MSC-derived exosomes protect auditory hair cells from neomycin-induced damage via autophagy regulation

doi:10.21203/rs.3.rs-2804788/v1

Download PDF

Research Article

MSC-derived exosomes protect auditory hair cells from neomycin-induced damage via autophagy regulation

https://doi.org/10.21203/rs.3.rs-2804788/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Increasing incidence of sensorineural hearing loss (SNHL) has raised concerns over the disease, while the limited treatment options have motivated the study of new biological therapies. Among these, mesenchymal stem cell (MSC) transplantation has been shown to improve hearing function, and accumulating evidence indicates that MSCs could impart their therapeutic effects by secreting exosomes. However, the underlying therapeutic mechanisms are not fully understood. Herein, in a neomycin-induced SNHL model, we found that exosomes released by MSCs rescued hearing loss and ameliorated hair cell loss by regulating autophagy of the recipient hair cells. Mechanistically, exogenous exosomes could be engulfed by hair cells after treatment. Then, in the hair cells, exosomes promoted the expression of endocytic genes and the formation of endosomes, thus inducing autophagy activation. Finally, the enhanced autophagy promoted cell survival, reduced mitochondrial oxidative stress and apoptosis of hair cells, and attenuated neomycin-induced ototoxic damage. Collectively, our study unveiled the otoprotective role of autophagy activated by exogenous exosomes in hair cells, and verified the potential of extracellular vesicle-based biological therapy for SNHL caused by neomycin.

Mesenchymal stem cell

exosome

hair cell

neomycin

aminoglycoside

autophagy

endocytosis

Disabling hearing loss, which affects approximately 5% of the global population (about 430 million people), is one of the most common sensory disorders in humans, and has therefore attracted growing attention worldwide[1]. Genetic mutations, noise, ototoxic drugs, and aging can contribute to sensorineural hearing loss (SNHL)[2]. Treatment of SNHL remains a challenge since hair cells, which are terminally differentiated cells, are difficult to regenerate and recover once damaged[3]. Current treatments rely heavily on devices such as hearing aids and cochlear implants, and there is no FDA-approved drug for the condition[4].

Limitations in treatment have motivated the study of biological alternatives, such as gene therapy, growth factor therapy, molecular strategies, and stem-cell therapy [2, 3, 5]. In the latter cases, mesenchymal stem cells (MSCs) are suitable candidates for cell-based medical therapies, since MSCs exhibit remarkable potential to repair or regenerate damaged cochlear hair cells and rescue hearing loss in SNHL animal models[6]. However, the underlying therapeutic mechanisms are not fully understood. Accumulating results indicate that MSCs could impart their ultimate therapeutic effect by producing exosomes. Exosomes, extracellular vesicles with diameters of 40–150 nm, can act as messengers carrying various bioactive payloads including proteins, lipids, and nucleic acids, and regulate pathways associated with inflammation, proliferation, apoptosis, differentiation, and metabolism[7–9]. To date, it has been shown that exosomes released by inner ear tissue can mediate nonautonomous survival signaling and protect sensory hair cells against lethal stress through carrying heat shock protein 70 (HSP70) [10, 11]. This suggests that exosomes derived from MSCs may be valuable therapeutic agents to prevent or reverse hearing loss. However, the underlying therapeutic mechanisms of exosomes are not completely understood.

Autophagy is an orderly cellular pathway that degrades unnecessary or abnormal cellular components through a highly conserved catabolic process in all eukaryotic cells[12]. This pathway acts as a protective mechanism for cochlear hair cells against damage induced by noise exposure, ototoxic drugs, and aging[13, 14]. Studies have demonstrated that autophagy and exosomes may be regulated concomitantly or reciprocally according to the cellular conditions, and exosomes have been shown to regulate the intracellular autophagic process[15]. In addition, to generate biological effects, exosomes need to fuse with the cell membrane or internalized by recipient cells through endocytosis, which may affect recipient cell’s biological functions. Interestingly, accumulating evidence indicates that endocytosis is critical and necessary for autophagy[15, 16]. Therefore, it is reasonable to investigate whether exosomes could induce endocytosis to mediate the biological effects on hair cells via autophagy.

In this study, we selected a neomycin-induced SNHL model to address these challenges, since the impairment of hair cells induced by ototoxic drugs is one of the major causes of SNHL, and aminoglycoside antibiotics, such as neomycin, are among the major classes of ototoxic drugs. Umbilical cord mesenchymal stem cells (UC-MSCs), one of the most widely applied in clinical trials, were used in our study[17]. In the present study, we investigated the protective effect of MSC-derived exosomes on hair cells in a neomycin-induced SNHL model and the potential role of the vesicles for enhancement of autophagy activity in hair cells. We found that exosomes derived from MSCs protected hair cells from neomycin-induced damage and promoted their autophagy. Mechanistically, we found that exosomes promoted expression of endocytic genes and formation of endosomes, which are required for exosome-induced autophagy activation, thereby rescuing the loss of cochlear hair cells and ameliorating hearing damage.

Animals

Wild-type C57BL/6 mice were used for in vivo studies. The 7-day-old mice were injected subcutaneously with neomycin once per day for five consecutive days at a dose of 200 mg/kg. The detailed protocol for neomycin administration was given previously[18]. Two days later, exosomes (20 µg in 10 µl PBS) were injected into the mice through the round window niche (RWN)injection. The control group was injected with the same amount of sterile saline or PBS into the same region without neomycin and exosomes. Autophagy inhibition in mice was achieved through intraperitoneal (IP) injection of 3-MA at a dose of 30 mg/kg, administrated three times at 24 h before, 2 h before and immediately after RWN treatment. The hearing threshold was evaluated by ABR measurement at P28. After ABR measurement, cochlear tissues were collected for immunofluorescence staining. CAG-RFP-EGFP-LC3 transgenic mice (Jackson Laboratory, 027139) obtained from the Jackson Laboratory were used to test the level of autophagy in the cochlear hair cells.

Cell culture, tissue culture and reagents

Umbilical cord mesenchymal stem cells (UC-MSCs) were purchased from Procell (CP-CL11, China) and cultured in ααmodified Eagle medium(α-MEM) (Gibco, USA) supplemented with 10% FBS (Sijiqing, China), 2 mM L-glutamine (Invitrogen, USA), 100 U/mL penicillin and 100 U/mL streptomycin (Invitrogen, USA). Cochleae were dissected from P1-3 mice and cultured as previously reported[19]. Briefly, cochleae were dissected and cleaned of surrounding tissue and bone in Hank’s Balanced Salt Solution (Solabio, H1045; China). The cochlear explants were attached to a glass coverslip coated with collagen solution (10X Basal Medium Eagle (BME; Sigma, B9638), 2% sodium carbonate (Sigma, S7795), collagen gel type I (Corning, 354236), in a 1:1:9 ratio)[20]. The explants were incubated in DMEM/F12 medium supplemented with N2/B27 (Gibco, 17502048/17504044, USA) and ampicillin at 37°C with 5% CO2 overnight prior to each treatment to stabilize them. Neomycin sulfate (Sigma-Aldrich, USA, N6386) was used to damage hair cells. HEI-OC1 cells were cultured at 33°C with 10% CO2 in high-glucose Dulbecco's Eagle's medium (DMEM) containing 10% FBS without antibiotics. When cells reached a suitable density, neomycin was added to the medium at a final concentration of 2 mM to damage the HEI-OC1 cells. 3-MA (HY-19312), Dynasore (HY-13863), and Cytochalasin D (HY-N6682) were purchased from MCE (USA).

Western blot

Cells and tissue samples were lysed with RIPA buffer (Beyotime, China) containing protease inhibitor. Protein quantification was performed using a BCA assay (Beyotime, China). Extracted proteins (30 µg) were separated by SDS-polyacrylamide gel electrophoresis (PAGE) and transferred onto PVDF membranes. The membranes were blocked with 5% bovine serum albumin for 1 hour at room temperature, followed by incubation with primary antibodies overnight at 4°C. After washing with Tris-buffered saline-Tween three times, the membranes were incubated with secondary antibodies for 2 hours at room temperature. The following primary antibodies were used: Alix (1:1000; Cell Signaling, 92880, USA), CD9 (1:1000; Abcam, ab236630, USA),CD63 (1:1000; Santa Cruz Biotechnology, sc-5275, USA), CD81 (1:1000; Santa Cruz Biotechnology, sc-9158, USA), GAPDH (1:5000; CWBIO, CW0100, China), Cleaved Caspase-3 (1:1000; Cell Signaling, 9661s, USA), LC3A/B (1:1000; Cell Signaling 12741, USA), CAV(1:1000; Abcam, ab133484, USA), EEA1(1:1000; Abcam, ab109110, USA).

Isolation and characterization of exosomes

Cell supernatant was first centrifuged at 800×g for 10 min to remove cells or cell debris. The supernatant was then centrifuged at 16,000×g for 30 min to remove microvesicles. Next, the supernatant was ultracentrifuged at 150,000×g for 70 min at 4℃, washed with PBS, and purified by ultracentrifugation at 150,000×g for additional 70 min. Exosomes derived from MSCs were collected from the bottom of the tube and resuspended in sterile PBS for further use. The protein concertation was measured by BCA kit (Beyotime). The size distribution of exosomes was analyzed using nanoparticle tracking analysis (NTA) with Zeta View PMX 110 (Particle Metrix) and corresponding software, Zeta View 8.04.02. Exosomes were also observed directly under a transmission electron microscopy (TECNAI Spirit, FEI).

Internalization of ABs into ECs in vitro

The cochlear explants were plated onto dishes and maintained at 37°C overnight. Exosomes were pre-labeled with the PKH26 Red Fluorescent Cell Linker Kit (Sigma-Aldrich, USA) according to the manufacturer’s instructions and washed in PBS with ultracentrifugation at 150,000 × g for 70 min. PKH26-labeled exosomes at a concentration of 20 µg/ml were then co-cultured with cochlear explants for 8 h. After fixation with 4% paraformaldehyde for 20 min at 4°C, the cells were used for immunofluorescence staining.

Immunofluorescence

The samples were fixed in 4% paraformaldehyde (PFA) for 20 min and permeabilized with 0.5% Triton X-100 for 15min. After washing with PBS, the samples were incubated with primary antibodies at 4°C overnight, followed by treatment with Cy-3- or FITC-conjugated IgG secondary antibody (1:200; Jackson, USA) for 2 h at room temperature. Cell nuclei were counter-stained with Hoechst 33342 for 5 min at room temperature. For autophagy flux assay, HEI-OC1 cells were infected with adenoviruses expressing mRFP-GFP-LC3 (MOI 25, Genechem, China) for 72 h and then treated with exosomes and/or CQ. Images were obtained using the laser scanning confocal microscope (Olympus or Nikon) and quantified. The following primary and secondary antibodies were used in the immunofluorescence studies: Myosin7a (1:400; Proteus biosciences, 25-6790, USA), Cleaved Caspase-3 (1:1000; Cell Signaling, 9661s, USA), EEA1(1:100; Abcam, ab109110, USA), FITC-conjugated goat anti-rabbit IgG (1:200, Jackson, 111-095-003, USA), and Cy3-conjugated goat anti-rabbit IgG (1:200, Jackson, 111-165-003, USA). Rhodamine-phalloidin (Cytoskeleton, PHDR1, USA), Mito-SOX Red (Invitrogen, M36008, USA), and TUNEL kit (Beyotime, C1090, China) was used to label or measure F-actin, ROS levels and apoptosis according to the manufacturer’s instructions.

Gene expression analysis by real-time qRT-PCR

Total RNA was extracted with TRIzol reagent (Invitrogen, USA), and one microgram of total RNA was reverse transcribed into cDNA with a Prime Script RT reagent kit (TaKaRa, Japan). Real-time PCR was performed with SYBR Green dye and Taq polymerase (BioRad, USA). Gene expression was normalized to an internal control. The primer sequences are shown in Table 1.

Table 1

Primers for real-time PCR
Gene	Description	Primer sequence
GAPDH	m-GAPDH-F	5'- AGGTCGGTGTGAACGGATTTG − 3'
GAPDH	m-GAPDH-R	5'- GGGGTCGTTGATGGCAACA − 3'
Cav2	m-Cav2-F	5'- CTCACCAGCTCAACTCTCATCTC-3'
Cav2	m-Cav2-R	5'- CAACGTCTGTCACACTCTTCCATA-3'
Rab5a	h- Rab5a -F	5'- CCTTTCTAACCCAAACTGTGTGTCT-3'
Rab5a	h- Rab5a -R	5'- CTCGCAAAGGATTCCTCATTTG-3'
Rab7a	h- Rab7a -F	5'- TTGTGTCTCCTCCTCCGTTGAC-3'
Rab7a	h- Rab7a -R	5'- CCGCTCCTATTGTGGCTTTGTA-3'
Clta	h- Clta -F	5'- CAAGAAGCGGAGTGGAAAGAAA − 3'
Clta	h- Clta -R	5'- CATAACCAATCAGGTCAGCGAA − 3'
Ap2a2	h- Ap2a2-F	5'- GCTGGCATAATACACACCAAAAC-3'
Ap2a2	h- Ap2a2-R	5'- GAGAGAGACAAGAGAGACGCACA-3'
Abc1	h- Abc1-F	5'- TCGTCTTCCTGTCTGTGTTTGC-3'
Abc1	h- Abc1-R	5'- TGGACCCCGATACCTTGCT-3'
Tom1	h- Tom1-F	5'- CTCAGAGACACCATCCAGACAGAAC-3'
Tom1	h- Tom1-R	5'- GGTGCGGTTCAGTTCCTGTAGTAG-3'
Aak1	h- Aak1-F	5'- CTACTTCACTTTGCCGTTTGGG-3'
Aak1	h- Aak1-R	5'- CCTTTTGTCAGGGTCTGGTTCC-3'
Snx2	h- Snx2-F	5'- CTGTCACTCCCACCACACTCA-3'
Snx2	h- Snx2-R	5'- ATGCCATCACCAACTTTTTCC-3'

Flow cytometry

Annexin V and PI assays were conducted to measure the apoptosis of HEI-OC1 cells using the Annexin V-FITC/PI Apoptosis Detection Kit (BD Biosciences, 556547, USA) according to the manufacturer’s instructions. The cells were collected and resuspended in 500 µL of binding buffer, and stained with 15 µL of FITC labelled Annexin V and 5 µL of PI for 30 minutes at 4°C. The stained cells were then analyzed by flow cytometry (Beckman-Coulter, USA).

Electron microscopy

Cochleae and HEI-OC1 cells were collected and immediately fixed in 2.5% glutaraldehyde for 24 h and then in 1% osmic acid for 2 h, dehydrated with acetone, and embedded in Epon 812. The ultrathin sections were stained with alcoholic uranyl acetate and lead citrate, washed gently with distilled water, and observed with transmission electron microscope (TECNAI Spirit, FEI).

ABR test

Under light anesthesia with sodium pentobarbital (40 mg/kg), the reference, ground, and active needle electrodes were inserted beneath the skin of the post-measured auricle, the sacrococcygeal region, and the calvaria of each rat, respectively. ABR was measured using the Tucker-Davis Technology RZ6 system (TuckerDavies Technologies, Gainesville, FL, USA) at 4, 8, 16, 24, and 32 kHz, respectively. ABR waves I and II were monitored to assess thresholds.

Statistical analysis

Data were expressed as mean ± s.d as indicated. Comparisons between two groups were performed by Student’s t-test, and multiple group comparisons were performed by one-way ANOVA. Tukey’s correction was used when multiple comparisons were performed. P values less than 0.05 were considered statistically significant. Graphs and statistical analysis were performed using GraphPad Prism (GraphPad Software, USA).

Exosomes derived from UC-MSCs reduced hearing loss and hair cell loss after neomycin-induced damage in vivo.

MSCs can produce extracellular vesicles (EVs), including exosomes, which are responsible for their therapeutic effect. MSC-derived exosomes have been used to treat various diseases and disorders of different systems[21–24]. Therefore, we hypothesized that exosomes derived from UC-MSCs could have a protective effect against neomycin-induced ototoxicity in mice. The cell supernatants of MSCs were collected, and exosomes were isolated through a sequential centrifugation procedure. The purified UC-MSCs-exosomes were characterized by immunoblotting, Transmission Electron Microscope (TEM), and Nanoparticle tracking analysis (NTA). Western blot showed that exosome surface markers, Alix, CD9, CD63, and CD81, were enriched in the exosomal lysates compared to UC-MSC’s (Fig. 1A). The exosomal lysates were probed for GAPDH as a negative control for intracellular protein and no positive staining was observed (Fig. 1A). TEM and NTA were used to evaluate the morphology and size distribution of exosomes. As shown in Fig. 1B and 1C, exosomes typically displayed a round shape and cup-shaped appearance (Fig. 1B), and they composed a homogenous population with major sizes between 50 and 150 nm in diameter (Fig. 1C). Then, in explant cultured cochleae, we confirmed that exosomes were internalized by hair cells after co-culture, as shown by confocal microscopy (Fig. 1D).

To assess their therapeutic benefits further, exosomes were injected into neomycin-induced SNHL mice through the round window niche (RWN) injection. Hearing function was evaluated using auditory brainstem response (ABR) after different treatments. The workflow of the animal experiments was showed in Fig. 1E. Compared to the control group, the hearing threshold significantly increased in the neomycin-injected group, while RWN injection of exosomes in neomycin exposed mice significantly reduced the hearing threshold at 4, 8, 16, 24, and 32 kHz (Fig. 1F). In addition, immunofluorescence was performed to examine the loss of hair cells in cochlear tissue labeled by Myo7a and F-actin. The results revealed that neomycin-treated mice showed significant loss of Myo7a-positive hair cells in the middle and basal regions. In contrast, the administration of exosomes in neomycin-injected mice significantly reduced the loss of Myo7a-positive hair cells in the middle and basal regions of the cochlear tissues (Fig. 1G, H, I). These results suggested that exosomes could reduce hearing loss and associated hair cell loss in neomycin-induced SNHL mice.

Exosomes derived from UC-MSCs protected hair cells against neomycin-induced damage in vitro.

As we have shown, exosomes released by MSCs could reduce hearing threshold and hair cell loss in neomycin-induced SNHL mice. We further examined the impact of exosomes on cell survival, oxidative stress and apoptosis of hair cells in the explant cultured cochleae and HEI-OC1 cells in vitro. In the explant cultured cochleae, cell survival was assessed by counting the Myo7a-positive hair cell number in 100µm lengths on all turns of the cochleae after neomycin damage. The results showed that hair cell loss was increased in all 3 turns of the cochleae after treatment with 0.5 mM neomycin for 12 h, but this loss was significantly decreased after treatment with exosomes in a dose-dependent manner (Fig. S1). As the concentration of 30µg/ml exosomes and the middle turn exhibited the most significant protective efficacy, the concentration of 30µg/ml exosomes were applied in the next experiments and the middle turn was investigated. Immunofluorescence and cell counting indicated that hair cell survival was reduced after neomycin exposure, but exosomes could promote hair cell survival after neomycin damage (Fig. 2A). Additionally, we used Mito-SOX Red, a redox fluorophore that selectively detects mitochondrial superoxide, to evaluate mitochondrial ROS levels in cochleae. The results demonstrated that exosomes could reduce the oxidative stress caused by neomycin damage in cochlear hair cells (Fig. 2B). Furthermore, TUNEL (terminal deoxynucleotidyl transferase dUTP nick end labeling) assays were used to evaluate hair cell apoptosis. The results showed that neomycin significantly increased the apoptosis of hair cells, while exosomes could ameliorate the apoptotic cochlear hair cells in neomycin damage (Fig. 2C).

In addition, we investigated the effect of exosomes on oxidative stress and apoptosis in HEI-OC1 cells under neomycin-damaged condition. Mito-SOX Red was used to assess mitochondrial ROS levels in HEI-OC1 cells. Immunofluorescence showed a significant increase in ROS levels after neomycin treatment, while exosomes reduced the neomycin-induced ROS accumulation in HEI-OC1 cells (Fig. 2D). To assess apoptosis, we performed TUNEL staining to detect apoptotic HEI-OC1 cells after neomycin and/or exosome treatments. The results showed that the proportion of TUNEL-positive HEI-OC1 cells in the neomycin-treated group was higher than in the control group, while exosome treatment significantly reduced the proportion of TUNEL-positive cells caused by neomycin (Fig. 2E). Next, immunofluorescence and Western blot were performed to detect the proportions of cleaved-CASP3-positive cells and cleaved-CASP3 protein expression in HEI-OC1 cells, respectively. The results showed that exosomes treatment significantly reduced the proportion of cleaved-CASP3-positive cells and the protein expression of cleaved-CASP3 after neomycin-induced damage in HEI-OC1 cells (Fig. 2F, G). Additionally, we used the Annexin V and Propidium Iodide (PI) assay, which uses propidium iodide to label the dead cells and ANXA5/Annexin V to label the cells undergoing apoptosis, to analyze cell apoptosis by flow cytometry. The results demonstrated that neomycin treatment significantly increased the proportion of dead and apoptotic cells compared to the control, but the proportion of apoptotic cells with exosomes treatment after neomycin damage was significantly reduced compared to the neomycin damage group (Fig. 2H). These results suggested that exosomes could protect hair cells against neomycin-induced damage by promoting cell survival, reducing mitochondrial ROS, and decreasing apoptosis both in the explant cultured cochleae and HEI-OC1 cells in vitro.

Exosomes improved autophagy in hair cells.

Autophagy has been demonstrated to be a core pathway for the preservation of cellular and organismal homeostasis, which is tightly involved in hair cell protection[13, 14, 25]. Therefore, we explored whether autophagy in hair cells could be enhanced by exosomes. The autophagy and autophagy flux were examined by Western blot, TEM and tandem fluorescence mRFP-GFP-LC3 reporter system in explant cultured cochleae and HEI-OC1 cells. The expression of autophagy-associated protein LC3 in cochleae was detected by Western blot. The results showed that protein expression level of autophagy-associated protein LC3-II was upregulated after treatment with exosomes or neomycin compared with the control, and the expression levels were further improved by exosomes after neomycin treatment (Fig. 3A). Besides, TEM was used to observe the autophagic vacuoles[26] (including the autophagosome, amphisome, and autolysosome) in the explant cultured cochlea. The results suggested that there were significantly more autophagic vacuoles after exosomes or neomycin treatment compared with the control, and the autophagic vacuoles could be further increased by exosomes treatment following neomycin treatment (Fig. 3B). CAG-RFP-EGFP-LC3 mice were used to confirm changes in autophagy flux after exosomes and/or neomycin exposure. Cochleae were dissected from P2 CAG-RFP-EGFP-LC3 mice and immunolabeled with the hair cell marker Myo7a. Quantification of the LC3 puncta in each hair cell showed that the numbers of red-only puncta (autolysosome) were significantly increased compared with yellow puncta (autophagosome) in hair cells after exosomes treatment compared with the control, and they could be further increased by exosomes treatment after neomycin treatment, which raised the red-only(autolysosome) and yellow puncta (autophagosome) (Fig. 3C). The results showed that exosomes treatment could enhance more autophagosome-lysosome fusion in normal and neomycin-induced autophagy activation condition.

LC3 expression was then assessed by Western blot in HEI-OC1 cells. Consistent with previous data from explant cultured cochleae, LC3-II expression was upregulated after treatment with exosomes or neomycin compared to the control, and the expression level was further improved by exosomes after neomycin treatment (Fig. 3D). Next, TEM images showed that autophagic vacuoles were significantly greater in the exosomes or neomycin treatment group compared to the control, and the autophagic vacuoles could further rise by exosomes following neomycin-induced increase (Fig. 3E). To determine whether exosomes could enhance autophagy flux in HEI-OC1 cells, a tandem fluorescence mRFP-GFP-LC3 reporter system was used to monitor the autophagic flux. The results showed that exosomes significantly increased the number of red-only puncta, while neomycin improved more yellow puncta than red-only puncta. Additionally, exosomes still increased the number of red-only puncta after HEI-OC1 cells were exposed to neomycin, suggesting the formation of autolysosomes (Fig. 3F). Furthermore, autophagy flux was examined by Western blot analysis. Chloroquine (CQ) was used to inhibit autophagy by blocking autophagosome-lysosome fusion and inducing the accumulation of autophagosomes. LC3 expression was assessed by Western blot in exosome-treated HEI-OC1 cells with or without CQ. Consistent with fluorescence data, exosomes increased the LC3-II levels at 4 h, 12 h and 24 h when HEI-OC1 cells were treated with CQ (Fig. 3G). In summary, these results illustrated the ability of exosomes to enhance autophagy flux in explant cultured cochleae and HEI-OC cells.

Autophagy was necessary for exosome-induced hearing protection in vivo.

It has been demonstrated that exosomes could promote autophagy of hair cells both in explant cultured cochleae and in HEI-OC1 cells. To further explore whether autophagy regulation is necessary for exosome-induced inner ear protection in vivo, firstly, 3-methyladenine (3-MA), an autophagy antagonist that inhibits class III phosphatidylinositol 3-kinase (PI3K), was used. The Western blot showed that 3-MA administration could effectively decrease LC3-II levels, thereby inhibiting autophagy in mice cochlear tissue (Fig. 4A). Next, hearing ability was assessed after exosomes treatment with or without autophagy inhibition. Consistent with the above results, the exosome-treated group showed improved hearing function after neomycin injection compared to the neomycin-exposure group, as assessed by the decreased hearing threshold (Fig. 4B) and increased hair cell survival (Fig. 4C, D, E, F). Meanwhile, the autophagy inhibition group showed an attenuated therapeutic effect of exosomes on the recovery of hearing threshold (Fig. 4B). Additionally, the beneficial effects of exosomes on reducing hair cell survival (Fig. 4C, D, E, F) were attenuated when autophagy was inhibited by 3-MA. These results showed that autophagy inhibition with 3-MA could block the therapeutic effect generated by exosomes, and autophagy was necessary for exosome-induced hearing protection.

Autophagy was required for exosome-mediated protective function in hair cells.

To demonstrate whether autophagy was necessary for exosome-mediated protective function in hair cells, 3-MA was used to inhibit autophagy in vitro. Cell survival, oxidative stress and apoptosis of hair cells were performed in explant cultured cochleae and HEI-OC1 cells, respectively. Consistent with the above results, exosomes improved cell survival in neomycin-treated cochleae, as assessed by immunofluorescence and counting the number of Myo7a-positive cells per 100µm (Fig. 5A), while autophagy inhibition attenuated the therapeutic effects of exosomes in promoting hair cell survival (Fig. 5A). Additionally, the protective effects of exosomes on reducing mitochondrial ROS (Fig. 5B) and apoptosis (Fig. 5C) were attenuated when autophagy was inhibited by 3-MA.

Similar results were observed in HEI-OC1 cells. The results showed that in the presence of 3-MA, exosomes failed to protect HEI-OC1 cells from neomycin-induced damage, including oxidative stress assessed by Mito-SOX Red staining (Fig. 5D) and apoptosis assessed by TUNEL assays (Fig. 5E), cleaved-CASP3 staining (Fig. 5F), Western blot (Fig. 5G), and flow cytometry (Fig. 5H). Taken together, these data indicated that autophagy was essential in the process of exosome-mediated protection both in explant cultured cochleae and HEI-OC1cells.

Exosomes upregulated autophagy via promoting endocytosis in hair cells.

Endocytosis shares many common effector proteins and molecular machinery with autophagy, and accumulating evidence has demonstrated that autophagy is tightly associated with and dependent on endocytosis [16]. Therefore, we explored whether exosomes enhanced autophagy by promoting endocytosis. First, we detected the expression of endocytosis-related genes. The relative expression of endocytic genes in hair cells was significantly upregulated after exosomes treatment (Fig. 6A). The expression levels of endocytosis-associated proteins, including EEA1 and CAV2, and autophagy-related protein LC3 were detected by Western blot, and the results showed that exosomes elevated the protein levels of EEA1 and CAV2, as well as LC3-II in HEI-OC1 cells (Fig. 6B). Additionally, immunofluorescence was performed to examine EEA1 (Fig. 6C). To demonstrate whether endocytosis was necessary for exosomes to regulate autophagy in hair cells, dynasore (a specific inhibitor of DNM GTPase) or cytochalasin D (an inhibitor of actin polymerization) was used. Firstly, the efficiency of endocytosis inhibition was assessed by Western blotting for the expression of CAV2 and EEA1 (Fig. 6D). Moreover, Fig. 6D showed that LC3-II was significantly decreased by dynasore and cytochalasin D. Then, Western blot analysis was used to assess the autophagy flux in exosome-treated hair cells with or without endocytosis inhibition. Consistent with the above results, exosomes increased LC3-II levels at 4 h, 12 h, and 24 h when hair cells were treated with CQ (Fig. 6E), whereas in cells treated with dynasore, LC3-II proteins decreased over time when hair cells were treated with CQ (Fig. 6F). Additionally, cells treated with cytochalasin D displayed a similar phenotype (Fig. 6G). These data indicated that exosomes could activate endocytosis, and inhibition of endocytosis attenuated the autophagy flux enhanced by exosomes in HEI-OC1 cells. Taken together, these results suggested that exosomes upregulated autophagy by promoting endocytosis in hair cells.

The contradiction between the increasing incidence of SNHL and limited treatment has received considerable attention in the field of disease research, with new biological therapies being developed[3]. Among these, MSC-based cell therapy is a feasible and safe treatment[6]. Accumulating evidence indicates that MSCs could impact their ultimate outcomes through paracrine of cargo-bearing EVs[27]. EVs have attracted considerable attention because they play a key role in cell-to-cell communication in physiological and pathological conditions[9]. Different cell-derived EVs exhibit different biological functions because EVs carry different membrane molecules on their surface, as well as bioactive molecules that are characteristic of the cells they were generated from [7]. In addition, different types of EVs, including ABs, microvesicles, and exosomes, possess different biological functions, with the latter being the predominant and most clinically significant type [7]. MSC-derived exosomes exhibit a superior safety profile compared to the cells they derive from because they do not replicate[28] or cause microvascular embolism[29] and can be easily stored without losing their properties[30]. Therefore, extensive research is ongoing to establish the potential use of MSC-exosomes toward cell-free therapeutic applications in various pathologies such as kidney injury[31], cardiovascular disease[32], wound healing[33] or liver failure[34]. In the case of inner diseases, exosomes derived from supporting cells were initially investigated as paracrine signaling to protect hair cells from neomycin-induced damage[10]. Additionally, accumulating reports indicate that MSC-derived exosomes have the potential to rescue the loss of outer hair cells and repair cochlear damage in the cisplatin-injected model [11]. In this study, we find that exosomes derived from MSCs play a positive role in otoprotection by promoting cell survival, ameliorating mitochondrial ROS level and reducing apoptosis of hair cells. Our study validates the findings that MSC-derived exosomes have protective effects on neomycin-induced damage, making them a potential EV-based alternative therapy for ameliorating SNHL.

Autophagy is an evolutionarily conserved system for the degradation of cytoplasmic elements and plays a pivotal role in the quality control of proteins and organelles[35, 36]. Autophagy is particularly important in the inner ear, which consists of terminally differentiated cells with very limited regenerative ability in neonatal ages and completely loses its regenerative capacity in adults [13, 14]. This restriction of spontaneous hair cell regeneration attributes to the fact that the hearing ability is not able to recover once hair cells are damaged[3]. In most cases, autophagy is adaptive and limits derangement and death. Interestingly, studies have shown that promoting lysosomal delivery through autophagy of aminoglycosides is cytoprotective[37]. Recently, autophagy has emerged as a potential target for treating various SNHL by decreasing oxidative stress levels and apoptosis[13, 14]. In our experiments, the results show that MSC-derived exosomes can markedly activate autophagy both in the normal basal state and upon neomycin-induced damage conditions in hair cells. Additionally, by measuring the autophagic flux, we find that exosomes can enhance similar autophagosome synthesis and more autophagosome-lysosome fusion compared to neomycin-induced autophagy. Our study provides evidence to verify that targeting autophagy through exosomes is an effective and potential strategy for treating SNHL.

Multiple mechanisms are involved in the modulation of autophagy by exosomes. Exosomes are generally regarded as messengers that carry nucleic acids, proteins, lipids, and metabolites, which participate in intercellular communication and signal transduction in health and disease and affect various aspects of cell biology[7]. However, to deliver their cargo, exosomes need to be internalized by recipient cells either by way of membrane fusion and/or endocytic uptake[38]. Endocytosis is the initial biological process between exogenous exosomes and recipient cells, and this interaction may mediate some of the biological effects of exosomes in target cells. Interestingly, various studies have shown that endocytosis is critical and necessary for autophagy [39]. Moreover, endosomal components regulate the process of autophagy at multiple stages, constituting an integral component of the autophagic machinery for the initiation of degradation, autophagosomal maturation and lysosomal fusion[39]. What’s more, studies have indicated that endocytosis and lysosomal delivery sequester aminoglycosides away from cytotoxic targets[37]. In the present study, we find that exosomes can activate the endosomal pathway and autophagy in HEI-OC1 cells, and endocytosis is necessary for exosome-mediated autophagy activation. Based on our results, we uncover that exosome-driven endocytosis is accompanied by autophagy activation in the recipient cell, and that endocytosis is necessary for exosomes to upregulate autophagy.

In conclusion, our study sheds light on the efficacy of exosomes in rescuing neomycin-induced hearing loss and provides new evidence extending the possibility that exosomes may be used as a therapeutic agent for SNHLs. Considering the association between exosomes and autophagy, our study suggests that autophagy activated by exosomes can be an effective and potential therapeutic target for SNHL treatment. Mechanistically, exosome-activated endocytosis is necessary for exosome-mediated autophagy activation. In addition, the underlying mechanism through which exosomes derived from MSCs could protect hair cells against damage can be applied to auditory protection by regulating autophagy in the inner ear.

SNHL : sensorineural hearing loss; MSC : mesenchymal stem cell; HSP70 : heat shock protein 70; UC-MSCs : Umbilical cord mesenchymal stem cells; EVs : extracellular vesicles; TEM : Transmission Electron Microscope; NTA : Nanoparticle tracking analysis; RWN : round window niche; ABR : auditory brainstem response; PI : Propidium Iodide; CQ : Chloroquine; 3-MA : 3-methyladenine; PI3K : class III phosphatidylinositol 3-kinase; IP : intraperitoneal; PFA : paraformaldehyde.

Funding

This work was supported by the National Natural Science Foundation of China (82271168 to Furong Ma, 82170925 to Shiyu Liu).

Competing Interests

The authors have no relevant financial or non-financial interests to disclose.

Author Contributions

Huan Liu contributed to the study design, data acquisition and interpretation. Huijuan Kuang., Yiru Wang, Lili Bao, Wanxin.Cao, Lu Yu, Meihao Qi. and Renfeng Wang performed the animal experiments and data analysis. Xiaoshan Yang, Feng Ding, Lili Ren, Qingyuan Ye contributed to data analysis and interpretation. Siying Liu, Furong Ma, Shiyu Liu developed the concept and supervised experiments. All the authors contributed to the writing of the manuscript.

Data Availability

All data supporting the findings of this study are available within the paper and its Supplementary Information.

Conflict of interest

The authors have no disclosure of conflicts of interest related to this investigation.

Ethical approval

Animal experiments were approved by the Fourth Military Medical University and were performed following the guidelines of the Intramural Animal Use and Care Committee of Fourth Military Medical University（2021 / kq-013）.

Consent to participate

Not applicable.

Consent for publication

All authors consent the publication of the manuscript in CMLS.

Deafness and Hearing Loss. Available online at. Available from: https://www.who.int/news-room/fact-sheets/detail/deafness-and-hearing-loss
Wang J, Puel JL (2018) Toward Cochlear Therapies. Physiol Rev 98(4):2477–2522
Geleoc GS, Holt JR (2014) Sound strategies for hearing restoration. Science 344(6184):1241062
Copeland BJ, Pillsbury HC (2004) 3rd, Cochlear implantation for the treatment of deafness. Annu Rev Med 55:157–167
Wolf BJ, Kusch K, Hunniford V, Vona B, Kuhler R, Keppeler D, Strenzke N, Moser T (2022) Is there an unmet medical need for improved hearing restoration? EMBO Mol Med 14(8):e15798
Dufner-Almeida LG, Cruz DBD, Mingroni Netto RC, Batissoco AC, Oiticica J, Salazar-Silva R (2019) Stem-cell therapy for hearing loss: are we there yet? Braz J Otorhinolaryngol 85(4):520–529
Kalluri R, LeBleu VS (2020) The biology, function, and biomedical applications of exosomes.Science, 367(6478)
Pegtel DM, Gould SJ (2019) Exosomes Annu Rev Biochem 88:487–514
van Niel G, D'Angelo G, Raposo G (2018) Shedding light on the cell biology of extracellular vesicles. Nat Rev Mol Cell Biol 19(4):213–228
Breglio AM, May LA, Barzik M, Welsh NC, Francis SP, Costain TQ, Wang L, Anderson DE, Petralia RS, Wang YX et al (2020) Exosomes mediate sensory hair cell protection in the inner ear. J Clin Invest 130(5):2657–2672
Warnecke A, Staecker H, Rohde E, Gimona M, Giesemann A, Szczepek AJ, Di Stadio A, Hochmair I, Lenarz T (2022) Extracellular Vesicles in Inner Ear Therapies-Pathophysiological, Manufacturing, and Clinical Considerations. J Clin Med, 11(24)
Vargas JNS, Hamasaki M, Kawabata T, Youle RJ, Yoshimori T (2022) The mechanisms and roles of selective autophagy in mammals.Nat Rev Mol Cell Biol,
Guo L, Cao W, Niu Y, He S, Chai R, Yang J (2021) Autophagy Regulates the Survival of Hair Cells and Spiral Ganglion Neurons in Cases of Noise, Ototoxic Drug, and Age-Induced Sensorineural Hearing Loss. Front Cell Neurosci 15:760422
Liu C, Zheng Z, Wang P, He S, He Y (2021) Autophagy: A Novel Horizon for Hair Cell Protection. Neural Plast, 2021: p. 5511010
Xing H, Tan J, Miao Y, Lv Y, Zhang Q (2021) Crosstalk between exosomes and autophagy: A review of molecular mechanisms and therapies. J Cell Mol Med 25(5):2297–2308
Papandreou ME, Tavernarakis N (2020) Crosstalk between Endo/Exocytosis and Autophagy in Health and Disease. Biotechnol J 15(8):e1900267
Zhou T, Yuan Z, Weng J, Pei D, Du X, He C, Lai P (2021) Challenges and advances in clinical applications of mesenchymal stromal cells. J Hematol Oncol 14(1):24
Yu H, Lin Q, Wang Y, He Y, Fu S, Jiang H, Yu Y, Sun S, Chen Y, Shou J et al (2013) Inhibition of H3K9 methyltransferases G9a/GLP prevents ototoxicity and ongoing hair cell death. Cell Death Dis 4(2):e506
Landegger LD, Dilwali S, Stankovic KM Neonatal Murine Cochlear Explant Technique as an In Vitro Screening Tool in Hearing Research.J Vis Exp, 2017(124).
Tian KY, Chang HM, Wang J, Qi MH, Wang WL, Qiu Y, Liang K, Chen FQ, Zha DJ, Qiu JH (2019) Inhibition of DHCR24 increases the cisplatin-induced damage to cochlear hair cells in vitro. Neurosci Lett 706:99–104
Phan J, Kumar P, Hao D, Gao K, Farmer D, Wang A (2018) Engineering mesenchymal stem cells to improve their exosome efficacy and yield for cell-free therapy. J Extracell Vesicles 7(1):1522236
Rahmani A, Saleki K, Javanmehr N, Khodaparast J, Saadat P, Nouri HR (2020) Mesenchymal stem cell-derived extracellular vesicle-based therapies protect against coupled degeneration of the central nervous and vascular systems in stroke. Ageing Res Rev 62:101106
Lin Z, Wu Y, Xu Y, Li G, Li Z, Liu T (2022) Mesenchymal stem cell-derived exosomes in cancer therapy resistance: recent advances and therapeutic potential. Mol Cancer 21(1):179
Rani S, Ryan AE, Griffin MD, Ritter T (2015) Mesenchymal Stem Cell-derived Extracellular Vesicles: Toward Cell-free Therapeutic Applications. Mol Ther 23(5):812–823
Klionsky DJ, Petroni G, Amaravadi RK, Baehrecke EH, Ballabio A, Boya P, Bravo-San JM, Pedro K, Cadwell F, Cecconi AMK, Choi et al (2021) Autophagy in major human diseases. EMBO J 40(19):e108863
Klionsky DJ, Abdel-Aziz AK, Abdelfatah S, Abdellatif M, Abdoli A, Abel S, Abeliovich H, Abildgaard MH, Abudu YP, Acevedo-Arozena A et al (2021) Guidelines for the use and interpretation of assays for monitoring autophagy (4th edition)(1). Autophagy, 17(1): p. 1-382
Psaraki A, Ntari L, Karakostas C, Korrou-Karava D, Roubelakis MG (2022) Extracellular vesicles derived from mesenchymal stem/stromal cells: The regenerative impact in liver diseases. Hepatology 75(6):1590–1603
Reis M, Ogonek J, Qesari M, Borges NM, Nicholson L, Preussner L, Dickinson AM, Wang XN, Weissinger EM, Richter A (2016) Recent Developments in Cellular Immunotherapy for HSCT-Associated Complications. Front Immunol 7:500
Xiong Y, Mahmood A, Chopp M (2017) Emerging potential of exosomes for treatment of traumatic brain injury. Neural Regen Res 12(1):19–22
Wen S, Dooner M, Cheng Y, Papa E, Del Tatto M, Pereira M, Deng Y, Goldberg L, Aliotta J, Chatterjee D et al (2016) Mesenchymal stromal cell-derived extracellular vesicles rescue radiation damage to murine marrow hematopoietic cells. Leukemia 30(11):2221–2231
Bruno S, Porta S, Bussolati B (2016) Extracellular vesicles in renal tissue damage and regeneration. Eur J Pharmacol 790:83–91
Fleury A, Martinez MC, Le Lay S (2014) Extracellular vesicles as therapeutic tools in cardiovascular diseases. Front Immunol 5:370
Hu L, Wang J, Zhou X, Xiong Z, Zhao J, Yu R, Huang F, Zhang H, Chen L (2016) Exosomes derived from human adipose mensenchymal stem cells accelerates cutaneous wound healing via optimizing the characteristics of fibroblasts. Sci Rep 6:32993
Kostallari E, Valainathan S, Biquard L, Shah VH, Rautou PE (2021) Role of extracellular vesicles in liver diseases and their therapeutic potential. Adv Drug Deliv Rev 175:113816
Mizushima N, Komatsu M (2011) Autophagy: renovation of cells and tissues. Cell 147(4):728–741
Qian H, Chao X, Williams J, Fulte S, Li T, Yang L, Ding WX (2021) Autophagy in liver diseases: A review. Mol Aspects Med 82:100973
Hailey DW, Esterberg R, Linbo TH, Rubel EW, Raible DW (2017) Fluorescent aminoglycosides reveal intracellular trafficking routes in mechanosensory hair cells. J Clin Invest 127(2):472–486
Mulcahy LA, Pink RC, Carter DR (2014) Routes and mechanisms of extracellular vesicle uptake.J Extracell Vesicles,3
Birgisdottir AB, Johansen T (2020) Autophagy and endocytosis - interconnections and interdependencies.J Cell Sci, 133(10)

SupplementalInformation.pdf

Download PDF

Version 1

posted

You are reading this latest preprint version

MSC-derived exosomes protect auditory hair cells from neomycin-induced damage via autophagy regulation

Status:

Version 1

Abstract

Figures

Introduction

Material And Methods

Animals

Cell culture, tissue culture and reagents

Western blot

Isolation and characterization of exosomes

Immunofluorescence

Gene expression analysis by real-time qRT-PCR

Flow cytometry

Electron microscopy

ABR test

Statistical analysis

Results

Discussion

Abbreviations

Declarations

References

Supplementary Files

Status:

Version 1