Quercetin alleviates inflammation induced by porcine reproductive and respiratory syndrome virus in MARC-145 cells through the regulation of arachidonic acid and glutamine metabolism

doi:10.21203/rs.3.rs-2825151/v1

Download PDF

Research Article

Quercetin alleviates inflammation induced by porcine reproductive and respiratory syndrome virus in MARC-145 cells through the regulation of arachidonic acid and glutamine metabolism

https://doi.org/10.21203/rs.3.rs-2825151/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 01 Jul, 2024

Read the published version in Veterinary Medicine and Science →

Version 1

posted

You are reading this latest preprint version

Porcine reproductive and respiratory syndrome virus (PRRSV) infection causes severe inflammatory response and respiratory disease. Quercetin is among the widely occurring polyphenol, found abundantly in nature. Quercetin has anti-inflammatory, anti-oxidative and anti-viral properties. This study aimed to explore the effect and mechanism of quercetin on PRRSV induced inflammation in MARC-145 cells. Observing the cytopathic effect and measurements of inflammatory markers in MARC-145 cells collectively demonstrate that quercetin elicits a curative effect on PRRSV-induced inflammation. Liquid chromatography–mass spectrometry was further used for a non-targeted metabolic analysis of the the role of quercetin in the metabolic regulation of PRRSV inflammation in MARC-145 cells. It was shown that quercetin attenuated PRRSV-induced cytopathy in MARC-145 cells. We also found that quercetin inhibited PRRSV-induced mRNA expression of tumor necrosis factor-α (TNF-α) and interleukin 6 (IL-6). Metabolomics analysis revealed that quercetin ameliorated PRRSV-induced inflammation. Pathway analysis results revealed that PRRSV-induced pathways including arachidonic acid metabolism, linoleic acid metabolism, glycerophospholipid metabolism, and alanine, aspartate, and glutamate metabolism were suppressed by quercetin. Moreover, we confirmed that quercetin inhibited the activation of NF-κB/p65 pathway, probably by attenuating PLA2, LOX and COX mRNA expression. These results provide a crucial insight into the molecular mechanism of quercetin in alleviating PRRSV-induced inflammation.

Inflammation

Metabolomics

Porcine reproductive and respiratory syndrome virus (PRRSV)

Quercetin

Porcine reproductive and respiratory syndrome, also known as PRRS, is an acute and highly contagious swine disease caused by the porcine reproductive and respiratory syndrome virus (PRRSV) [1]. PRRSV infection induces inflammatory responses. For example, Gomez-Laguna et al. and Zhao et al. have shown that PRRSV infection in pigs significantly upregulates the expression of inflammatory cytokines, including interleukin (IL)-1β, IL-6, IL-8, and tumor necrosis factor-alpha (TNF-α), which is proportional to the intensity of PRRSV infection [2, 3]. Further studies have also shown that PRRSV infection of MARC-145 cells activates the nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) pathway, which is involved in regulating the expression of inflammatory cytokines induced by PRRSV [4, 5].

Quercetin is a polyhydroxy flavonoid widely distributed in nature. It has strong biological activity and exerts multiple pharmacological effects in vitro and in vivo, such as antioxidant, anti-inflammatory, and antiviral effects [6–8]. Studies have shown that quercetin inhibits lipopolysaccharide (LPS)-induced inflammation in RAW264.7 cells by regulating the Toll-like receptor 4 (TLR4)/NF-κB pathway, thereby reducing the expression of inflammatory cytokines, such as TNF-α, IL-6, and IL-1β [9, 10]. Moreover, quercetin also significantly reduces the mRNA expression of inflammatory mediators, including cyclooxygenase, 5-lipoxygenase, myeloperoxidase, nitric oxide synthases, C-reactive protein, and cytokines, by attenuating the TLR–NF-κB signaling pathway, thereby reducing the inflammation induced by high cholesterol in endothelial cells [11]. Furthermore, quercetin significantly reduces the expression of pro- and anti-inflammatory cytokines in PRRSV-infected monocyte-derived macrophages, lowering the number of viremic pigs induced by the PRRSV vaccine [12]. Therefore, we hypothesized that quercetin has great potential in alleviating the inflammation caused by PRRSV infection in MARC-145 cells, possibly through the involvement of the NF-κB/p65 pathway.

After an organism is stimulated or disturbed, the changes in its endogenous metabolites reflect the disease's pathological process. Metabolomics is a holistic and dynamic analysis. Qualitative and quantitative analyses of these changes provide a basis for further elucidation of the mechanism of drug action and have been extensively used since the initial report in 1999 [13, 14]. Recent studies on immune metabolism have shown that cellular metabolic reprogramming plays an important regulatory role in activating the immune system and inflammatory responses (including cytokine secretion caused by viral infection) [15, 16]. Another study has reported that peripheral blood metabolites in patients with coronavirus disease 2019 are closely related to the secretion of inflammatory cytokines [17]. Arginine, tryptophan metabolism inhibitor (e.g., epacadostat), and purine metabolism-related inhibitor (e.g., mycophenolic acid) effectively regulate the release of pro-inflammatory cytokines from peripheral blood mononuclear cells induced by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), most of which are related to cytokine release syndrome [18]. Although studies have shown that metabolites are closely related to the secretion of inflammatory cytokines after a viral infection, there is still a lack of comprehensive understanding of the regulatory function of host metabolic remodeling on inflammatory responses after PRRSV infection. Hence, this study analyzed the effect of quercetin on gene expression of inflammatory factors induced by PRRSV in MARC-145 cells. Combining the gene expression data with the analysis of metabolomics data, we further explored the effect and mechanism of quercetin on PRRSV-induced inflammation in MARC-145 cells to provide a theoretical basis for subsequent research.

Cells, viruses and reagents

Marc-145 cells (an African green monkey kidney epithelial cell line, ATCC CRL-12231) were maintained in Dulbecco’s modified Eagle’s medium (DMEM) with 10% fetal bovine serum (FBS) containing 100 U/ml penicillin and 100 mg/ml streptomycin at 37°C with 5% CO₂ in a humidified incubator. The pathogenic PRRSV strain FJZ03 (GenBank ID: KP860909, isolated in 2013 in Fujian Province, China, and maintained in our laboratory), was used for all experiments and is designated PRRSV throughout this article. Antibodies and other reagents were obtained from the following sources. Anti-NF-κB/p65, anti-P-p65, anti-IκBα、anti-P-IκBα and anti-α-Tubulin were from Cell Signaling Technology (Danvers, MA, USA). CCK-8 kit, BCA kit, RIPA, horseradish peroxidase (HRP)-conjugated goat anti-mouse and -rabbit IgG secondary antibodies were from Beyotime (Shanghai, China). Quercetin was purchased from Sigma-Aldrich (Saint Louis, MO, USA).

Cell Viability

The cytotoxicity of quercetin on Marc-145 cells were assessed by CCK-8 assay. Briefly, cells dispersed evenly in medium were seeded at a density of 1 × 10⁴ cells/well in 96-well plates. Next day, cells were treated with quercetin (25, 50, 100, 200, 300, 400 µmol/L), respectively, for 24 hours. Then, CCK-8 solution was added into each well. Followed by a 4-hour incubation, the optical density (OD) at 450 nm was determined using a microplate reader. Control group was untreated cells.

cytopathic effect (CPE)

Marc-145 cells were seeded in 6-well plates. After 24 hours, cells were infected with PRRSV (MOI, 0.5) for 2 hours, then cells were exposed to quercetin (25, 50, 100 µmol/L) in 2% FBS medium. After 24 hours, CPE was observed under inverted microscope.

RNA extraction and quantitative real-time PCR

Cells were washed twice with phosphate-buffered saline (PBS) before RNA isolation. Total RNA was isolated from cells using an cell total RNA isolation kit (Vazyme Biotech, China) and then reverse-transcribed using a HiScript II 1st-strand cDNA synthesis kit (Vazyme Biotech, China) by following the instructions accompanying each kit. Reverse transcription-quantitative PCR (qRT-PCR) was performed using AceQ qPCR SYBR green master mix (Vazyme Biotech, China) according to the manufacturer’s protocol. All samples were analyzed in triplicate on the same plate. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was chosen as an internal control for each experiment. Differences in gene expression levels were calculated using the 2^–△△CT method (where CT is threshold cycle) and normalized against GAPDH. Specific primers for all genes are listed in Table 1.

Table 1

List of primers used in this study.
Gene	Sequence ( 5’ → 3’ )	Length (bp)
IL-6	F: GCTGCAGGCACAGAACCA	61
IL-6	R: AAAGCTGCGCAGGATGAGA	61
TNF-α	F: TCCTCAGCCTCTTCTCCTTCCT	70
TNF-α	R: ACTCCAAAGTGCAGCAGACAGA	70
GAPDH	F: TCATGACCACAGTCCATGCC	144
GAPDH	R: GGATGACCTTGCCCACAGCC	144
PLA2G2	F: CACGACTGCTGCTACCAGGAAC	132
PLA2G2	R: TGTCTGCTTGTCACACTCTGTCTTG	132
PLA2G4	F: CGCCTAGAAGTTGAATTTCGCTTGC	122
PLA2G4	R: TCTCCTGTCTCCTCCAGTTGAACG	122
PLA2G5	F: CTGGCTTGGTTCCTGGCTTGTAG	93
PLA2G5	R: GGCATTCTTCCCTGTCACCTTCTC	93
COX-1	F: GTCAATGCCACCTTCATCCGAGAG	104
COX-1	R: ATGTAGTCATGTGCTGCGTTGTAGG	104
COX-2	F: GGGTTGCTGGTGGTAGGAATGTTC	86
COX-2	R: CTGGTATTTCATCTGCCTGCTCTGG	86
LOX-5	F: ACGGACGACTACATCTACCTCAGC	135
LOX-5	R: CCAGTTCTTCATCCACGGTCACG	135

Metabonomic analysis

This project uses LC-MS/MS technology for untargeted metabolomics analysis, using highresolution mass spectrometer Q Exactive (Thermo Fisher Scientific, USA) to collect data from both positive and negative ions to improve metabolite coverage. LC-MS/MS data processing was performed using The Compound Discoverer 3.1 (Thermo Fisher Scientific, USA) software, mainly included peak extraction, peak alignment, and compound identification. The multivariate raw data is dimensionally reduced by PCA (Principal Component Analysis) to analyze the groupings, trends (intra- and inter-group similarities and differences) and outliers of the observed variables in the data set (whether there is an abnormal sample). Using PLS-DA (Partial Least Squares Method-Discriminant Analysis), the VIP (Variable Importance in Projection) values of the first two principal components of the model, combined with the variability analysis, the Fold change and the Student's test to screen for differential metabolites. According to PLS-DA VIP > 1 and P < 0.05, screen the differential metabolites induced by PRRSV that can be recalled by quercetin, use MetaboAnalyst 5.0 to enrich the pathway and identify potential biomarkers.

Western blotting

The cells were lysed in RIPA lysis buffer supplemented with a protease inhibitor. The lysed cells were resolved on 10% SDS-polyacrylamide gels and then transferred to a polyvinylidene difluoride membrane (Millipore, USA). The membranes were blocked with 5% nonfat dry milk in TBST for 2 h and probed with the corresponding primary antibodies at room temperature for 4 h. After washing three times with TBST, the membranes were incubated with horseradish peroxidase (HRP)-conjugated secondary antibody at room temperature for 1 h. Specific bands were analyzed using the Alliance Q9 Advanced Auto imaging system (UVITEC, UK) after treatment with enhanced chemiluminescence (ECL). For quantitative analysis, bands were quantified using ImageJ and normalized to levels of β-actin.

Statistical analyses

All statistical analyses were conducted using GraphPad Prism 7. Data are expressed as means ± standard errors of the means (SEM). Differences between groups were evaluated using one-way or two-way analysis of variance (ANOVA). Differences between groups were considered statistically significant when P < 0.05 and are annotated with an asterisk (*) in the figures (**, P < 0.01; *, P < 0.05).

Effects of quercetin on PRRSV-induced inflammation in MARC-145 cells

Our experimental results indicated that quercetin at 25, 50, and 100 µmol/L had no inhibitory effect on the survival rate of MARC-145 cells (P > 0.05, Fig. 1A). Therefore, these concentrations of quercetin were used in subsequent experiments. We then performed experiments to address whether quercetin alleviates the cytopathic effect caused by PRRSV in vitro. The cytopathic effect of the virus group was obvious, with the cells turning round, fused, and appearing as grape-like clusters. After treating PRRSV-infected MARC-145 cells with quercetin at 25, 50, and 100 µmol/L concentrations for 24 h, the cytopathic effects caused by PRRSV infection were mitigated in vitro, showing a good dose–effect relationship. Nearly no cytopathic changes were observed in the cells treated with 100 µmol/L quercetin (Fig. 1B). Assessment of the mRNA expression levels of inflammatory cytokines showed that the mRNA levels of TNF-α and IL-6 in the PRRSV group were significantly higher than those of the control group (P < 0.01, P < 0.0001). Compared with the PRRSV group, the mRNA expression levels of TNF-α and IL-6 in the cells treated with different concentrations of quercetin were reduced to varying degrees, with the best inhibitory effect observed in the cells treated with 100 µmol/L quercetin (P < 0.01, Fig. 1C). Therefore, 100 µmol/L quercetin was used in subsequent experiments.

Metabolomic analysis

Differential analysis of metabolites

Liquid chromatography–mass spectrometry (LC-MS) was used to analyze cellular metabolites. With OPLS-DA VIP > 1 and P value < 0.05 as criteria, 355 differential metabolites were identified. Heat maps were also generated to visualize the different levels of metabolites in different samples (Fig. 2A). One hundred and thirty-one differential metabolites were identified between the control and the quercetin groups. Among these, 23 metabolites were upregulated, and 108 were downregulated in quercetin groups. In the comparison between the control and PRRSV groups, 111 differential metabolites were identified, including 21 upregulated and 90 downregulated metabolites in PRRSV groups. In the comparison between the PRRSV and PRRSV + quercetin groups, 113 differential metabolites were identified. Among them, there were 29 upregulated and 84 downregulated metabolites in PRRSV + quercetin groups. A total of 20 differential metabolites were induced by PRRSV with the induction reversed by quercetin, namely L-carnosine, sn-glycerol 3-phosphoethanolamine, D-fructose 6-phosphate, malate, L-pyroglutamic acid, xanthosine, glutamine, linoleic acid, pterine, myristic acid, arachidonic acid (peroxide free), xanthylic acid (xmp), phosphorylcholine, cis-9-palmitoleic acid, 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine, mestranol, Paxilline, DL-tryptophan, apigenin 7-glucoside, and L-saccharopine. Hierarchical clustering analysis of the differential metabolites showed that metabolites with similar expression patterns in the PRRSV and quercetin groups appeared in the same clusters, indicating that the metabolites had good classification results (Fig. 2B).

Metabolic pathway analysis

The MetaboAnalyst 5.0 was used to analyze the metabolic pathways of the 20 differential metabolites. The pathways with impact > 0.1 were considered the major pathways for quercetin to mitigate PRRSV-induced inflammation in MARC-145 cells, including glycerophospholipid metabolism; linoleic acid metabolism; arachidonic acid metabolism; and alanine, aspartic acid and glutamic acid metabolism. This result indicated that quercetin mainly regulated the lipid and amino acid metabolisms in MARC-145 cells (Fig. 3).

Multivariate analysis

An OPLS-DA model was established for 20 differential metabolites to search for potential biomarkers of inflammation. The metabolic profiles of the control group, the quercetin group, and the PRRSV + quercetin group were separated from the PRRSV group (Fig. 4A). The metabolic profile of the quercetin group was between that of the control and the virus groups, with the quality parameters of the model being R²_X = 0.755, R²_Y = 0.75, and Q² = 0.582, indicating that the quercetin intervention made the cells close to the normal state. As shown in Fig. 4B, the model quality parameters of the virus group were R²_X = 0.798, R²_Y = 0.996, and Q² = 0.97, and the quality parameters of the model in the quercetin group were R²_X = 0.792, R²_Y = 0.988, and Q² = 0.976; the prediction component 1 ([t₁]) differentiated the cells between these two culture conditions. Eighteen potential candidate biomarkers were identified based on an OPLS-DA VIP > 0.7769, namely sn-glycero-3-phosphoethanolamine, L-carnosine, xanthylic acid, DL-tryptophan, malic acid, glutamine, phosphorylcholine, L-pyroglutamic acid, apigenin-7-glucoside, D-fructose-6-phosphate disodium, linoleic acid, 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine, cis-9-hexadecenoic acid, xanthine, arachidonic acid, L-glycosides, and mestranol (Fig. 4C). Among them, metabolites that also satisfied being in the major pathways(impact > 0.1) were considered the potential biomarkers, namely sn-glycero-3-phosphoethanolamine, glutamine, phosphorylcholine, and arachidonic acid.

A mechanism by which quercetin regulates PRRSV-induced inflammation

Given the the abnormalities of glycerol phospholipid metabolism, linoleic acid metabolism and arachidonic acid metabolism, it was desirable to examine the gene expression of certain enzymes in these pathways. Phospholipase A2 (PLA2) is the key enzyme to produce linoleic acid and arachidonic acid, while lipoxygenase (LOX) and cyclooxygenase (COX) are the pathway enzymes of arachidonic acid metabolism.We therefore measured the mRNA expression level of these synthases. PRRSV infection caused an upregulation of PLA2G2, PLA2G4, PLA2G5, LOX-5, COX-1, COX-2 mRNA, while a significant downregulation of these synthases were found in cells exposed to PRRSV plus quercetin (Fig. 5A).Arachidonic acid metabolites activate the NF-κB signaling pathway and NF-κB activity is regulated by phosphorylation. We found that IκBα and NF-κB/p65 phosphorylation were boosted by PRRSV infection and were inhibited by treatment with PRRSV plus quercetin (Fig. 5B). A proposed mechanism for the protection of quercetin against PRRSV-induced inflammation was provided (Fig. 6)

As a widely present natural Chinese medicine monomer, quercetin has been shown in numerous studies to exert significant anti-inflammatory and antiviral effects. It inhibits LPS-induced TNF-α, IL-8, and IL-1β production in macrophages, lung A549 cells, and glial cells [19, 20]. Quercetin also inhibits the production of inflammation-producing enzymes, such as cyclooxygenase and lipoxygenase, by inhibiting Src- and Syk-mediated tyrosine phosphorylation of phosphatidylinositol-3-kinase (PI3K) [21]. Furthermore, it shows inhibitory activity in the early stage of influenza virus infection and has a therapeutic effect on the influenza virus [22, 23]. In addition, quercetin interacts with the glycoprotein D of the porcine pseudorabies virus and inhibits infection and adsorption by the porcine pseudorabies virus [24]. However, there has been no in-depth investigation of quercetin in its anti-PRRSV role, and its mechanism of action is not fully understood.

PRRSV infection activates the NF-κB pathway through multiple pathways and regulates the transcription and expression of various inflammatory cytokines, such as IL-6, IL-8, IL-10, and TNF-a, thereby causing cytokine storms. It is one of the causes of severe inflammatory responses after PRRSV infection and is also considered one of the causes of PRRS pathogenesis [25, 26]. This study observed the cytopathic effects of PRRSV through in vitro experiments and found that quercetin significantly reduced PRRSV-induced cytopathy in MARC-145 cells. Furthermore, the antiviral and inflammatory effects of quercetin were evaluated at the gene level, discovering that quercetin effectively reversed the upregulation of mRNA expression of inflammatory cytokines TNF-α and IL-6 and alleviated the cellular inflammation in MARC145 cells infected with PRRSV.

In the lipid metabolism network, the arachidonic acid metabolic pathway is the main pathway to trigger the inflammatory responses. Arachidonic acid stimulates the translocation of NF-κB into the nucleus; in addition after arachidonic acid is metabolized by lipoxygenase or cyclooxygenase, it activates the NF-κB signaling pathway [27, 28]. In addition, NF-κB regulates the transcription of arachidonic acid metabolic pathway enzymes, resulting in sustained or amplified inflammatory responses [27]. Arachidonic acid is normally bound to glycerophospholipids, such as phosphatidylethanolamine (PE) or phosphatidylcholine (PC), which are present on the cell membrane. In an inflammatory state, phospholipase A2 is activated to hydrolyze PE or PC, releasing a large amount of arachidonic acid [29]. Linoleic acid biosynthesis is also one of the main sources of arachidonic acid. PC releases linoleic acid through hydrolysis by phospholipase A2, and linoleic acid enters linoleic acid metabolism to generate arachidonic acid [30]. The glycerophospholipid metabolism, linoleic acid metabolism, and arachidonic acid metabolism described in this study belong to the lipid metabolism. It was found that sn-glycero-3-phosphoethanolamine and phosphorylcholine, linoleic acid, and arachidonic acid affected the above three metabolic pathways. The contents of sn-glycero-3-phosphoethanolamine and phosphorylcholine were significantly lower in the virus group than in the control group. In contrast, linoleic acid and arachidonic acid contents were significantly higher in the PRRSV group than in the control group, indicating that PRRSV stimulation resulted in massive hydrolysis of glycerophospholipids on the MARC-145 cell membrane to release linoleic acid and arachidonic acid. After quercetin intervention, the contents of sn-glycerol-3-phosphoethanolamine, phosphorylcholine, linoleic acid, and arachidonic acid were all restored. Further research showed that quercetin could inhibit the expression of PLA2 mRNA to reduce the production of linoleic acid and arachidonic acid, and inhibit the expression of LOX and COX mRNA to block NF- κB pathway activation.

Glutamine is the most abundant free amino acid in mammalian cells. Studies have shown that in LPS-induced rat alveolar type II epithelial cells, glutamine plays an immunomodulation role by inhibiting the activity of NF-κB and reducing the expression of the inflammatory cytokine TNF-α [31]. Glutamine also affects the infection and replication of viruses, such as human cytomegalovirus, Japanese hemagglutination virus, and porcine circovirus [32–34]. In this study, the glutamine content in the virus group was significantly lower than in the control group, resulting in alanine, aspartate, and glutamate metabolism disorders. This suggested that PRRSV infection may consume a large amount of glutamine in the cells, weakening its ability to inhibit the activation of the NF-κB pathway. Quercetin intervention restored glutamine content in the cells, suggesting that quercetin may play a role in reducing inflammation by regulating alanine, aspartate, and glutamate metabolism and maintaining glutamine content. We showed that PRRSV stimulation and activation of the NF-κB pathway were blocked in the cells after quercetin intervention, confirming it as the key pathway by which quercetin exerted its anti-inflammatory effect (Fig. 6).

In summary, we illustrate the protective effects of quercetin against PRRSV-induced inflammation in vitro. The mechanisms for protection include inhibiting cytopathogenic effect and anti-inflammation. We further reveal that quercetin ameliorates PRRSV-induced inflammation by the reduction of arachidonic acid decomposition regulated by inhibiting the expression of PLA2, LOX and COX. Importantly, our data establish NF-κB pathway as regulators of inflammation in cells exposed to PRRSV plus quercetin. Further experiments will elucidate how PRRSV regulates the expression of PLA LOX and COX.

ACKNOWLEDGEMENTS

We thank LetPub (www.letpub.com) for its linguistic assistance during the preparation of this manuscript.

AUTHOR CONTRIBUTION

Qian Guang, Longze Zhang, Xin Tang and Jiakai Li performed the experiments. Longxin Qiu and Hongbo Chen conceived and designed the experiments. Qian Guang and Hongbo Chen performed the data analyses. Longxin Qiu and Hongbo Chen completed the writing of the manuscript. All authors contributed to the article and approved the submitted version.

FUNDING

This work was supported by the National Natural Science Foundation of China (32102628), the Fujian Provincial Key Scientific and Technological Innovation Projects (2021G02015), the Natural Science Foundation of Fujian Province (2022J011157)

DATA AVAILABILITY

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Consent for Publication All authors agree to submit the final version of manuscript for publication.

Competing Interests The authors declare no competing interests.

Zhang Q, Yoo D. PRRS virus receptors and their role for pathogenesis. Vet Microbiol 2015; 177:229-241.
Zhao X, Niu Y, Yu X, Qin L, Jia J, Wang Q, et al. Aberrant host immune response induced by highly virulent PRRSV identified by digital gene expression tag profiling. BMC Genomics 2010; 11:544-544.
Gómez-Laguna J, Salguero FJ, Barranco I, Pallarés F, Rodríguez-Gómez I, Bernabé A, et al. Cytokine Expression by Macrophages in the Lung of Pigs Infected with the Porcine Reproductive and Respiratory Syndrome Virus. J Comp Pathol 2010; 142:51-60.
Zhu Z, Zhang X, Dong W, Wang X, Guo C. TREM2 suppresses the proinflammatory response to facilitate PRRSV infection via PI3K/NF-κB signaling. PLoS Path 2020; 16:e1008543.
Yu Z, Huang C, Zhang Q, Feng WH. Porcine reproductive and respiratory syndrome virus (PRRSV) induces IL-12p40 production through JNK-AP-1 and NF-κB signaling pathways. Virus Res 2016; 225:73-81.
Gansukh E, Kazibwe Z, Pandurangan M, Judy G, Kim DH. Probing the impact of quercetin-7-O-glucoside on influenza virus replication influence. Phytomedicine 2016; 23:958-67.
Choi HJ, Song JH, Park KS, Kwon DH. Inhibitory effects of quercetin 3-rhamnoside on influenza A virus replication. Eur J Pharm Sci 2009; 37:329-33.
Mehrbod P, Ebrahimi SN, Fotouhi F, Eskandari F, Eloff JN, McGaw LJ, et al. Experimental validation and computational modeling of anti-influenza effects of quercetin-3-O-alpha-L-rhamnopyranoside from indigenous south African medicinal plant Rapanea melanophloeos. BMC complementary and alternative medicine 2019; 19:346.
Zheng J, Hui X, Huang C, Fan J, Mei Q, Lu Y, et al. Quercetin protects against intestinal barrier disruption and inflammation in acute necrotizing pancreatitis through TLR4/MyD88/p38?MAPK and ERS inhibition. Pancreatology 2018:S1424390318306392-.
Wu TC, Chan ST, Chang CN, Yu PS, Cheng-Hung C, Shu-Lan Y. Quercetin and chrysin inhibit nickel-induced invasion and migration by downregulation of TLR4/NF-κB signaling in A549?cells. Chemico Biological Interactions 2018; 292:101-109.
Bhaskar S, Sudhakaran PR, Helen A. Quercetin attenuates atherosclerotic inflammation and adhesion molecule expression by modulating TLR-NF-kappaB signaling pathway. Cell Immunol 2016; 310:131-140.
Ruansit W, Charerntantanakul W. Oral supplementation of quercetin in PRRSV-1 modified-live virus vaccinated pigs in response to HP-PRRSV-2 challenge. Vaccine 2020; 38:3570-3581.
Saito K, Matsuda F. Metabolomics for Functional Genomics, Systems Biology, and Biotechnology. Annu Rev Plant Biol 2010; 61:463-489.
Madsen R, Lundstedt TR, Trygg J. Chemometrics in metabolomics--a review in human disease diagnosis. Anal Chim Acta 2010; 659:23-33.
O'Neill LA, Kishton RJ, Rathmell J. A guide to immunometabolism for immunologists. Nature reviews Immunology 2016; 16:553-65.
Wang Q, Fang P, He R, Li M, Yu H, Zhou L, et al. O-GlcNAc transferase promotes influenza A virus-induced cytokine storm by targeting interferon regulatory factor-5. Sci Adv 2020; 6:eaaz7086.
Su Y, Chen D, Yuan D, Lausted C, Choi J, Dai CL, et al. Multi-Omics Resolves a Sharp Disease-State Shift between Mild and Moderate COVID-19. Cell 2020; 183:1479-1495 e20.
Xiao N, Nie M, Pang H, Wang B, Hu J, Meng X, et al. Integrated cytokine and metabolite analysis reveals immunometabolic reprogramming in COVID-19 patients with therapeutic implications. Nature communications 2021; 12:1618.
Cells E, Geraets L, Moonen H, Brauers K, Hageman GJ. Dietary flavones and flavonoles are inhibitors of poly(ADP-ribose)polymerase-1 in pulmonary epithelial cells. J Nutr 2007; 137:2190-2195.
Geraets L, Moonen HJ, Brauers K, Wouters EF, Bast A, Hageman GJ. Dietary flavones and flavonoles are inhibitors of poly(ADP-ribose)polymerase-1 in pulmonary epithelial cells. J Nutr 2007; 137:2190-5.
Lee KM, Hwang MK, Lee DE, Lee KW, Lee HJ. Protective effect of quercetin against arsenite-induced COX-2 expression by targeting PI3K in rat liver epithelial cells. Journal of Agricultural and Food Chemis ry 2010; 58:5815-20.
Wu W, Li R, Li X, He J, Jiang S, Liu S, et al. Quercetin as an Antiviral Agent Inhibits Influenza A Virus (IAV) Entry. Viruses 2015; 8.
Mehrbod P, Hudy D, Shyntum D, Markowski J, Los MJ, Ghavami S. Quercetin as a Natural Therapeutic Candidate for the Treatment of Influenza Virus. Biomolecules 2020; 11.
Sun Y, Li C, Li Z, Shangguan A, Jiang J, Zeng W, et al. Quercetin as an antiviral agent inhibits the Pseudorabies virus in vitro and in vivo. Virus Res 2021; 305:198556.
Amarilla SP, Gómez-Laguna J, Carrasco L, Rodríguez-Gómez I, Caridad Y, Graham SP, et al. Porcine reproductive and respiratory syndrome type 1 viruses induce hypoplasia of erythroid cells and myeloid cell hyperplasia in the bone marrow of experimentally infected piglets independently of the viral load and virulence. Vet Microbiol 2017; 201:126-135.
Jing H, Fang BL, Ding BZ, Wang BD, Hao BW. Porcine Reproductive and Respiratory Syndrome Virus nsp1α Inhibits NF-κB Activation by Targeting the Linear Ubiquitin Chain Assembly Complex. J Virol 2017; 91:e01911-16-16.
Shoeb M, Ramana KV. Anti-inflammatory effects of benfotiamine are mediated through the regulation of the arachidonic acid pathway in macrophages. Free Radical Biol Med 2012; 52:182-190.
Camandola S, Leonarduzzi G, Musso T, Varesio L, Poli G. Nuclear factor kB is activated by arachidonic acid but not by eicosapentaenoic acid. Biochem Biophys Res Commun 2016; 229:643-647.
Zhao J, Liu Q, Liu Y, Qiao W, Yang K, Jiang T, et al. Quantitative profiling of glycerides, glycerophosphatides and sphingolipids in Chinese human milk with ultra-performance liquid chromatography/quadrupole-time-of-flight mass spectrometry. Food Chem 2021; 346:128857.
Rett BS, Whelan J. Increasing dietary linoleic acid does not increase tissue arachidonic acid content in adults consuming Western-type diets: a systematic review. Nutr Metab 2011; 8:36.
Santos A, Correia CA, Oliveira DD, Nogueira-Pedro A, Borelli P, Fock RA. Intravenous Glutamine Administration Modulates TNF-α/IL-10 Ratio and Attenuates NFkB Phosphorylation in a Protein Malnutrition Model. Inflammation 2016; 39:1-9.
Chambers JW, Maguire TG, Alwine JC. Glutamine Metabolism Is Essential for Human Cytomegalovirus Infection. J Virol 2009; 84.
Yang DK, Kim HH, Nah JJ, Lee KW, Song JY. Binary Ethylenimine Inactivated Japanese Encephalitis Virus Antigen Reveals Hemagglutination. Open Journal of Veterinary Medicine 2012; 2:120-123.
Ren W, Luo W, Wu M, Liu G, Yu X, Fang J, et al. Dietary L-glutamine supplementation improves pregnancy outcome in mice infected with type-2 porcine circovirus. Amino Acids 2013; 45:479-488.

No competing interests reported.

Download PDF

Journal Publication

published 01 Jul, 2024

Read the published version in Veterinary Medicine and Science →

Version 1

posted

You are reading this latest preprint version

Quercetin alleviates inflammation induced by porcine reproductive and respiratory syndrome virus in MARC-145 cells through the regulation of arachidonic acid and glutamine metabolism

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Materials And Methods

Cells, viruses and reagents

Cell Viability

cytopathic effect (CPE)

RNA extraction and quantitative real-time PCR

Metabonomic analysis

Western blotting

Statistical analyses

Results

Effects of quercetin on PRRSV-induced inflammation in MARC-145 cells

Metabolomic analysis

Differential analysis of metabolites

Metabolic pathway analysis

Multivariate analysis

A mechanism by which quercetin regulates PRRSV-induced inflammation

Discussion

Conclusions

Declarations

References

Additional Declarations

Status:

Journal Publication

Version 1