Asiatic Acid Alleviates Ang-II Induced Cardiac Hypertrophy and Fibrosis via miR-126/PIK3R2 signaling

doi:10.21203/rs.3.rs-269028/v1

Download PDF

Research

Asiatic Acid Alleviates Ang-II Induced Cardiac Hypertrophy and Fibrosis via miR-126/PIK3R2 signaling

https://doi.org/10.21203/rs.3.rs-269028/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 13 Jul, 2021

Read the published version in Nutrition & Metabolism →

You are reading this latest preprint version

Background

Cardiac hypertrophy is an independent risk factor of many cardiovascular diseases. Studies demonstrated that microRNA-126 (miR-126) was involved in angiogenesis during physiological and pathological process. However, its role in cardiac hypertrophy has not been known clearly. Recent studies demonstrated asiatic acid (AA) has obvious protective effect on cardiac hypertrophy. Here, this study aimed to discover the regulatory role of miR-126 and its mechanism in cardiac hypertrophy, and to determine whether AA’s anti-hypertrophy effect is partially miR-126 dependent.

Methods

Male Sprague Dawley (SD) rats were AngII infused via osmotic minipumps for 4 weeks and were treated with AA (20mg/kg/day) by oral gavage. Cardiac protective hypertrophy was assessed using the echocardiography and histological analysis. And, the effect of AA on miR-126 and PI3K/AKT signaling pathway was investigated.

Results

Treatment of rats with AA decreased the ratio of heart weight to tibia length and hypertrophy markers. Moreover, our results found downregulation of miR-126 and activation of PI3K/AKT signaling AngII infusion induced cardiac hypertrophy model. It was also determined that miR-126 targets PIK3R2 directly.

Conclusions

AA supplementation upregulated the expression of miR-126 and conferred cardio-protection against AngII induced cardiac hypertrophy.

Nutrition & Dietetics

Cellular Metabolism

miR-126

PIK3R2

PI3K/Akt signaling pathway

Cardiac hypertrophy

Globally, cardiovascular disease (CVD) remains the leading cause of mortality and morbidity[1]. Cardiac hypertrophy is one of the most important stage during the development of CVD, but its mechanism has still not fully been understood. Pathological Cardiac hypertrophy is now recognized as an independent risk factor for heart disease, including coronary artery disease (CAD), arrhythmia, heart failure, hypertension and even sudden death[2].

Asiatic acid, a natural triterpenoid compound extracted from Centella asiatica, has been identified as a potential therapeutic agent as it demonstrates anti-hyperlipidemia, anti-inflammation[3], anti-fibrosis[4] and anti-oxidation[5]. Previous studied have reported that AA ameliorates liver fibrosis through regulating the PI3K/AKT/mTOR signaling pathway[6]. Our recent study demonstrated that AA attenuates cardiac fibrosis and improves cardiac function via regulating TGF-β1/Smads signaling pathway[7].

MicroRNAs (miRNAs), a kind of small non-coding RNAs containing approximately 22 nt[8], play important roles in almost all of physiology and pathophysiology process, including proliferation, apoptosis as well as fibrosis[9-11]. They serve as post-translational regulators and negatively regulate gene expression by binding to their complementary sequence within their target mRNAs 3’ untranslated regions (UTRs), leading to mRNA degradation or blocked translation[12]. Recently，the crucial role of miRNAs in cardiac function regulation has attracted much more attention[13, 14]. Interestingly, miR-126 was reported to play a critical role in angiogenesis by activating mitogen-activated protein kinase (MAPK) and PI3K/AKT signaling pathway[15, 16]. Previous studies reported the PI3K/AKT signaling pathway was involved in the development of cardiac hypertrophy and fibrosis[17]. miR-126 can regulate PI3K/AKT signaling pathway by targeting PIK3R2 (PI3K regulatory subunit 2)[18] and affect the proliferation, migration, and angiogenesis.

In the present study, we aimed to explore the regulatory role of miR-126 in cardiac anti-hypertrophy after AA treatment. Using AngII infusion induced hypertrophy model, we showed for the first time that AA alleviates cardiac hypertrophy is associated with miR-126/ PI3k/AKT signaling pathway. PI3k/AKT pathway was inactivated and regulated by miR-126. Our results might help to deepen the understanding of the role and function of miRNA-126 in cardiac hypertrophy. These findings offer important insights into fundamental mechanisms underlying functions of AA and miRNA, meantime, would provide a potential therapeutic targets for cardiac hypertrophy.

Materials

Asiatic acid (C₃₀H₄₈O_5,MW: 488.70) was purchased from Guangxi Changzhou Natural Products Development Co. Ltd (＞95% purity, Guangxi, China). Antibiotic-antimycotic solution (10,000 units/ml of penicillin, 10,000 ug/ml of streptomycin) Ang II was obtained from Sigma Chemical Co. (St Louis, MO, USA). Antibodies against ANP, β-MHC, PIK3R2, PI3K, p-PI3K, Akt, p-Akt, GAPDH were purchased from Abcam CO (Cambrige, UK).

Animal

8-week-old male Sprague Dawley (SD) rats (150-170 g body weight) were purchased from Beijing Vital River Laboratory Animal Technology Company (Beijing, China). All experiments involving rats were approved by the Institutional Animal Care Research Advisory Committee of the National Institute of Biological Science (NIBS) and Animal Care Committee of Zhengzhou University. All rats were maintained on a 12:12-h light-dark cycle and have free access to water and food.

Experimental design and treatment protocol

A rat model of Ang-II infusion induced cardiac hypertrophy were established. In brief, SD rats were quickly anesthetized with an intraperitoneal injection of sodium pentobarbital (50 mg/kg), then the prefilled osmotic minipumps (Alzet, Model 2002) were implanted into the subcutaneous tissue to deliver Ang II (Sigma-Aldrich, A9525) at 400 ng/kg/min for 4 weeks. Rats were randomly divided into two groups (10 mice/group) for different treatments by oral gavage for 4 weeks: Ang II group and Ang II +AA (AA 20mg/kg) group. Another ten SD rats as the wild control group sham group.

Cell culture

Rat cardiomyoblast H9c2 cells were cultured in DMEM with 15% FBS, 100 U/mL penicillin and 100 μg/mL streptomycin in a humidified atmosphere of 5% CO2 and 95% air at 37℃. Cells were incubated with AA 160uM with or without AngII 10uM for 24 h in a 6 well plate. Cell surface area analysis was performed using confocal microscopy as described previously [19].

Echocardiographic study

Transthoracic echocardiography was performed to access left ventricular (LV) function variables. Briefly, after the induction of general anesthesia, rats were placed in a supine position. Rats were underwent transthoracic two dimensional guided M-mode echocardiography with a 12L MHz transducer (Sibiscape Co. Ltd.). From the cardiac short axis, the LV anterior wall end-diastolic thickness (LVAWd), the systolic LV anterior wall thickness (LVAWs)，the LV internal dimension at end-diastole (LVIDd), the LV internal dimension at end-systole (LVIDs), the LV posterior wall end-diastolic thickness (LVPWd), the LV posterior wall end-systolic thickness (LVPWs), the ejection fraction (EF), and fractional shortening (FS) were measured.

Histological analysis

The left ventricle were fixed in 10% formalin and embedded in paraffin. Tissue sections (4um) were stained with 1.0 mg/ml Alexa Fluor 488^®conjugete of wheat germ agglutinin (WGA) solution（MolecularProbes, Eugene, OR, USA）to demonstrate the size of cardiomyocytes. The collagen deposition in the left ventricle was detected by Masson staining. Ten fields in each region of the heart were selected randomly from four nonconsecutive serial sections, and collagen content was quantified by measuring the total blue area per square millimeter using the ImageJ.

Dual-luciferase gene reporter assays

Based on the PIK3R2-wild type (wt), a complementary sequence mutation site of the seed sequence was designed as mutant type (mut). PIK3R2 wt and mut were amplified and cloned into a pGL3 vector containing the firefly luciferase reporter gene (ObiO, Shanghai, China). Human embryonic kidney (HEK) 293 cells were co-transfected with 100ng of recombinant luciferase reporter plasmid, 10ng of pRL-TK as an internal control, 50nM miR-126-3p mimic, or mimic control respectively. Luciferase activity and renilla luciferase were measured 24h after transfection using a dual-luciferase reporter assay. And the ratio of firefly luciferase/renilla luciferase was calculated and were used to reveal the interactions between miR-126 and PIK3R2.

Western blotting

At the end of experiment, rats were sacrificed and the heart were quickly removed. Left ventricle tissue were lysed by RIPA lysis buffer and phenylmethylsulfonyl fluoride (Beyotime, China). The protein concentration was detected by using a BCA protein assay kit. Equal amounts of protein (30μg) were separated using 10 or 12% SDS-PAGE and were transferred onto a polyvinylidene difluoride membrane (PVDF). Next, PVDF membranes were blocked with 5% fat-free milk and incubated with primary antibodies overnight at 4℃. Subsequently, the membranes were washed and incubated with secondary antibodies at room temperature. The optical density of the bands were visualized by an ECL system (Pierce). GAPDH was used as an endogenous control. Data was normalized to GAPDH levels.

RNA isolation and quantitative real-time PCR

Total RNA was extracted from the frozen tissues or treated H9c2 cells using Trizol reagent (Invitrogen, USA). First strand cDNA was synthesized using an RT kit (Invitrogen, USA). miRNA from heart was converted to cDNA using the miRNA 1^st Strand cDNA Synthisis Kit (Vazyme, Nanjing, China) according to the manufacturer’s protocol. Amplifications were performed using an opticon continuous fluorescence detection system with SYBR green fluorescence (Molecular Probes, Eugene, USA). A single melting curve peak confirmed the presence of a single product. Results were expressed as fold differences relative to GAPDH or U6 using the 2-ΔΔCT method. All the primers were synthesized by Sangon Biotech (Shanghai, China) and the sequence are listed in Table 1.

Table 1. Primers used for reverse transcription and real-time PCR

Primer Names

Sequences

ANP

Sense

Anti-Sense

CCTTCTCCATCACCAA

TGTTATCTTCGGTACCG

PIK3R2

Sense

Anti-Sense

ACTCACCTTCTGCTCCGTT

TCTGGTCCTGCTGGTATTTGG

Stem-loop

Sense

Anti-Sense

GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAA

AGAGAAGATTAGCATGGCCCCTG

ATCCAGTGCAGGGTCCGAGG

miR-126

Stem-loop

Sense

Anti-Sense

GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCGCATT

CGCGTCGTACCGTGAGTAAT

AGTGCAGGGTCCGAGGTATT

pri-miR-126

Sense

Anti-Sense

AAGGACCATTGTTGGCACTCAGG

TCTCACCACGCTGTCCACTCC

β-MHC

Sense

Anti-Sense

GCCGAGTCCCAGGTCAACAA

GTAATTCGAGGGCAGGAACCC

Co1 I

Sense

Anti-Sense

ACTCAGCCCTCTGTGCCT

CCTTCGCTTCCATACTCG

Co1 III

Sense

Anti-Sense

AGATGCTGGTGCTGAGAAG

TGGAAAGAAGTCTGAGGAAGG

GAPDH

Sense

Anti-Sense

GACATCAAGAAGGTGGTGAAGC

TGTCATTGAGAGCAATGCCAGC

Statistical analysis

All data are presented as means ± SEM. SPSS 21.0 was used to perform statistical analysis of the data. Statistical differences were calculated with the 2-tailed Student t test when comparing 2 conditions, and ANOVA was used when comparing ＞2 conditions. A value of P <0.05 was considered statistically significant.

AA attenuated AngII-induced cardiomyocyte growth and CF collagen expression in vitro

To investigate whether AA has a protective role on the development of cardiac hypertrophy, cell surface area and hypertrophic markers were assessed in H9C2 cells treated with AngII. Our results demonstrated that hypertrophic markers (ANP and BNP) and cell surface area were significantly increased in H9C2 cells treated with AngII 10μM for 24 h compared to the control group (Figure 1A, B and C). AA treatment was able to significantly inhibit the hypertrophic growth of cardiomhocytes and ANP and BNP mRNA levels in H9C2 cells following 24 h of AngII administration (Figure 1A, B and C). In addition, following AngII administration, the fibrotic markers α-SMA， Col1a1 and Col3a1 gene expression were increased in cardiac fibroblasts(CFs), and AA treatment significantly alleviated the increased expression of fibrotic markers(Figure1D,E and F).

AA ameliorated AngII-induced cardiac hypertrophy and fibrosis

An animal model of cardiac hypertrophy was established in rats received AngII infusion for 4 weeks. We measured the ratio of heart weight to tibia length (HW/TL) and evaluated cardiac function by echocardiogram. AngII infusion rats show a significant increase in the ratio of weight/tibia length (HW/TL), and this increase was attenuated in AA-treated rats (Figure 2A). The thickness of the left ventricular post wall at the end-diastole (LVPWd) and the end-systole (LVPWs) was higher in AngII infusion rats, while AA treatment attenuated these alterations (Figure 2B). Results of WGA staining showed that the cell size of cardiomyocytes was significantly increased in the myocardium of the Ang-II infusion animal model, which was significantly attenuated in AA-treated rats (Figure 2C). To determine the effect of AA on cardiac fibrosis, heart sections were stained with Masson’s staining. In Figure 2D, interstitial fibrosis is demonstrated by the blue areas. Quantitative data suggest that AA-treated rats displayed less collagen deposition than AngII-induced rats (Figure 2D). Meanwhile, significant increase of ANP and β-MHC protein expression was observed in the hypertrophic rat myocardium, while their expression was inhibited in AA-treated rat (Figure 2E). Collectively, AA treatment can inhibit AngII-induced cardiac hypertrophy and fibrosis.

AA promote the expression of miRNA-126 in the hypertrophic AngII-infused rats

To explore novel mechanisms underlying the anti-hypertrophy effects of AA, we focused on miR-126 which has attracted a lot of attention in angiogenesis. Furthermore, we investigated whether miR-126 could contribute to cardiac hypertrophy. The results of qRT-PCR showed that mature miR-126 expression was remarkably decreased whereas unprocessed pri-miRNA-126 was increased in AngII infusion rats compared with control rats (Figure 2E), and AA treatment elevated the levels of miR-126 while decreased that of pri-miRNA-126 (Figure 2E).

AA suppress expression of PIK3R2 and PI3K/Akt signaling pathway in hypertrophic AngII-infused rats

Real-time PCR and western blotting analysis were performed to investigate the expression of PIK3R2 mRNA and protein level. Compared with the sham group, the expression of PIK3R2 mRNA and protein were significantly increased in Ang-II infusion rats (Figure 3A and 3B). We further determined whether the PI3K/Akt signaling pathway was activated in hypertrophy myocardium. Our results demonstrated that PI3K and Akt phosphorylation increased in Ang II-infusion rat group (Figure 3B). And AA treatment significantly attenuated PIK3R2 upregulation and PI3K/Akt signaling pathway activation (Figure 3B). There was no significant difference in total PI3K and total Akt between the control group and Ang-II infusion groups (Figure3B).

PIK3R2 is a target gene of miR-126

Considering the expression of miR-126 is inversely related with that of the PIK3R2, it seems reasonable to speculate that miR-126 could directly regulate PIK3R2 expression. TargetScan were used to search for the targets of miR-126. The putative target sites for binding of PIK3R2 and miR-126 is shown in Figure.4A. Mutation was constructed to the putative target sites on the 3’-UTR of PIK3R2. Dual luciferase reporter gene assay was performed to further verify the potential interaction of miR-126 with the 3’-UTR of PIK3R2. Results revealed that compared with the NC group, overexpression of miR-126 significantly inhibited the luciferase activity of PIK3R2-3’-UTR-wt, while exerted no obvious effect on luciferase activity of the PIK3R2-3’-UTR-mut (Figure 4B). Taken together, miR-126 could specifically bind to PIK3R2-3’-UTR and down-regulate PIK3R2 gene expression at the post-transcriptional level. So, in this section, we confirmed that PIK3R2 is a target of miR-126.

Cardiac hypertrophy and fibrosis caused by multiple diseases including hypertension and heart valvular disease, have become a major cause of morbidity and mortality for people from both the developed and the developing countries. A better understanding of the mechanisms underlying cardiac hypertrophy and fibrosis is important for developing more effective diagnostic and therapeutic strategies. In the present study, we found that miRNA-126 were markedly downregulated in the myocardium of AngII-infused rats, PIK3R2 is a target of miRNA-126, and AA supplementation was able to prevent pathological cardiac hypertrophy and fibrosis by upregulation of miR-126 and inhibition of PI3K/AKT signaling pathway.

AA has been proved to inhibit renal fibrosis and left ventricular remolding. In our previous study, we found AA could inhibit AngII-induced proliferation of CFs and the pressure overload-induced cardiac hypertrophy and fibrosis. Here, an important finding of our study is that AA protected the heart from hypertrophy and fibrosis in response to AngII through upregulation of miR-126 and activation of PI3K/AKT signaling pathway. Our study is the first to show that AngII-induced cardiac hypertrophy and fibrosis is associated with decreased expression of miRNA-126.

miRNAs regulate gene expression at the transcriptional or translational level by binding to the 3’UTR of mRNAs, and affect a variety of cellular pathways. Previous studies have reported associations of miR-126 with angiogenesis[20], atherosclerosis[21] and tumorigenic process[22]. Recently, a study showed that reduction of miRNA-126 drove lung fibrosis by activating the PI3K/AKT/mTOR pathway after carbon black treatment[15]. We found a decrease level of miRNA-126 and an increase level of PIK3R2 in rat cardiac tissue in response to AngII infusion. Considering the expression of miR-126 is inversely related with that of the PIK3R2, we speculated that miR-126 could directly regulate PIK3R2 expression. In our study, we confirmed that PIK3R2 is a target of miR-126, and this finding is consistent with previous studies[15].

Many studies reported that PI3K/AKT signaling pathway was involved in the development of fibrotic diseases, such as pulmonary fibrosis[23], liver fibrosis[6] and cardiac fibrosis[24]. We also found that PI3K/AKT signaling pathway was activated in AngII-infusion rats, while those effects were suppressed by AA supplementation.

In this study, we arrived at a conclusion that miR-126 targeting PIK3R2 activating the PI3K/AKT signaling pathway, and promoted cardiac hypertrophy and fibrosis in AngII-induced rats. Our study supports the notion that upregulation of miR-126 or inhibition of PI3K/AKT signaling pathway can represent a novel target for future development of therapeutic strategies for cardiac hypertrophy and fibrosis. Therefore, AA supplementation may be considered as potential prevention strategy for cardiac hypertrophy and fibrosis.

AA: asiatic acid (AA); SD: Sprague Dawley; CVD: cardiovascular disease; CAD: coronary artery disease; UTRs: untranslated regions; MAPK: mitogen-activated protein kinase; LV: left ventricular; LVAWd: the LV anterior wall end-diastolic thickness; LVAWs: the systolic LV anterior wall thickness; LVIDs: the LV internal dimension at end-systole; LVPWd: the LV posterior wall end-diastolic thickness; LVPWs: the LV posterior wall end-systolic thickness; EF: the ejection fraction; FS: fractional shortening; WGA: wheat germ agglutinin; PVDF: polyvinylidene difluoride membrane; CFs: cardiac fibroblasts.

Acknowledgment

Not applicable

Funding

This work was supported by National Natural Science Foundation of Henan (Grant No. 202300410396 ).

Availability of data and materials

All data generated of analyzed during this study are included in this published article or are available from the corresponding author on reasonable request.

Author’s contributions

ZM designed the study; HYL, XXT, YJR and JHX conducted the experiments; XXT did sample analysis and data analysis, HYL wrote the manuscript; ZM revised the paper. HYL and XXT contributed equally to this work. All authors read and approved the final manuscript.

Ethics approval and consent to participate

This study was approved by the ethics committee of Zhengzhou University.

Consent for publication

Not applicable

Competing interest

The authors have no conflicts of interest to disclose.

Benjamin EJ, Muntner P, Alonso A, Bittencourt MS, Callaway CW, Carson AP, Chamberlain AM, Chang AR, Cheng S, Das SR, et al: Heart Disease and Stroke Statistics-2019 Update: A Report From the American Heart Association.Circulation 2019, 139:e56-e528.
Luscher TF: Predictors as well as surrogate and hard endpoints in cardiovascular disease.Eur Heart J 2015, 36:2197-2199.
Park JH, Seo YH, Jang JH, Jeong CH, Lee S, Park B: Asiatic acid attenuates methamphetamine-induced neuroinflammation and neurotoxicity through blocking of NF-kB/STAT3/ERK and mitochondria-mediated apoptosis pathway.J Neuroinflammation 2017, 14:240.
Zhang ZH, He JQ, Zhao YY, Chen HC, Tan NH: Asiatic acid prevents renal fibrosis in UUO rats via promoting the production of 15d-PGJ2, an endogenous ligand of PPAR-gamma.Acta Pharmacol Sin 2020, 41:373-382.
Pakdeechote P, Bunbupha S, Kukongviriyapan U, Prachaney P, Khrisanapant W, Kukongviriyapan V: Asiatic acid alleviates hemodynamic and metabolic alterations via restoring eNOS/iNOS expression, oxidative stress, and inflammation in diet-induced metabolic syndrome rats.Nutrients 2014, 6:355-370.
Wei L, Chen Q, Guo A, Fan J, Wang R, Zhang H: Asiatic acid attenuates CCl4-induced liver fibrosis in rats by regulating the PI3K/AKT/mTOR and Bcl-2/Bax signaling pathways.Int Immunopharmacol 2018, 60:1-8.
Meng Z, Li HY, Si CY, Liu YZ, Teng S: Asiatic acid inhibits cardiac fibrosis throughNrf2/HO-1 and TGF-beta1/Smads signaling pathways in spontaneous hypertension rats.Int Immunopharmacol 2019, 74:105712.
Gebert LFR, MacRae IJ: Regulation of microRNA function in animals.Nat Rev Mol Cell Biol 2019, 20:21-37.
Huleihel L, Ben-Yehudah A, Milosevic J, Yu G, Pandit K, Sakamoto K, Yousef H, LeJeune M, Coon TA, Redinger CJ, et al: Let-7d microRNA affects mesenchymal phenotypic properties of lung fibroblasts.Am J Physiol Lung Cell Mol Physiol 2014, 306:L534-542.
Ji X, Wu B, Fan J, Han R, Luo C, Wang T, Yang J, Han L, Zhu B, Wei D, et al: The Anti-fibrotic Effects and Mechanisms of MicroRNA-486-5p in Pulmonary Fibrosis.Sci Rep 2015, 5:14131.
Liu G, Friggeri A, Yang Y, Milosevic J, Ding Q, Thannickal VJ, Kaminski N, Abraham E: miR-21 mediates fibrogenic activation of pulmonary fibroblasts and lung fibrosis.J Exp Med 2010, 207:1589-1597.
Berezikov E: Evolution of microRNA diversity and regulation in animals.Nat Rev Genet 2011, 12:846-860.
D'Alessandra Y, Devanna P, Limana F, Straino S, Di Carlo A, Brambilla PG, Rubino M, Carena MC, Spazzafumo L, De Simone M, et al: Circulating microRNAs are new and sensitive biomarkers of myocardial infarction.Eur Heart J 2010, 31:2765-2773.
Anfossi S, Babayan A, Pantel K, Calin GA: Clinical utility of circulating non-coding RNAs - an update.Nat Rev Clin Oncol 2018, 15:541-563.
Han B, Chu C, Su X, Zhang N, Zhou L, Zhang M, Yang S, Shi L, Zhao B, Niu Y, Zhang R: N(6)-methyladenosine-dependent primary microRNA-126 processing activated PI3K-AKT-mTOR pathway drove the development of pulmonary fibrosis induced by nanoscale carbon black particles in rats.Nanotoxicology 2020, 14:1-20.
D. A. Silva ND J, Fernandes T, Soci UP, Monteiro AW, Phillips MI, EM DEO: Swimming training in rats increases cardiac MicroRNA-126 expression and angiogenesis.Med Sci Sports Exerc 2012, 44:1453-1462.
Yu SY, Liu L, Li P, Li J: Rapamycin inhibits the mTOR/p70S6K pathway and attenuates cardiac fibrosis in adriamycin-induced dilated cardiomyopathy.Thorac Cardiovasc Surg 2013, 61:223-228.
Song L, Li D, Gu Y, Wen ZM, Jie J, Zhao D, Peng LP: MicroRNA-126 Targeting PIK3R2 Inhibits NSCLC A549 Cell Proliferation, Migration, and Invasion by Regulation of PTEN/PI3K/AKT Pathway.Clin Lung Cancer 2016, 17:e65-e75.
Tse MM, Aboutabl ME, Althurwi HN, Elshenawy OH, Abdelhamid G, El-Kadi AO: Cytochrome P450 epoxygenase metabolite, 14,15-EET, protects against isoproterenol-induced cellular hypertrophy in H9c2 rat cell line.Vascul Pharmacol 2013, 58:363-373.
Fish JE, Santoro MM, Morton SU, Yu S, Yeh RF, Wythe JD, Ivey KN, Bruneau BG, Stainier DY, Srivastava D: miR-126 regulates angiogenic signaling and vascular integrity.Dev Cell 2008, 15:272-284.
Economou EK, Oikonomou E, Siasos G, Papageorgiou N, Tsalamandris S, Mourouzis K, Papaioanou S, Tousoulis D: The role of microRNAs in coronary artery disease: From pathophysiology to diagnosis and treatment.Atherosclerosis 2015, 241:624-633.
Meister J, Schmidt MHH: miR-126 and miR-126*: new players in cancer.ScientificWorldJournal 2010, 10:2090-2100.
Hu X, Xu Q, Wan H, Hu Y, Xing S, Yang H, Gao Y, He Z: PI3K-Akt-mTOR/PFKFB3 pathway mediated lung fibroblast aerobic glycolysis and collagen synthesis in lipopolysaccharide-induced pulmonary fibrosis.Lab Invest 2020, 100:801-811.
Wang X, Chen L, Zhao X, Xiao L, Yi S, Kong Y, Jiang Y, Zhang J: A cathelicidin-related antimicrobial peptide suppresses cardiac hypertrophy induced by pressure overload by regulating IGFR1/PI3K/AKT and TLR9/AMPKalpha.Cell Death Dis 2020, 11:96.

Download PDF

Journal Publication

published 13 Jul, 2021

Read the published version in Nutrition & Metabolism →

Editorial decision: Minor revision
10 Apr, 2021
Review #2 received at journal
31 Mar, 2021
Review #1 received at journal
22 Mar, 2021
Reviewer #2 agreed at journal
16 Mar, 2021
Reviewers invited by journal
03 Mar, 2021
Reviews received at journal
03 Mar, 2021
Reviewer #1 agreed at journal
03 Mar, 2021
Editor assigned by journal
22 Feb, 2021
Submission checks completed at journal
22 Feb, 2021
Editor invited by journal
22 Feb, 2021
First submitted to journal
22 Feb, 2021

You are reading this latest preprint version

Asiatic Acid Alleviates Ang-II Induced Cardiac Hypertrophy and Fibrosis via miR-126/PIK3R2 signaling

Status:

Journal Publication

Version 1

Abstract

Figures

Background

Methods

Results

Discussion

Conclusions

Abbreviations

Declarations

References

Status:

Journal Publication

Version 1