Culture of human skeletal muscle cell line HSkMC cells
The human skeletal muscle cell line (HSkMC) was purchased from BeNa Bio (Beijing, China). HSkMC cells were thawed and centrifuged at 1000 rpm for 5 min. The supernatant was discarded, and the cells were resuspended in high-glucose DMEM medium (containing 10% fetal bovine serum, 100,000 U/L penicillin, 100 mg/L streptomycin), transferred to 6 cm cell culture dishes, and cultured at 37 ℃, 5% CO2 and saturated humidity. The cells were passaged once every 2 ~ 3 d, 2 or 3 times per week according to the cell growth. The cells were observed under an ordinary inverted microscope when they reached the logarithmic phase for subsequent experiments.
Construction Of Pten-overexpressed Lentivirus
The PTEN overexpressed lentivirus vector was completed by Gikech Gene (Technology Co., LTD.). Briefly, the forward and reverse primers for amplifying human PTEN (NM_000314) CDS were designed based on the NCBI database, and the AgeI cleavage site was added at the 5' end of the primers. The CDS region of PTEN was amplified using a Polymerase Chain Reaction (PCR). The results of the PCR reaction were examined on agarose gels, and gels of similar size to the target gene were cut and recovered. At the same time, AgeI performed enzyme digestion on the overexpressed vector GV358, and the PCR product recovered from cutting gum. After digestion, the enzyme cut PCR product was mixed with GV358 linear vector and incubated at 37°C for 30 min under the action of recombinase ExnaseTM II. After the PCR product was recombined with GV358, a circular recombinant plasmid was formed. The recombinant plasmid product was transformed into competent cells and amplified by picking monoclonal colonies after 12–16 h incubation in culture plates supplemented with ampicillin. The recombinant vector was identified by sequencing, the monoclonal liquid with correct sequencing was amplified, and the plasmid was prepared. The GV358 vector plasmid containing PTEN-overexpressed sequence and two other virus-packing AIDS, pHelper1.0 and pHelper2.0 plasmid, were co-transfected into HT293 cell lines. The virus was harvested for 48–72 hours, tested for virus quality and titer, and stored in a refrigerator at -80°C.
Construction Of Hskmc Cells With Stable Overexpression Of Pten
HSkMC cells were inoculated in a 6-well plate at 1 × 105/well, and the cells were in the logarithmic growth phase after 24 hours, and the number was about 2 × 105/well. The original medium was replaced with 2 ml of fresh medium containing 6 µg/ml polybrene, and appropriate viral suspension (MOI = 10) was added. After incubating at 37℃ for 12 h, the medium was replaced with the virus-free medium. The transfection efficiency was observed by the green fluorescence of GFP under an inverted fluorescence microscope after continued culture for 36 h. When the cell growth reached 80%, 1 µg/ml puromycin (Solarbio, Beijing, China) was added to screen stably transfected cells. After the screening, cells were photographed, and images were collected under an inverted fluorescence microscope, as shown in Fig. 1. The positive rate of cells with GFP was over 90% (Fig. 1A), and the expression of PTEN in the cells was detected by Western blotting assay, and it was found that the relative amount of PTEN expression in the overexpression group (PTEN-OE) was significantly higher than that in the control group (PTEN-NC) cells transfected with empty vector (Fig. 1B, C).
Drug Treatment Of Hskmc Cells
HSkMC cells transfected with or without PTEN overexpression lentivirus were treated with 100 µM DBP with or without 1 µM concentration of PI3K inhibitor BKMI20, and the control group was treated with an equal volume of DMSO. 24 h later, cells were collected for subsequent Real-time quantitative PCR (RT-qPCR) and Western blotting.
Rt-qpcr Experiment
Cells were lysed with TRIzol reagent (Shanghai, China), and total RNA was extracted and reversed to cDNA. Then RT-qPCR was performed according to the reaction system of SYBR Fluorescent Dye Kit (Takara, Japan) on an ABIQ6FLEX fluorescence quantitative PCR instrument (Thermo Fisher Scientific). The conditions of RT-qPCR amplification were as follows: 95°C 30 s predenaturation, 95°C 15 s, 60°C 30 s, a total of 40 cycles of PCR reaction. The primer sequences used in this study are shown in Table 1. The ΔΔCt value method was used to quantify the results using GAPDH as an internal reference. Each experiment was independently repeated, with each sample detected for three duplications.
Table 1
Primer sequences used for RT-qPCR
Gene | Forward Primer | Reverse Primer |
InsR | AAAACGAGGCCCGAAGATTTC | GAGCCCATAGACCCGGAAG |
PTEN | TTTGAAGACCATAACCCACCAC | ATTACACCAGTTCGTCCCTTTC |
IRS-1 | ACAAACGCTTCTTCGTACTGC | AGTCAGCCCGCTTGTTGATG |
AKT-2 | GGTGCAGAGATTGTCTCGGC | GCCCGGCCATAGTCATTGTC |
GLUT-4 | GACCAGCACTCCCAAGGTTAC | CTGGCCCGGAAGACATCTG |
PI3K | CTGCCTGCGACAGATGAGTG | TCCGATTACCAAGTGCTCTTTC |
GAPDH | CTGGGCTACACTGAGCACC | AAGTGGTCGTTGAGGGCAATG |
Western Blotting
HSKMC cells were collected after different treatments, and cell lysate containing PMSF (RIPA: PMSF = 100: 1) (Beyotime, Shanghai, China)was added to extract the total protein. The total protein concentration was quantified using BCA, SDS polyacrylamide gel electrophoresis was performed, and protein was transferred to the PVDF membrane and closed at room temperature for one h with 5% BSA. After being washed, the bands were incubated with primary antibodies, including anti-porimin (Beyotime, Shanghai, Chian, 1:500) and anti-caspase-3 (Beyotime, Shanghai, Chian, 1:1000) at 4 ℃ overnight. The bands were washed three times with TBST (5 min/ time) and incubated with the second antibody (Beyotime, Shanghai, Chian, 1:10000) at room temperature for one h. After being washed three times with TBST (5 min/time), an ECL (Solarbio, Shanghai, China) was used for color development and exposure. The optical density of the target protein was corrected using β-actin and analyzed with Image J.
Statistical analysis
SPSS 22.0 software was used for statistical analysis. The data were expressed as means ± standard deviation (SD) for normally distributed measures, and the student's t-test was used to compare the means of two samples to determine if the variances were homogeneous. If the variances were not homogeneous, the student's t-test was used to compare the means of two samples, and one-way ANOVA was used to compare the means of multiple samples. LSD-test was used to compare groups if the variances were homogeneous, and if the variances were uneven, the rank sum test was used to compare groups. P < 0.05 was considered statistically significant.