Esophageal cancer-derived exosomes imbalance Tfh/Tfr cell ratio in the tumor immune microenvironment via EXO-PDL1 to promote immunosuppression

doi:10.21203/rs.3.rs-2824635/v1

Download PDF

Research Article

Esophageal cancer-derived exosomes imbalance Tfh/Tfr cell ratio in the tumor immune microenvironment via EXO-PDL1 to promote immunosuppression

https://doi.org/10.21203/rs.3.rs-2824635/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background: Esophageal cancer (EC) is a deadly malignancy. Exosomal programmed death ligand 1 (EXO-PDL1) induces immune escape to promote tumor progression. Furthermore, the imbalance between follicular helper T cells (Tfh) and follicular regulatory T cells (Tfr) numbers is related to the progression of many malignant tumors. However, the role of the EC-derived EXO-PDL1 in Tfh/Tfr ratio is unknown.

Methods: Tfh and Tfr numbers in samples obtained from 45 patients with EC and 33 healthy donors (HD) were determined using flow cytometry. Exosomes were isolated using differential centrifugation from patients’ plasma and PDL1 expression on exosomes was tested using ELISA. Exosomes were cultured in vitro for Tfh and Tfr cells expansion assays. CD4⁺T cells were isolated, stimulated, and cultured in vitro with exosomes to evaluate the levels, phenotypes, and functions of Tfh and Tfr cells.

Results: In patients with EC, the proportion of Tfh cells was lower than that in HD (P<0.001) whereas the proportion of Tfr cells was higher than that in HD (P<0.001). Patients with EC also showed a significantly lower ratio of Tfh/Tfr cells and a higher level of EXO-PDL1 than HD did (P<0.001). Additionally, a negative correlation was noted between EXO-PDL1 and Tfh/Tfr (R=-0.74, P<0.05). EC cell derived EXO-PDL1 inhibited the expansion of Tfh cells and enhanced the percentage of CTLA4⁺Tfh cells. Moreover, the levels of IL-21 and IFN-γ decreased, whereas IL-10 level was increased in response to EC cell derived EXO-PDL1. EXO-PDL1 promoted the expansion and suppressive functions of Tfr cells, the increased percentages of CTLA4⁺Tfr cells and ICOS⁺Tfr cells were accompanied with higher levels of IL-10, IFN-γ, and IL-21. Finally, EC derived exosomes promoted the imbalance of Tfh/Tfr ratio via the EXO-PDL1.

Conclusions: Patients with EC have imbalanced Tfh/Tfr ratio, which is attributed to EC-derived EXO-PDL1. Our results suggest a novel mechanism of EXO-PDL1-mediated immunosuppression in EC. Thus, inhibiting EXO-PDL1 to restore Tfh/Tfr cell balance may provide new therapeutic approaches in EC treatment.

Esophageal Cancer

follicular regulatory T cells

Tfr

follicular helper T cells

Tfh

EXO-PDL1

immunosuppression

Esophageal cancer (EC) is a common but deadly malignancy, even when treated with immune checkpoint inhibitors (ICI). Cancer-derived exosomes modulate the immune systems by triggering the immunosuppressive response^[1], which in turn favors tumor progression^[2]. These exosomes regulate the functions of immune cells in the tumor microenvironment (TME) by expressing immunosuppressive or pro-apoptotic molecules on their surface, including programmed death ligand 1 (PDL1)^[3]. Furthermore, exosomes derived from tumors reflect the characteristics of their parent cells and promote tumor progression by presenting PDL1. Exosomal (EXO)-PDL1 mediates programmed death receptor 1 (PD1) crosslinking and immunosuppression as it has a similar extracellular membrane topology as its cell surface counterpart^[4].. Exosomes suppress T cells in a PDL1 dependent fashion. For instance, removal of tumor exosomes from TRAMP-C2 cells recapitulated the effects of deleting PDL1^[5], suggesting that exosomes are a significant source of extra-tumoral PDL1 and may contribute to PD1 antibody treatment resistance^{[6, 7]}. Indeed, exosomes may be more potent immunosuppressants than other forms of extracellular PDL1^[4], and PDL1 levels on circulating exosomes appear to be a more reliable prognostic marker than PDL1 expression in tumor biopsies. Thus, monitoring circulating EXO-PDL1 maybe useful to predict the tumor response to treatment and clinical outcome^[8]. In addition, the role of EXO-PDL1 in the formation of systemic immunosuppression may be more important than previously assumed^[9].

Follicular regulatory T cells (Tfr) and follicular helper T cells (Tfh) share many characteristics. Specifically, they co-express PD1, chemokine receptor 5 (CXCR5), and Bcl6 as well as produce IL-21, IL-10, and IFN-γ. Tfr and Tfh cells are believed to be involved in the pathogenesis of many kinds of cancers. Tfr cells play a suppressive role during the generation of CD38⁺CD27^high plasma blasts^[10], leading to the immunosuppression. Tfh cells represent a distinct lineage of helper CD4⁺ T cells; they express CXCR5 and migrate into B cell follicles. Inducible T cell co-stimulator (ICOS), a cell surface co-stimulatory molecule, is highly expressed on Tfh cells and crucial for the interaction of Tfh cells with B cells^{[11, 12]}. Tfh cells play an important role in tumor immune protection^[13]. A subset of FoxP3⁺ regulatory T (Treg) cells that suppress different types of immune responses are known as Tfr cells^{[14, 15]}. They act as a regulatory counterpart for Tfh cells ^[16]. Tfr cells regulate germinal center (GC) responses and prevent antibody-mediated autoimmunity, promoting the formation of an immunosuppressive microenvironment^{[15, 17]}.. Given opposing functions of Tfh and Tfr cells as regulators of GC responses, a balance of their actions is critical for immune homeostasis ^[13][18]. Therefore, Tfh/Tfr ratio can be used as a tumor progression marker. However, whether EC is characterized by imbalanced Tfh/Tfr ratio remains unknown.

Cancer cells release exosomes and stimulate the expansion of Treg cells^[2], which causes immunosuppression in the TME by impairing the function of antitumorigenic T cells^[19]. Treg cells are precursors of Tfr cells; however, it is unclear whether EC-derived exosomes regulate Tfr cells to promote immunosuppression in EC. Furthermore, the relationship between EXO-PDL1 and Tfh/Tfr ration in EC has not been clarified. Therefore, this study was designed to assess the effect of EC tumor-derived exosomes on Tfh/Tfr balance. Furthermore, we aimed to evaluate whether these exosomes act via PDL1 to cause immunosuppression and promote the development of EC.

Patient samples and cell lines

Fresh blood samples were obtained from 45 naïve EC patients and 33 healthy donors (HD) visiting the Fourth Hospital of Hebei Medical University from August 2021 to April 2022. None of the patients had received anti-cancer therapy before surgical resection. Patients with concurrent HIV, other cancers or autoimmune diseases were excluded. Among the included patients, the plasma samples of 26 EC patients and 17 HD were used to detect EXO-PDL1. Clinical stages were classified according to the guidelines of the International Union against Cancer and patient characteristics are listed in Table S1. Informed consent was obtained from each patient, and the protocol was approved by the Fourth Hospital of Hebei Medical University. Human EC cell, Eca109 cells, used in this study were obtained from ATCC.

Lentivirus infection

ShRNA was introduced by shRNA carrying lentivirus under CMV promoter/ enhancer (GenePharma, Shanghai, China). The vector carried GFP encoding gene for visualization and puromycin resistance gene for selection. Cells were grown in six-well plates for 24 h till they reached approximately 50% confluence. Cells were washed with PBS, and viral transfection solution was added along with 3 mL Polybrene. Cells were incubated at 37°C under 5% CO₂ for 24 h before normal medium was replenished. Transfection efficiency was estimated by observing green fluorescence under a fluorescence microscope at 48 h post transfection. Puromycin was added at 48 h post transfection to maintain stably transfected cells. ShRNA sequences were as follows: shRNA1: CTGACATTCATCTTCCGTTTA, shRNA2: CGAATTACTGTGAAAGTCAAT.

Exosome isolation

Exosomes were isolated using differential centrifugation of conditioned media collected from human plasma or the supernatant of Eca109-PDL1^ko and Eca109-PDL1^nc cells. Cell cultures were treated with exosome-depleted media prepared by ultracentrifugation of fetal bovine serum (FBS) for 3 hours at 200,000 g. All culture medium contained polymyxin B (20µg/mL; Sigma-Aldrich) to eliminate endotoxin contamination. The cells were grown in their respective conditioned media till they reached 70 to 80% confluence. Briefly, cells were cultured for 72 hours, the culture medium was centrifuged at 300 g for 10 min to remove dead cells and debris followed by centrifugation at 2,000 g for 10 min, and finally, the supernatant was centrifuges at 10,000 g for 60 min twice to pellet the exosomes. The exosome pellet was washed in a large volume of PBS to eliminate contaminating proteins and centrifuged one last time at 100,000 g. The exosomal pellets were re-suspended in PBS and the total exosomal protein concentrations were determined using the BCA Protein Assay kit (Thermo Fisher Scientific, Santa Clara, CA).

Exosome analysis

Transmission electron microscope ( HITACHI H-7650 TEM) was used to analyze samples of exosomes processed using a standard protocol. Protein estimation and particle number of exosomes were determined using the protein micro BCA assay kit (Invitrogen) and NTA (Particle Metrix Zetaview), respectively. The expression of CD63, CD9, Tsg101, Calnexin, and PDL1 on exosomes were evaluated by performing western blot analysis.

Peripheral blood mononuclear cell (PBMC) isolation

PBMCs were isolated from fresh blood samples using a lymphocyte separation medium (Cedarlane Corporation). Briefly, 10 mL fresh blood was mixed with 10 mL PBS and the mixture was carefully added to 10 mL lymphocyte separation medium. The mixed solution was centrifuged at 400g for 25 minutes at 20–25℃, the buffy coat was removed and washed 3 times with PBS to obtain PBMCs. Naïve CD4⁺ T cells were purified using a Naïve CD4⁺ T Cell Isolation Kit (BioLegend) and cell purity was > 90% (Figure S2).

Cell stimulation and culture

All cells were cultured in a humidified incubator at a temperature of 37ºC in an atmosphere of 5% CO₂. Briefly, 96-well plates were coated with anti-CD3 (1 µg/mL, 100 µl) and anti-CD28 antibodies (0.5 µg/mL, 100 µl) overnight at 4°C. Then, the antibody solution was removed, and the plate was washed twice with PBS to remove unbound antibodies. Next, CD4⁺T cells were plated (2×10^5 cells/well) in abovementioned CD3 antibody-coated wells. Forty-eight hours later, isolated exosomes (10 µg/mL) or exosomes that were preincubated with 20 µg/mL anti-PDL1 or anti-IgG for 1 h at 37°C were added to cell cultures. Then, the CD4⁺T cells were cultured for another 3 days before being harvested and analyzed using flow cytometry. Phenotypic and intracellular cytokine analyses of CD4⁺T cells, with or without stimulation, were carried out. The reagents used in this experiment are listed in Table S2-3.

Flow cytometry

Here, we identify CD4⁺CD45RA⁻CXCR5⁺PD1⁺FoxP3^−/+T cells as ‘Tfh’ ‘Tfr’.Cells were stained with specific antibodies for 30 minutes; antibodies used in this experiment are listed in Table S2 and Table S3. For intracellular staining, cells were fixed and permeabilized for 30 minutes at 4°C using a Transcription Factor Buffer Set (BD Biosciences) and then washed with Perm/Wash Buffer. For intracytoplasmic staining, cells were stimulated for 5 hours with phorbol 12-myristate 13-acetate (50 ng/mL), ionomycin (1 µg/mL), and brefeldin A (2.5 µg/mL). Isotype-matched control antibodies were used as the background control. Flow cytometric analysis was performed using BD FACS Aria and analyzed using FlowJo software version 10 (TOMY Digital Biology).

Enzyme-linked Immunosorbent Assay (ELISA)

The level of PDL1 expression on exosomes isolated from plasma of EC patients and HD was determined using human ELISA kits (Abcam) according to the manufacturer’s instructions.

Statistical analysis

The results are expressed as the mean ± SEM. The statistical significance of differences between groups was analyzed using the log-rank test or Student’s t-test. Correlations between two parameters were assessed using Pearson’s correlation analysis. All data were analyzed using two-tailed tests, and results with P < 0.05 were considered statistically significant.

EC patients with progressive clinical characteristics have imbalanced Tfh/Tfr cell ratio

First, we used flow cytometry to analyze the proportions of Tfh and Tfr cells in fresh peripheral blood samples of 45 naïve EC patients and 33 HD (Fig. 1A-B). The proportion of Tfh cells was significantly lower in EC patients (P<0.001）(Fig. 1C), whereas the proportion of Tfr cells was significantly enhanced（P<0.001, Fig. 1D). Furthermore, Tfh/Tfr cell ratio was significantly lower in the EC patients than that in the HD group（P<0.001）(Fig. 1E).

To determine the clinical relevance of our findings, we checked the correlation between the Tfh/Tfr cell ratio and the tumor TNM stage, tumor location, and differentiation status. Notably, a significant negative correlation was observed between Tfh /Tfr cell ratio with the tumor size and lymph node infiltration. EC patients with higher TNM stage had a higher Tfh /Tfr cell ratio (Fig. 1F-I). Patients with poor tumor differentiation had a higher Tfh/Tfr cell ratio than those with well- or moderate- differentiated tumor (Fig. 1K). Furthermore, no correlation was observed between the Tfh/Tfr cell ratio and tumor location (Fig. 1J). Based on these results, the increased frequency of Tfr cells was attributed to the extent of immunosuppressive microenvironment in EC. Thus, impaired Tfh/Tfr cell balance may negatively impact antitumor immunity in EC patients.

Correlation of EXO-PDL1 with Tfh/Tfr cell ratio in EC patients

The mechanism contributing to impaired Tfh/Tfr cell ratio remains to be elucidated. In EC, tumor cell derived exosomes may induce Tfr cell expansion and induce the expression of immunosuppressive marker PDL1 to trigger inhibitory signal^[20]. Therefore, exploring the role of EXO-PDL1 is crucial to understand its role as the inhibitor of immune responses as well as its potential as a biomarker. In this study, we isolated exosomes from the plasma of 26 EC patients and 17 HD, and detected EXO-PDL1. As shown in Fig. 2A, EC patients showed a clear negative correlation between EXO-PDL1 and Tfh/Tfr cell ratio (R=-0.74, P<0.05). Furthermore, these patients exhibited higher EXO-PDL1 expression than HD did (P<0.001) (Fig. 2B). Additionally, EC patients with higher TNM stage tumors had higher EXO-PDL1 levels (Fig. 2C-E).The proportion of Tfh cells negatively correlated, but that of that of Tfr cells positively correlated with EXO-PDL1(Fig. S1). Based on these findings, we hypothesized that the observed decrease in Tfh/Tfr cell ratio in EC patients might be attributed to EXO-PDL1 expressed on tumor-derived exosomes.

Isolation and characterization of EC cell-derived exosomes

To determine whether EXO-PDL1 can induce Tfh/Tfr cell ratio imbalance, we knocked out PDL1 in Eca109 cells and acquired PDL1-deficient cell clones that secreted exosomes without PDL1. Exosomes obtained from the culture supernatant of Eca109-PDL1^koand Eca109-PDL1^nc cells showed vesicle like morphology with a lipid bilayer (Fig. 3A). Nano Sight nanoparticle tracking analysis (Particle Metrix Zetaview) showed that the extracellular vesicles were approximately 100 nm in diameter (Fig. 3B). EXO-PDL1^koand EXO-PDL1^nc were positive for the multivesicular body-related proteins CD63, CD9, and Tsg101, but not for Calnexin. As expected, only EXO-PDL1^nc were positive for PDL1 (Fig. 3C).

EC derived EXO-PDL1 impairs Tfh/Tfr cell ratio

Exosomes were isolated from Eca109-PDL1^ko and Eca109-PDL1^nccell supernatants; naïve CD4⁺T cells were separated from PBMCs of HD and cultured for use in subsequent assays (Fig. 4A). Naïve CD4⁺T cells were seeded in the 96 wells (2×10^5 cells/well) followed by anti-CD3 and anti-CD28 antibody stimulation for 48 hours. Next, EXO-PDL1^koand EXO-PDL1^nc (10 μg/mL) were preincubated with or without anti-PDL1 or anti-IgG (20 μg/mL) for 1 h and cocultured with naïve CD4⁺ T cells for another 3 days (Fig. 4B). Higher proportion of Tfr cells (P<0.05) and lower proportion of Tfh cells (P<0.05) were observed in EXO-PDL1^ncgroup than in EXO-PDL1^kogroup (Fig. 4C-D, E-F), resulting in a lower Tfh/ Tfr cell ratio (P<0.01); consistently, EXO-PDL1^ko group showed the opposite trend (Fig. 4G). Moreover, EXO-PDL1 neutralization using anti-PDL1 reversed the Tfh/ Tfr cell ratio induced by EXO-PDL1^nc as EXO-PDL1^nc+anti-PDL1group had similar result with that observed in the EXO-PDL1^kogroup. Tumor-derived exosomes showed a strong potential to induce Tfr cell differentiation from naïve CD4⁺T cells via EXO-PDL1, leading to immunosuppression. These results suggest that anti-PDL1 drugs could reverse Tfh/Tfr cell ratio imbalance in EC to achieve ICI efficiency in clinical settings.

EC-derived EXO-PDL1 changes the frequencies, phenotypes, functions of Tfh and Tfr cells and contributed to immunosuppression

Our results so far raised the possibility that EC-derived EXO-PDL1 can disrupt Tfh/Tfr cell ratio by decreasing the proportion of Tfh cells and increasing the proportion of Tfr cells via PD1/PDL1 interaction. Additionally, blocking PD1-PDL1 interaction reversed this effect. After EXO-PDL1 was incubated with CD4⁺T cells for 3 days, we analyzed the expression levels of CTLA4 and ICOS on CD4⁺CXCR5⁺FoxP3^-Tfh cells and CD4⁺CXCR5⁺FoxP3⁺Tfr cells. In addition, levels of IL-10, IL-21, and IFN-γ secreted from Tfh and Tfr cells were detected (Fig. 5A-B). After the incubation with EXO-PDL1^nc, the proportion of CD4⁺CXCR5⁺FoxP3⁺CTLA4⁺Tfr cells (P<0.01) (Fig. 5C,M) and the CD4⁺CXCR5⁺FoxP3⁺ICOS⁺Tfr cells increased (P<0.001, Fig. 5D,N), whereas incubation with EXO-PDL1 upregulated the expression of CTLA4 onTfh cells (P<0.001) (Fig. 5H-I, R-S). Concurrently, after incubation with EXO-PDL1^nc, Tfr cells expressed a higher level of IL-10 (P<0.001) (Fig. 5E-G,O-Q), whereas Tfh cells secreted lower levels of IL-21 (P<0.01) and IFN-γ (P<0.05) and a higher level of IL-10 (Fig. 5J-L, T-V) than those incubated with EXO-PDL1^ko. Next, to elucidate whether those trends were induced by PD1/PDL1 interaction, we incubated exosomes with anti-PDL1 antibody, which significantly reversed the results.

Collectively, these findings indicate that EXO-PDL1 may change the phenotypes of Tfh cells and Tfr cells, induce suppressive functions, and increase proportion of Tfr cells, but inhibit the functions and frequency of Tfh cells. EXO-PDL1 can, therefore, play a key role in immunosuppression by involving PD1/PDL1 and skewing Tfh/Tfr cell ratio in patients with EC.

In this study, we investigated the role of EC-derived exosomes in regulating the balance of Tfh/Tfr cell ratio. Our data showed that the proportion of Tfr cells, characterized by high expression of FoxP3, was increased in EC patients, whereas that of Tfh cells, characterized by low expression of FoxP3, was decreased. In addition, EC patients had a lower Tfh/Tfr cell ratio than HD. Furthermore, Tfh/Tfr cell ratio significantly correlated with tumor TNM stage and tumor differentiation status, which suggests that Tfh/Tfr cell ratio imbalance may be one of the mechanisms to induce EC carcinogenesis and may be used as a tumor prediction marker for EC. Our results are consistent with findings from studies, which reported that Tfh/Tfr cell ratio imbalance is related to the progression of malignant tumors, such as non-small cell lung cancer^[21], breast cancer^[22], hepatocellular carcinoma^[23], colorectal cancer^[24], and pancreatic cancer^[25]. As Tfh and Tfr cells play opposing roles in maintaining germinal center responses, their balanced activities are critical for immune homeostasis^[18].

Tumor-derived exosomal PDL1 contributes to establishing the immune memory of the tumor^[5]. Furthermore, immunosuppressive signaling mediated by EXO-PDL1 reportedly plays a crucial role in inhibiting antitumor immunity^[26]. Accordingly, EXO-PDL1 predicts poor survival, reflects immune status in gastric cancer patients and correlates with clinical stage of breast cancer, head and neck cancer, and melanoma ^[27–30]. Similar results were reported for MC38 colon cancer, melanoma, and TRAMP-C2 prostate cancer mouse models^{[4, 6, 9]}. In our study, exosomes extracted from the plasma of EC patients revealed increased EXO-PDL1 expression compared with those extracted from HD. Furthermore, a significant correlation was noted between EXO-PDL1 and tumor TNM stage and differentiation status. Interestingly, increased EXO-PDL1 expression level reportedly negatively correlates with Tfh/Tfr cell ratio in EC patients.

Based on these findings, we infer that EXO-PDL1 may induce the expansion of Tfr cells but inhibit the expansion and function of Tfh cells. EC-derived EXO-PDL1 be one of the mechanisms underlying Tfh and Tfr cell imbalance.

In vitro co-culture of PDL1⁺ exosomes with T cells suppresses T cell activation^[9], and EXO-PDL1 also suppresses tumor immunity ^[4]. Here, we confirmed that following anti-CD3/CD28 stimulation, EXO-PDL1^nc but not EXO-PDL1^ko, induced the expansion of Tfr cells and reduced Tfh cell count, thereby decreasing Tfh/Tfr cell ratio. It is possible that the greater suppressive capacity of Tfr cells, together with the decreased Tfh/Tfr cell ratio inhibits Tfh cell function^[31]. Eca109-PDL1^ko cell-derived exosomes did not induce the expansion of Tfr cell nor promoted Tfh proliferation, whereas Eca109-PDL1^nc cell-derived exosomes did. To the best of our knowledge, this is the first study to show the role of tumor-derived EXO-PDL1 in Tfh/Tfr balance in EC tumorigenesis.

CTLA4 inhibits T cell proliferation, suppresses the transcription of IL-2 encoding gene, as well as initiates inhibitory signal transduction. Sage et al. demonstrated that CTLA4 loss on Tfh cells resulted in stronger B cell responses, whereas CTLA4 loss on Tfr cells resulted in defective suppression of antigen-specific antibody responses^{[32, 33]}. Our results showed that EXO-PDL1 increased CTLA4 expression not only on Tfr cells, but also on Tfh cells, which means that antigen-specific antibody responses and B cell responses were significantly suppressed, which may be one of the reasons accounting for the EC immunosuppressive microenvironment. Furthermore, ICOS supply essential costimulatory signals for Tfr and Tfh cells in circulation as well as in the lymph nodes and is required for Tfr cell differentiation^[31]. Here, EXO-PDL1^nc but not EXO-PDL1^ko incubated with activated naïve CD4⁺T cells led to the higher ICOS expression on Tfr cells. Moreover, ICOS ligand on the B cell surface also binds to ICOS on Tfr cell surface, which may lead to the dysfunctional B cells.

IL-10 of Tfr cells could inhibit the ability of Tfh cells to proliferate and secrete cytokines, thereby regulating the immune response of B cells, including antibody class switching and affinity maturation. IL-21 derived from Tfh cells can also inhibit the expansion of Tfr cells in the germinal center. We compared the cytokine IL-21, IL-10 and IFN-γ expression profiles between CD4⁺CXCR5⁺FoxP3⁻Tfh cells and CD4⁺CXCR5⁺FoxP3⁺Tfr cells. Stimulated by TCR, EXO-PDL1^nc promotes the expansion of CTLA4⁺Tfr significantly accompanied with higher level of IL-10, while reduces Tfh significantly along with lower level of IL-21 and IFN-γ. These changes in cytokine levels accelerated the imbalance of Tfh/Tfr, defected humoral immunity and had other immunosuppressive effects.

PD-1 controls the generation and function of suppressive Tfr cells^[31]. Our data showed that when EXO-PDL1 was neutralized by anti-PDL1 antibody, the proportion of Tfr cells decreased and Tfh/Tfr cell ratio imbalance reversed. Thus, anti-PDL1 treatment can abolish exosomal immunosuppression mediated by PDL1, thereby activating antitumor immunity and attenuating the immune suppression^[34].

Tumor-derived exosome-bound PDL1 results in anergic T cells In different types of cancer, such as glioblastoma, HNSCC, melanoma, gastric and lung cancer^{[8, 29, 34]}. Our results are consistent with these findings, showing that EXO-PDL1 can function as a systemic immunosuppressant of TME^{[35, 36]}.

Overall, our study highlights a novel pathway whereby EC cells release exosomes with the potential to promote the accumulation of Tfr cells. Sage et al. highlighted the lack of methods for selectively modulating Tfr cells in clinical settings^[32]; however, our findings suggest the possibility that tumor-secreted exosomes may also serve as a therapeutic target while EXO-PDL1 could modulate Tfr cells in clinical settings.

Certain limitations were noted in our research. First, some studies have demonstrated that EXO-PDL1 is associated with PFS and OS ^[3]. In our study, we did not obtain data related to PFS or OS. Second, the relative proportions of Tfh and Tfr cells change over time and precede antibody production and function^[32]; further studies are required to investigate and validate these aspects.

This is the first study to investigate the relationship between Tfh/Tfr cell ratio, EXO-PDL1, and clinical characteristics for EC patients. EXO-PDL1 and Tfh/Tfr cell ratio served as independent prognostic biomarkers. Furthermore, we define a new role for EXO-PDL1 in regulating EC immune responses via modulating differentiation and functions of Tfh and Tfr cells in the blood, which could be reversed by treatment with anti-PDL1 antibody. EXO-PDL1 maybe one of the effectors by which anti-PDL1 drugs achieve their clinical benefits. Deepening our understanding of how EXO-PDL1 influences the overall immune profile of EC patients is critical to achieve successful patient outcomes.

EC: esophageal cancer; Tfr: follicular regulatory T cell; Tfh: follicular helper T cell; PDL1: Programmed death ligand 1; PD1: Programmed death receptor 1; PBMC: Peripheral blood mononuclear cells; Treg: regulatory T cell; Exo/exo: Exosome; qPCR: Quantitative PCR; TME: Tumor microenvironment; HD: healthy donors; CXCR5: the chemokine receptor 5; TNM: tumor size(T)、lymph node infiltration(N)、metastasis(M); ATCC: American Type Culture Collection.

Author affiliations ¹Hebei Medical University, Shijiazhuang 050011, Hebei, People's Republic of China.²Department of Immuno-Oncology, The Fourth Hospital of Hebei Medical University, Shijiazhuang 050010, Hebei, People's Republic of China.³Department of Internal Medicine, Affiliated Cancer Hospital of Zhengzhou University, Henan Cancer Hospital, Zhengzhou, Henan, 450008, People's Republic of China.

Contributors Zhiyu Wang and Zijie Li conducted conceptualization of the study, experimental design. Zijie Li performed major Imageflow experiments and mass cytometry experiments and analysis. Yuehua Zhang, and He Hao interpreted and analyzed data. Tingting LV, Xiaokuan Zhang and Lu Chen assisted with experiments. Yuying Qi provided advice with experiments. Zijie Li wrote, reviewed and edited the manuscript. Zhiyu Wang is responsible for the overall content as guarantor.

Funding This work was supported in part by National Natural Science Foundation of China (No.81872101）and Natural Science Foundation of Hebei Province (No.H2020206649).

Competing interests The authors declare no competing financial interests.

Patient consent for publication Not applicable.

Ethics approval This study involves human participants. All patients gave informed consent to participate per the Fourth Hospital of Hebei Medical University approved protocols. Participants gave informed consent to participate in the study before taking part.

Data availability statement Data are available upon reasonable request.

Supplemental material This content has been supplied by the author(s).

Morrissey, S.M., et al., Tumor-derived exosomes drive immunosuppressive macrophages in a pre-metastatic niche through glycolytic dominant metabolic reprogramming. Cell Metab, 2021. 33(10): p. 2040-2058 e10.
Lindau, D., et al., The immunosuppressive tumour network: myeloid-derived suppressor cells, regulatory T cells and natural killer T cells. Immunology, 2013. 138(2): p. 105-115.
Raimondo, S., et al., Extracellular Vesicles and Tumor-Immune Escape: Biological Functions and Clinical Perspectives. Int J Mol Sci, 2020. 21(7): p. 2286.
Daassi, D., K.M. Mahoney, and G.J. Freeman, The importance of exosomal PDL1 in tumour immune evasion. Nat Rev Immunol, 2020. 20(4): p. 209-215.
Poggio, M., et al., Suppression of Exosomal PD-L1 Induces Systemic Anti-tumor Immunity and Memory. Cell, 2019. 177(2): p. 414-427.
Kahlert, C. and R. Kalluri, Exosomes in tumor microenvironment influence cancer progression and metastasis. J Mol Med (Berl), 2013. 91(4): p. 431-437.
Liu, J., et al., The biology, function, and applications of exosomes in cancer. Acta Pharm Sin B, 2021. 11(9): p. 2783-2797.
Cordonnier, M., et al., Tracking the evolution of circulating exosomal-PD-L1 to monitor melanoma patients. J Extracell Vesicles, 2020. 9(1): p. 1710899.
Morrissey, S.M. and J. Yan, Exosomal PD-L1: Roles in Tumor Progression and Immunotherapy. Trends Cancer, 2020. 6(7): p. 550-558.
He, H., et al., ILdrives conversion of T follicular helper cells to T follicular regulatory cells through transcriptional regulation in systemic lupus erythematosus. 2020.
Ma, X., et al., Expansion of T follicular helper-T helper 1 like cells through epigenetic regulation by signal transducer and activator of transcription factors. Ann Rheum Dis, 2018. 77(9): p. 1354-1361.
King, C., Tfh cells set the stage for tumor control. Immunity, 2021. 54(12): p. 2690-2692.
Ye, Y., M. Wang, and H. Huang, Follicular regulatory T cell biology and its role in immune-mediated diseases. J Leukoc Biol, 2021. 110(2): p. 239-255.
Wing, J.B., A. Tanaka, and S. Sakaguchi, Human FOXP3(+) Regulatory T Cell Heterogeneity and Function in Autoimmunity and Cancer. Immunity, 2019. 50(2): p. 302-316.
Chung, Y., et al., Follicular regulatory T cells expressing Foxp3 and Bcl-6 suppress germinal center reactions. Nat Med, 2011. 17(8): p. 983-988.
Gonzalez-Figueroa, P., et al., Follicular regulatory T cells produce neuritin to regulate B cells. Cell, 2021. 184(7): p. 1775-1789.
Sage, P.T. and A.H. Sharpe, T follicular regulatory cells in the regulation of B cell responses. Trends Immunol, 2015. 36(7): p. 410-418.
Liu, C., et al., Increased Circulating Follicular Treg Cells Are Associated With Lower Levels of Autoantibodies in Patients With Rheumatoid Arthritis in Stable Remission. Arthritis Rheumatol, 2018. 70(5): p. 711-721.
Wieckowski, E.U., et al., Tumor-derived microvesicles promote regulatory T cell expansion and induce apoptosis in tumor-reactive activated CD8+ T lymphocytes. J Immunol, 2009. 183(6): p. 3720-3730.
Xie, F., et al., The role of exosomal PD-L1 in tumor progression and immunotherapy. Mol Cancer, 2019. 18(1): p. 146-156.
Shi, W., et al., PD-1 regulates CXCR5(+) CD4 T cell-mediated proinflammatory functions in non-small cell lung cancer patients. Int Immunopharmacol, 2020. 82: p. 106295.
Faghih, Z., et al., Immune profiles of CD4+ lymphocyte subsets in breast cancer tumor draining lymph nodes. Immunol Lett, 2014. 158(1-2): p. 57-65.
Wang, B., et al., Tfr-Tfh index: A new predicator for recurrence of hepatocellular carcinoma patients with HBV infection after curative resection. Clin Chim Acta, 2020. 511: p. 282-290.
Shi, W., et al., Follicular helper T cells promote the effector functions of CD8(+) T cells via the provision of IL-21, which is downregulated due to PD-1/PD-L1-mediated suppression in colorectal cancer. Exp Cell Res, 2018. 372(1): p. 35-42.
Lux, A., et al., c-Met and PD-L1 on Circulating Exosomes as Diagnostic and Prognostic Markers for Pancreatic Cancer. Int J Mol Sci, 2019. 20(13): p. 3305.
Wang, L., et al., HCV-associated exosomes promote myeloid-derived suppressor cell expansion via inhibiting miR-124 to regulate T follicular cell differentiation and function. Cell Discov, 2018. 4: p. 51.
Del Re, M., et al., PD-L1 mRNA expression in plasma-derived exosomes is associated with response to anti-PD-1 antibodies in melanoma and NSCLC. Br J Cancer, 2018. 118(6): p. 820-824.
Cao, J., et al., Exosomes in head and neck cancer: Roles, mechanisms and applications. Cancer Letters, 2020. 494: p. 7-16.
Fan, Y., et al., Exosomal PD-L1 Retains Immunosuppressive Activity and is Associated with Gastric Cancer Prognosis. Ann Surg Oncol, 2019. 26(11): p. 3745-3755.
Yang, Y., et al., Exosomal PD-L1 harbors active defense function to suppress T cell killing of breast cancer cells and promote tumor growth. Cell Research, 2018. 28(8): p. 862-864.
Sage, P.T., et al., The receptor PD-1 controls follicular regulatory T cells in the lymph nodes and blood. Nat Immunol, 2013. 14(2): p. 152-161.
Sage, P.T. and A.H.J.I.R. Sharpe, T follicular regulatory cells. 2016. 271(1): p. 246-259.
Sage, P.T., et al., The coinhibitory receptor CTLA-4 controls B cell responses by modulating T follicular helper, T follicular regulatory, and T regulatory cells. Immunity, 2014. 41(6): p. 1026-1039.
Theodoraki, M.N., et al., Clinical Significance of PD-L1+ Exosomes in Plasma of Head and Neck Cancer Patients. 2017. 24(4): p. 896-905.
Xing, C., et al., The roles of exosomal immune checkpoint proteins in tumors. Mil Med Res, 2021. 8(1): p. 56-66.
Kugeratski, F.G. and R. Kalluri, Exosomes as mediators of immune regulation and immunotherapy in cancer. FEBS J, 2021. 288(1): p. 10-35.

No competing interests reported.

Supplementalmaterial..docx

Download PDF

Version 1

posted

You are reading this latest preprint version

Esophageal cancer-derived exosomes imbalance Tfh/Tfr cell ratio in the tumor immune microenvironment via EXO-PDL1 to promote immunosuppression

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Patient samples and cell lines

Lentivirus infection

Exosome isolation

Exosome analysis

Peripheral blood mononuclear cell (PBMC) isolation

Cell stimulation and culture

Flow cytometry

Enzyme-linked Immunosorbent Assay (ELISA)

Statistical analysis

Results

EC patients with progressive clinical characteristics have imbalanced Tfh/Tfr cell ratio

Correlation of EXO-PDL1 with Tfh/Tfr cell ratio in EC patients

Isolation and characterization of EC cell-derived exosomes

EC derived EXO-PDL1 impairs Tfh/Tfr cell ratio

EC-derived EXO-PDL1 changes the frequencies, phenotypes, functions of Tfh and Tfr cells and contributed to immunosuppression

Discussion

Conclusion

Abbreviations

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1