Cell culture
Human normal ovarian epithelial cells IOSE80 cells (cat.no BNCC358126), OC cell lines OVCAR3 (cat.no BNCC339586), CAOV-3 (cat.no BNCC101010) and SCOV3 (cat.no BNCC310551) cells were obtained from BeNa Culture Collection (Henan, China). All cells were cultured in DMEM medium (Gibco) containing 10% fetal bovine serum (FBS, Gibco) and 100 IU/mL penicillin plus 100 µg/mL streptomycin (Sigma-Aldrich). Cells were grown in sterile culture dishes at 37°C in a 5% CO2 atmosphere. To detect the sensitivity of OC cells to cisplatin, CAOV-3 cells were treated with different concentrations of cisplatin (0, 20 µg/ml, 40 µg/ml, 60 µg/ml, 80 µg/ml, HY-17394, MedChemExpress) for 48 h.
Reverse Transcription-quantitative Pcr (Rt-qpcr)
Total RNA from different cells was extracted with TRIzol reagent (Invitrogen, Carlsbad, CA), and first-strand complementary DNA (cDNA) was synthesized with 1 µg of total RNA. qPCR was performed on an ABI PRISM 7900HT (Applied Biosystems; Life Technologies; Thermo Fisher Scientific, Inc.) using SYBR Premix Ex Taq™ (Takara Bio, Inc.) or Taqman probes (Applied Biosystems; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. The relative expression levels of mRNA were normalized to GAPDH expression, and fold changes in expression were calculated using the 2−ΔΔCt method. The sequences of all primers used for RT-qPCR are as follows: CHD1L: forward: 5’-GGGAAGACCTGCCAGATTTGCT-3’, reverse: 5’-TTTCACTCGCCTCAGCAGAAA-3’; PLK1: forward: 5’- TGACTCAACACGCCTCATCC-3’, reverse: 5’- CTCGTCGATGTAGGTCACGG-3’; GAPDH: forward: 5’-AATGGGCAGCCGTTAGGAAA-3’, reverse: 5’- GCGCCCAATACGACCAAATC-3’
Western Blot
Cells were digested in RIPA buffer (Shanghai Absin Biotechnology Co., Ltd.) on ice. A bicinchoninic acid protein assay kit (Thermo Fisher Scientific, Inc.) was used to detect the protein concentrations. Subsequently, 30 µg protein was separated by 10% SDS-PAGE gel and transferred to PVDF membranes (Sigma-Aldrich). Then the membranes were blocked with 5% bovine serum albumin (BSA) for 2 h and were incubated at 4°C overnight with primary antibodies. GAPDH was used as the internal control. Goat anti-rabbit horseradish-peroxidase-conjugated IgG was used as the secondary antibody (1:5000, Abcam) for 2 h at room temperature and visualized using an enhanced chemiluminescence detection system (Beyotime Institute of Biotechnology) according to the manufacturer’s protocol.
Small-interfering Rna Transfection
CHD1L small interfering RNAs (siRNA- CHD1L-1 and siRNA- CHD1L-2) were designed and synthesized by Shanghai GenePharma Co., Ltd. (Shanghai, China). Negative control siRNA (siRNA-NC) was purchased from Sangon Biotech Co., Ltd. (Shanghai, China). Briefly, 500 ng siRNA- CHD1L was transfected into CAOV-3 cells using 1 µl Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. Subsequently, transfected cells were incubated at 37°C for 48 h. The PLK1 overexpression plasmid (ov-PLK1) and the corresponding negative control plasmid (ov-NC) with lentiviral expression vector GV 493 were synthesized by Shanghai GenePharma Co., Ltd. The cells were transfected with 20 nM ov-PLK1 or ov-NC using Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) at 37˚C with 5% CO2 for 48 h. The transfection efficacy was determined using RT-qPCR after 48 h. siRNA-CHD1L-1-sense: 5’- AUGUUACACAGGAAAGACCUG-3’, siRNA-CHD1L-1-antisense: 5’- GGUCUUUCCUGUGUAACAUAU − 3’, siRNA- CHD1L-2-sense: 5’- AAAUGAUGCAUCUUUCAAGCA − 3’, siRNA-CHD1L-2-antisense: 5’- CUUGAAAGAUGCAUCAUUUCU − 3’, siRNA-NC-sense: 5’-UUCUCCGAACGUGUCACGUTT-3’, and siRNA-NC-antisense: 5’-ACGUGACACGUUCGGAGAATT-3’.
Cell Counting Kit-8 (Cck8) Assay
CAOV-3 cells (2x103 cells/well) were seeded into 96-well plates, and CCK8 (Beyotime Technology, Shanghai, China) was added to each well after cell transfection and incubated for 2 h at 37°C. The optical density was measured at 450 nm using a microplate reader.
Edu Staining Assay
EDU staining was used to analyze the cancer cell proliferation according to the following protocol. Briefly, CAOV-3 cells were transfected and then incubated with EDU (20 mmol/L) for 2 h. The cells were fixed with 4% paraformaldehyde for 20 min at room temperature and permeated with 0.5% Triton X-100 for 10 min at room temperature. The cells were incubated with Click reaction solution in the dark for 30 min and DAPI dye was applied for counterstaining the cell nucleus. The images were obtained using a fluorescence microscope (Olympus Corporation).
Tunel Assay
CAOV-3 cells (2x104 cells/well) were seeded into 6-well plates and subjected to indicated treatment. Subsequently, the cells were fixed with 4% paraformaldehyde at 37˚C for 15 min followed by the cultivation with TUNEL solution for 1 h at 37˚C. The cells were then stained with 3,3-diaminobenzidine (Sigma-Aldrich) for 10 min at room temperature according to the manufacturer's protocol. Cell nuclei were stained with 0.1 µg/ml DAPI for 5 min and nuclear DNA fragmentation was assessed using the DeadEnd™ Fluorometric TUNEL system (Promega Corporation). Finally, the cells were observed in five randomly selected fields under an Olympus IX71 fluorescence microscope (Olympus Corporation).
Flow Cytometry
The treated CAOV-3 cells at 70–80% confluence were digested into a single-cell suspension, fixed in 70% ethanol, stained with propidium iodide (PI), and analyzed by flow cytometry. In addition, the percentages of cells within each phase of the cell cycle were analyzed with ModFit version 4.0 (Verity Software House, Inc., Topsham, ME, USA) and CellQuest version 5.1 (Thermo Fisher Scientific, Inc.).
IP
Immunoprecipitation (Ip)
The cells were lysed to generate chromatin fragments with an average size of 500 bp and the supernatant was removed, which was incubated with indicated 5 µg anti-CHD1L or anti-PLK1 and a total of 10 µl protein A/G agarose beads (cat. no. sc-2003; Santa Cruz Biotechnology, Inc.) overnight at 4℃. Isotype-matched IgG was used as negative control. After washed, beads were decoupled by SDS loading buffer boiling. In addition, the input we take is half of the total lysate. The samples were analyzed by western blot.
Statistical analysis
Data are represented as mean ± SD. The statistical analyses were performed using one-way ANOVA with Tukey's post hoc test. The p values less than 0.05 were considered to be significant. All statistical analyses were performed using SPSS 17.0 software.