Effect of Wnt/β-catenin signaling pathway on repair and regeneration after dentin-pulp injury

doi:10.21203/rs.3.rs-2832464/v1

Download PDF

Research Article

Effect of Wnt/β-catenin signaling pathway on repair and regeneration after dentin-pulp injury

https://doi.org/10.21203/rs.3.rs-2832464/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

The Wnt/β-catenin signaling pathway performs multiple essential functions during tooth development. Several Wnt/β-catenin signaling pathway components are expressed in the dental epithelium and mesenchyme during tooth development in humans and mice. Functional studies and experimental analyses in relevant animal models have confirmed the regulatory role of the Wnt/β-catenin signaling pathway on developing tooth formation and adult dental homeostasis. In this study, we used the adult mouse incisor as a model to explore the effect of the Wnt/β-catenin signaling pathway on the repair and regeneration of dental pulp stem cells after injury. We established the dentin-pulp injury models successfully in two different ways and observed an obvious injury in the proximal region of the adult mouse incisor in each group. Faster repair and regeneration were detected after Wnt/β-catenin signaling activation and vice versa, indicating that Wnt/β-catenin signaling is required for cell proliferation and odontoblast differentiation. The same results were further verified by culturing mouse DPSCs in vitro. In our experiments, we found that Wnt10a also showed significant expression when the Wnt/β-catenin signaling pathway was activated and further demonstrated that Wnt10a-mediated Wnt/β-catenin signaling plays a positive regulatory role to regulate DPSCs proliferation and odontoblast differentiation and promoting the repair process of incisor injury. This study highlights the crucial role of the Wnt/β-catenin signaling pathway in the tooth injury and repair and shed new lights on the discovery of novel molecular mechanisms associated with tooth regeneration.

DPSCs

Dentin-pulp complex injury

Wnt/β-catenin signaling pathway

Wnt10a.

Wnt/β-catenin signaling pathway can promote proliferation and odontoblast differentiation of DPSCs in different injury area of teeth injury.And Wnt10a plays an important role in it.

Abrasion and cutting methods can cause different injury areas to the teeth and simulate different types of dentin-pulp complex damage.
Wnt signaling pathway expression is elevated after teeth injury.
Wnt10a-mediated Wnt/β-catenin signaling plays a positive regulatory role to promote DPSCs proliferation and odontoblast differentiation and the repair process of teeth injury.

Dentin-pulp complex damage^[1] caused by caries, trauma or iatrogenic causes will not only lead to various diseases of dental tissue and periodontal tissue but also have different degrees of physiological and psychological effects on patients. According to statistics, there are around 500 million people in China who are suffering from varying degrees of tooth loss^[2]. And world traumatic dental injuries frequency was reported that permanent dentition prevalence was 15.2%, primary dentition prevalence was 22.7%^[3]. It was indicated that prevalence of dental injury was generally high and the consequences were severe around the world. Therefore, how to repair damaged teeth caused by various reasons has become one of the hot topic for dental researchers all over the world. In order to study the process and mechanism of dental injury repair intuitively and precisely, dental researchers have simulated human dental injury through animal dental injury. The construction of animal models is one of the most important parts of dental injury studies. At present, researchers often use abrasion and cutting methods to construct animal tooth damage models, and further study the mechanism of animal tooth injury repair through in vitro culture method. However, there is no specific comparative study on repair, regeneration and signaling pathway regulation among different injury models.

Dental pulp stem cells (DPSCs) offer a lot of potential for a variety of uses in regenerative medicine and stem cell research. Numerous reports on DPSCs characteristics from in vitro and in vivo investigations, including cell proliferation, differentiation capability, assay proficiency and potential for novel stem cell functions, can be found in the life science literature. According to the first study on DPSCs, both in vitro and in vivo, their stem cell capabilities are comparable to those of bone marrow stromal cells (BMSCs)^[4]. They are recognized as crucial controls for the processes involved in pulp repair. They primarily accomplish this by migrating to the site of the injury and then differentiating into a new generation of odontoblast-like cells that produce reparative dentin^[5]. Because DPSCs have high differentiation potential and are simple to culture, it holds tremendous promise for these cells in the field of research^[4].

The continuously growing mouse incisor has become an attractive model system for studying stem cell-driven tissue homeostasis, regeneration and repair^[6]. It is reported that mouse incisors grow continuously throughout their lives and this continuous growth included the continuous renewal of enamel-forming cells, the odontoblast and pulpal cells^[7].

Almost all aspects of embryogenesis, organ development, tissue regeneration and homeostatic self-renewal in several adult tissues, including skin and teeth, depend on Wnt signaling. These signaling pathways, which involve seven receptors and 19 distinct Wnt glycoproteins, control cell behavior, proliferation and destiny. The proliferation of DPSCs and the development and differentiation of human teeth are both significantly influenced by the Wnt/β-catenin signaling pathway. One member of this family, Wnt10a, appears to be specifically relevant to teeth out of the 19 known Wnt ligands^[8]. Mechanistically, Wnt10a is engaged in cell-matrix interactions that control the differentiation of a murine pluripotent fibroblast cell line into an odontoblast. Its knockdown has been demonstrated to impede murine dentin production and limit the proliferation of murine dental mesenchymal cells in culture. The proliferation and capacity for self-renewal of stem or progenitor cells appear to be enhanced by Wnt10a at an early stage of the dentin repair procedure^[9]. However, how the Wnt/β-catenin signaling pathway regulates DPSCs proliferation and odontoblast differentiation and how they promote the reparation process of incisor injury are still unknown.

In this study, we established the dentin-pulp injury models successfully in two different ways, to explore the effect of the Wnt/β-catenin signaling pathway on the repair and regeneration of DPSCs after injury^[10–22].Our results show that repair and regeneration were detected more quickly following activation of the Wnt/β-catenin signaling and vice versa. Mouse DPSCs were cultured in vitro to further confirm the similar effects. It proves that Wnt/-catenin signaling has a beneficial regulatory effect on DPSC proliferation and odontoblast differentiation as well as the incisor damage repair process. This study highlights the crucial role of Wnt/β-catenin signaling in regulating tissue repair and regeneration.

1 Materials and Reagents

The Kunming mice required for the experiment were purchased from the Department of Experimental Animals of Kunming Medical University. The experimental protocol had been reviewed and approved by the Animal Ethics Committee of Kunming Medical University, approval number: KMMU2020292.

1.1 Experimental Animals

Seventy SPF-grade healthy 8-week-old female Kunming mice, weighing 28-30g, were provided by the Department of Experimental Animals of Kunming Medical University and were fed with ordinary laboratory mouse chow (Jiangsu Medison Biomedical Co., Ltd.) and raised according to the clean grade. All experimental operations were performed strictly by the Guidelines for the Care and Use of Laboratory Animals issued by the National Institutes of Health of the United States and were approved by the Laboratory Animal Ethics Committee of Kunming Medical University. Every effort was made to reduce animal suffering and to minimize the number of animals used during the experiments.

1.2 Reagents

The reagents used in this study were anhydrous lithium chloride (C8381, Solarbio) prepared as a solution of 0.75g/L as required, DKK1 recombinant protein (H00022943-P01, Abnova) prepared at a concentration of 1ug/ml, BCA protein quantification kit (P0009, Beyotime), Trizol (15596-026, Ambion), RNA Reverse Transcription Kit (G3337-50, Ambion), Real-Time Fluorescence RT-PCR Reagent (G3325-15, Service), Ki67 Antibody (ab15580, Abcam), Chondrogenic Induction Kit (MUCMX-90041, Saiye Biotech) Ltd.), and EDU (C0071S, Beyotime).

1.3 Instruments

The instruments employed in this study were the Real-time fluorescence quantitative PCR instrument (788BR08065, BIO.RAD), the Optical Microscope (LEICA DM750 ZEISS, Germany) and the Protein Electrophoresis Instrument (165–8033, BIO-RAD, USA).

2.1 Mice incisor injury model assay

Experimental animal groups: Seventy Kunming mice were randomly divided into 7 groups: the control group, the abrasion model group, the abrasion LiCl group, the abrasion DKK1 group, the cutting model group, the cutting LiCl group and the cutting DKK1 group. No treatment was done in the control group. The abrasion model group, the abrasion LiCl group and the abrasion DKK1 group used the method of abrasing an incisor. The cutting model group, the cutting LiCl group and the cutting DKK1 group used the method of cutting an incisor.

The abrasion method: We used a dental drill to abrade the root of one side incisor, cooling and washing with saline while grinding until the red pulp penetration point was visible to the naked eye. The diameter of the defect was 1.0-1.5mm and the depth was 0.5-1.0mm. The other side incisor was reserved as a negative control. (Fig. 1A1, A1').

The cutting method: We used an ophthalmic scissor to cut directly one side incisor of the mouse until the red pulp penetration point was visible to the naked eye and the other side incisor was still used as a control. (Fig. 1A2, A2').

Drug administration treatment: The abrasion LiCl model group and the cutting LiCl group were given LiCl solution (0.75 g/L) at a dose of 0.2 ml/kg by local injection into the periodontal ligament, once every 2 days. The mice in the abrasion DKK1 group and the cutting DKK1 group were also injected with DKK1 protein at a dose of 0.2 µg/kg into the periodontal ligament, once every 2 days. The cutting model group and the abrasion model group were injected with an equal volume of saline, once every 2 days until the 7th day after the model was constructed successfully. The control group did not receive any treatment.

2.2 qRT-PCR analysis

We extracted an appropriate amount of dental pulp tissue from all groups of mice, added Trizollysis solution to fully lyse, and added chloroform to extract RNA at the ratio of 200ul chloroform per 1 ml of lysis solution. Next, we used the centrifuge at 12000×g, for 15 min at 4℃, took the supernatant, added 0.5 times the volume of isopropanol to precipitate RNA, used the centrifuge at 12,000 × g, for 10 min at 4℃, and discarded the supernatant. In the next step, we added 0.5 ml of 75% ethanol to the precipitate for suspending and washing, used the centrifuge at 7500 rpm for 5 min at 4℃, discarded the supernatant and blotted the mouth of the tube with absorbent paper. Then we opened the lid on the ultra-clean workbench and dried it for 5 minutes in the air. After that, we added 30-50ul of DEPC-treated ddH₂O to dissolve the precipitate according to the amount of precipitate, which was total RNA. Referring to the instructions of the SureScript™ First-Strand cDNA Synthesis Kit, we took 1ug of total RNA, added 1ul of SureScriptRTase Mix (20×) and 4ul of SureScript RT Reaction Buffer (5×), replenished water to 20ul and under general conditions (25℃ for 5min, 42℃ for 45min, 85℃ for 5min and 4℃ hold) for reverse transcription on a common PCR machine (4359659, Applied Biosystems 2720 Thermal Cycler, USA) to synthesize the first-strand cDNA. Then we used the BlazeTaq™ SYBR® Green qPCR Mix 2.0 to detect the expression of Axin2 and β-catenin on a CFX96 real-time quantitative PCR instrument (Bio-Rad, USA) by using the Sybrgreen method with cDNA as a template and GAPDH as an internal reference. PCR amplification reaction conditions were: 95℃preheating for 10 min, 95℃ for the 10s, 60℃ for the 20s, 72℃ for the 30s, for 40 cycles, collected and recorded the fluorescence, read the Ct value and used the 2^–△△Ct method to calculate the gene relative expression. All the primer sequences required for this study are shown in the table below:

Table 1

The Primer Information Table
Primers	Sense Primer	Anti-sense Primer
Axin2	TGGACTTCTGGTTTGCTTGTAA	TCTCGTATGTAGGTCTTGGTGG
β-catenin	CCTTCACAACCTTTCTCACCAC	ACAGACAGCACTTTCAGCACTC
Wnt10a	GGCAGATGGAGGTGTGTGTG	AGGAAGTATGGCCGGGTGTT
Dspp	CTCTGTGGCTGTGCCTCTTCTA	CAGTGTTCCCCTGTTCGTTTAC
GAPDH	TTGGTCAGGCAAGGGAA	CCCATCACCATCTTCCAGG

2.3 Immunofluorescence staining

Ki67 immunofluorescence staining: We prepared paraffin sections of 9µm samples at different time points. The paraffin sections were dried at room temperature for 30-50min. Then we washed the sections with 1X phosphate buffered saline (PBS) for 5min, and repeated 3 times. We dissolved TritonTMX-100 in PBS at 1:100 for cell membrane perforations, applied at room temperature for 10 minutes, then washed with PBST for 5min and repeated 3 times. Next, the cells were sealed with Blocking buffer for 1 hour at room temperature and primary antibody Ki67 (1:100) and secondary antibody (1:200) were added sequentially. Subsequently, nuclear staining was performed by using DAPI (1:100), incubated for 5min at room temperature and we protected them from light, washed for 5 min in PBST and repeated 3 times. Finally, fluorescence microscopy was used for image acquisition and analyzed the changes in Ki67-positive cells by Image J image software.

2.4 Western Blotting analysis

Total cellular proteins were extracted using RIPA lysate and proteins were quantified by using the BCA protein assay kit. Samples were electrophoresed through sodium dodecyl sulfate-polyacrylamide gels and transferred topolyvinylidene difluoride membra-nes. Using β-actin as an internal reference control and sealing with 5% fat-free milk, the primary antibody was incubated: Axin2 antibody (1:1000), β-catenin antibody (1:1000), Wnt10a antibody (1:1000), Dspp antibody (1: 2000) and mouse anti-β-actin antibody (1:5000). Then the membrane was incubated with the secondary antibody (goat anti-mouse IgG). Development was performed and exposed. Analyzed protein bands in grayscale were used with Image J software and relative protein expression was calculated.

2.5 Isolation and identification of mouse dental pulp stem cells

Mice incisors were collected and rinsed with PBS containing 5% double antibodies until there was no obvious blood clot on the tooth surface. The pulp in the pulp cavity was removed and rinsed again. Large pieces of pulp tissue were cut up and digested with a mixture of type I collagenase and Dispase II at 37℃. This was followed by culturing with MEM medium containing 20% FBS. The P3-generation DPSCs were identified by flow cytometry after staining by adding 5µl of FITC fluorescently labeled CD44, CD45, CD105, CD34, CD146 and CD31, under light-protected conditions, respectively^{[15–17, 20]}.

2.6 Osteogenesis, lipogenesis and chondrogenesis induction and identification of dental pulp stem cells

Osteogenesis induction and identification: P3-genera-tion mouse dental pulp stem cells were inoculated into coated Petri dishes at a cell density of 2×104 cells/cm², cultured at 37℃ with 5% CO₂ to a confluence of 60–70%. Then we discarded liquid supernatant and added osteogenesis-induced differentiation medium (osteogenesis-induced differentiation basal medium 175 ml, specialized fetal bovine serum 20 ml, glutamine 2 ml, dual antibody 2 ml, ascorbic acid 400 µl, β-glycerophosphate sodium 2 mL, dexamethasone 20 µL). About 14 days later, the termination time of cell induction was determined according to the precipitation of intracellular calcium salt crystals and the formation of calcium nodules, and identified by Alizarin Red Staining.

Lipogenesis induction and identification: P3-generation mouse dental pulp stem cells were inoculated, and lipogenesis-induced differentiation mediumsolution A (lipogenesis-induced differentiate-on basal medium A 175 ml, FBS 20 ml, glutamine 2 ml, dual antibodies 2 ml, insulin 400µl, IBMX 200ul, rosiglitazone 200ul, dexamethasone 200µl) and B solution (lipogenic induction differentiation basal medium B 175ml, FBS 20ml, dual antibodies 2ml, glutamine 2ml, insulin 400g) were added to the basal mediums respectively, then the medium was mixed well and placed in the warmed bath. Lipogenic cells were induced by adding the configured lipogenic A solution, changing the B solution once after three days, keeping it for one day and then changing the A solution. Osteogenic induction was added into osteogenic induction mediums, and we placed cells with the added induction medium in the incubator and continued to culture for 14 days. Depending on the condition of the cells, the time to finish the cell induction was decided and Oil Red O Staining was performed for identification.

Chondrogenesis induction and identification: Using the instructions of the chondrogenesis induction kit, P3-generation mouse dental pulp stem cells were digested and counted at 3×10⁵cells in 15 ml centrifuge tubes, respectively, and centrifuged at 220 g for 8 min at low speed to allow the cells to form microclusters. The cells were cultured in centrifuge tubes with chondrogenic induction solution, and we changed liquid at 3–4 d intervals, induced for 5 weeks, fixed the cells in 4% paraformaldehyde and paraffin sections were made routinely. The sections were dewaxed in xylene, dehydrated in gradient ethanol, and washed in distilled water before being stained with Alcinium Stain for identification.

2.7 Effect of LiCl and DKK1 treatment on the proliferation of mouse dental pulp stem cells

The P3-generation dental pulp stem cells were digested, supernatant liquid discarded by centrifugation, washed twice in PBS buffer, counted and transferred to a 6-well plate with the corresponding volume of cell suspension and then incubated with 0.75 g/L LiCl and 1ug/ml DKK1 for 24 h. The proliferation of cells in different groups was detected by EDU staining.

2.8 Statistical analysis

In this study, SPSS 19.0 software was used to statistically analyze the data and the measurement data were expressed as (x ̅ ± s). Independent sample t-test was used for inter-group comparison, and paired t-test was used for intra-group comparison. Enumeration data were expressed as rate (%) and compared by chi-square test. P < 0.05 was considered statistically significant.

3.1 LiCl intervention promoted the adult mouse incisor injury repair, whereas DKK1 inhibited the process

The root of one incisor was abraded with a dental drill in the abrasion method until the red pulp point was visible (Fig. 1A1, A1'). In the cutting method, one side of the mouse incisor was cut directly until the red penetrating point was visible to the naked eye (Fig. 1A2, A2'). The injured and medicated incisors were observed continuously for 7 days and the restoration state of the incisors was recorded. In the abrasion LiCl group, some incisors injury recovered completely on the 4th day, 8 mice recovered on the 5th day and 2 mice recovered on the 6th day after the injury, with an average recovery time of 5.2 days. In the cutting LiCl group, the incisors injury was restored in 5 mice on the 6th day and in 5 mice on the 7th day after the injury, with a mean recovery time of 6.5 days. 3 mice incisors injuries in the abrasion DKK1 group recovered on the 7th day after the injury and the recovery rate was 30%. 2 mice incisors injuries in the cutting DKK1 group recovered on the 7th day after the injury and the recovery rate was 20%. There were 10 mice and 8 mice in the abrasion model group and the cutting model group recovered respectively after 7 days of injury and the recovery rates were 100% and 80%, respectively (Fig. 1B). The results suggested that LiCl intervention promoted the repair of tooth injury, whereas DKK1 inhibited the process and it was also indicated that the abrasion group had a shorter repair time than the cutting group.

3.2 Dentin-pulp injury and LiCl could stimulate the proliferation and odontoblast differentiation of DPSCs after dentin-pulp injury, while DKK1 inhibited this process

The incisors were decalcified by EDTA and slices were prepared for Ki67 immunofluorescence staining to observe changes in cell proliferation after 7 days of intervention with LiCl and DKK1 in the incisor injury models. Both the abrasion and the cutting model group models had much more Ki67 fluorescence staining positive cells than the control group, but there was no statistically significant difference between the two injury methods (Fig. 2A). It was suggested that DPSCs could be triggered to proliferate after incisor injury and revealed that there was no difference in the proliferation of DPSCs between abrasion and cutting methods by the inconsistent degree of injury. However, compared with the control and model groups, the Ki67-positive cells in the drug group showed a different situation. The number of Ki67-positive cells in the drug group was increased after LiCl injection. In the DKK1 group, the number of Ki67-positive cells decreased obviously (Fig. 2B). These results suggested that the increase of proliferative cells after injury might be closely related to the Wnt/β-catenin signaling pathway.

To determine the effect of the Wnt/β-catenin signaling pathway on odontoblast differentiation after incisor injury, the mRNA and protein expressions of dentine sialophosphoprotein (Dspp) were detected by qRT-PCR and Western Blotting in the injury model after 7 days of LiCl and DKK1 intervention. Compared with the control group, the mRNA and protein levels of Dspp were increased after abrasion and cutting injury (Fig. 2C), but there was no statistical difference between the two injury models, suggesting that DPSCs could be stimulated to differentiate into odontoblasts after incisor injury, but there was no significant relationship between the severity of the injury of incisors. Compared with the two injury model groups, the expression level of Dspp protein in the LiCl injection group was further increased. On the contrary, the Dspp expression level in the DKK1 group was significantly decreased (Fig. 2D, E). These results suggested that the odontoblast differentiation of DPSCs after injury might be intimately related to the Wnt/β-catenin signaling pathway.

3.3 Wnt/β-catenin signaling pathway plays acritical role in the repair and regeneration of dentin-pulp injury

To further clarify an important role of the Wnt/β-catenin signaling pathway in the repair and regeneration process of dentin-pulp injury, we used the dentin-pulp injury model constructed in the previous experiments to detect the expression of β-catenin, Axin2 and Wnt10a in incisor tissue by Western Blotting and qRT-PCR. Compared with the control group, the protein and mRNA expression levels of β-catenin, Axin2 and Wnt10a were significantly increased after two injury methods (Fig. 3A). These results indicated that the Wnt/β-catenin signaling pathway could be activated by dentin-pulp injury. To further demonstrate the definite relationship between the Wnt/-catenin signaling pathway and dentin-pulp injury repair and regeneration, the Wnt/β-catenin signaling pathway agonist LiCl and the inhibitor DKK1 were used to intervene in the two injury models. The expressions of β-catenin, Axin2 and Wnt10a protein in incisor tissue were detected by Western Blotting on the 7th day after intervention. Compared with the model group, the expression levels of β-catenin, Axin2 and Wnt10a protein in the LiCl intervention group were further increased. On the contrary, β-catenin, Axin2 and Wnt10a protein expression levels were significantly decreased in the DKK1 intervention group (Fig. 3B, C, D). These results suggested that Wnt10a might play an important role in the regulation of the Wnt/β-catenin signaling pathway in the repair and regeneration of incisor dentin-pulp injury.

3.4 DPSCs have remarkable mesenchymal stem cell properties

Flow cytometry results showed that the mesenchymal markers in dental pulp stem cells CD44, CD105 and CD146 were positive, while the hematopoietic markers CD45, CD34 and CD31 were negative (Fig. 4A). DPSCs were long spindle-shaped and grew in clusters, which were the typical morphology of mesenchymal stem cells (Fig. 4B). Oil red O staining showed obvious adipogenic induction and differentiation of P3

generation mouse DPSCs after 14 days of adipogenesis induction (Fig. 4C). Alizarin red staining showed obvious osteogenic induction and differentiation of P3 generation mouse DPSCs after 14 days of osteogenic induction (Fig. 4D). The chondrogenic induction and differentiation of P3 generation mouse dental pulp stem cells were also performed. After 5 weeks of induction, paraffin sections were routinely prepared and Alsinlan staining showed that chondrogenic induction was obvious (Fig. 4E). These results proved that the isolated and cultured mouse DPSCs had good stem cell characteristics.

3.5 Cellular experiments revealed that the Wnt/β-catenin signaling pathway plays an important role in regulating proliferation and odontoblast differentiation of mouse DPSCs

Proliferation of primary cultured DPSCs intervened by LiCl and DKK1 was observed by using EDU staining. The control group, the LiCl group and the DKK1 group had EDU-staining positive cells. However, there was a significant difference among the three groups. The number of EDU staining positive cells in the LiCl group was more than in the control group, while the number of EDU staining positive cells in Dkk1 group was very small. (Fig. 5A, B). The results demonstrated that LiCl intervention significantly enhanced the proliferation of DPSCs whereas DKK1 greatly inhibit this process. The results of in vivo experiments and cell experiments were consistent, prompting that the accelerated proliferation of DPSCs was closely related to the activation of the Wnt/β-catenin signaling pathway. To further determine the effect of the Wnt/β-catenin signaling pathway on odontoblast differentiation, Dspp immunofluorescence staining was used to test the primary cultured mouse DPSCs stimulated by LiCl and DKK1. We found that the number of Dspp positive cells in LiCl group was significantly higher than that in control group, while in DKK1 group was much lower, which indicate that LiCl intervention significantly boosted Dspp expression in mouse DPSCs, but DKK1 stimulation significantly inhibited this process (Fig. 5C, D). In addition, the expression of the Dspp protein was also examined by using Western blotting to ascertain the odontoblast differentiation of mouse DPSCs. In comparison to the control group, the relative DSPP level was higher in the LiCl group and lower in the DKK1 group (Fig. 5E, F). The results suggested that LiCl intervention considerably enhanced the differentiation of mouse DPSCs into odontoblasts, while DKK1 stimulation significantly hindered this process. These results suggested that proliferation and odontoblast differentiation of DPSCs might be intimately related to the Wnt/β-catenin signaling pathway.

3.6 Cellular experiments revealed that the Wnt/β-catenin signaling pathway was significant in the repair and regeneration process and Wnt10a played an important role in it

To further confirm the important role of the Wnt/β-catenin signaling pathway in the repair and regeneration process, Western Blotting was used to detect β-catenin, Axin2 and Wnt10a protein expressions in cellular experiments. After LiCl intervention, the expressions of β-catenin, Axin2 and Wnt10a protein increased in comparison to the control group. Instead, after the DKK1 intervention, the expression of these proteins was markedly reduced (Fig. 6A, B, C, D). The cell experiments supported the in vivo studies, which confirmed that the accelerated odontoblast differentiation of DPSCs was closely related to the activation of the Wnt/β-catenin signaling pathway. In this process, the change of Wnt10a is positively correlated with the activation or inhibition of Wnt/β-catenin signaling pathway, that is, the expression of Wnt10a increases with the activation of Wnt/β-catenin signaling pathway and the expression of Wnt10a decreases with the inhibition of Wnt/β-catenin signaling pathway. Wnt10a played an important role in it.

The research on the repair and regeneration of tooth injury has always been a hot topic in stomatology and the construction of a dental injury model is the primary problem that needs to be solved. When the tooth is damaged due to caries, mechanical wear and trauma, the inflammatory reaction will stimulate the pulp stem cells to perform the repair function. The study using abrasion and cutting methods aims to simulate the dental pulp exposure caused by caries, iatrogenic pulp perforation and trauma directly caused by tooth fracture in clinical practice and to analyze the situation of dental repair after injury under different circumstances more comprehensively^[24–29]. Early studies have shown that when the dental pulp is damaged severely, the dental pulp cells migrate from the central area of the dental pulp to the marginal area of the dental pulp and differentiate into odontoblasts, which replace the necrotic odontoblasts to produce restorative dentin^[30–32]. Therefore, dentin-pulp regeneration involves DPSCs migrating to the site of injury and proliferating, and further differentiating into odontoblast-like to form tertiary dentin^[21]. This study uses the mice incisors as the research object because its mesenchymal stem cells remain in the adult stage, which can realize self-renewal and damage repair. Repair and regeneration after injury of mice incisor including enamel, dentin and dental pulp, but the enamel regeneration mainly derived from stem cells in the epithelium, dentin and dental pulp regeneration mainly from mesenchymal stem cells. Since dental pulp includes vascular, nerve bundles and a variety of cell groups, it is complicated to study its repair and regeneration alone. Therefore, this study focused on the repair and regeneration of the dentin-dental pulp complex, laying a foundation for further research.

Dentin-pulp regeneration is closely related to the regulation of signaling pathways. The Wnt/β-catenin signaling pathway has been demonstrated to play an important role in tooth development, including cell fate differentiation, determination, polarization, migration and cell proliferation. However, the repair effect of the Wnt/β-catenin signaling pathway after incisor injury in adult mice is unclear and even less for a comparative study between different injury models. In this study, the mouse incisor dentin-pulp injury model was successfully constructed by the abrasion method and cutting method respectively. It was observed that the restorative dentin was formed in the pulp cavity after an injury and the general observation showed that the cutting method was significantly slower than the abrasion method in incisor injury repair, which maybe related to the area of injury. Under the intervention of LiCl, the activator of the Wnt/β-catenin signaling pathway, showed the shortest repair time, while DKK1, the inhibitor of this pathway, had the longest repair time. These results indicated that activation of the Wnt/β-catenin signaling pathway contributes to the repair of dentin-pulp injury. It is speculated that the classical Wnt pathway may promote the repair of dental pulp injury by stimulating the proliferation and odontoblasts differentiation of DPSCs.

To confirm the above speculation, we conducted animal experiments and cell experiments respectively. It was observed that DPSCs proliferation could be stimulated by different injury methods through Ki67 immunofluorescence staining and EDU staining. Then, the results of Western Blotting showed that DKK1 could inhibit the proliferation of DPSCs, while LiCl could stimulate this process, indicating that the proliferation of DPSCS could be stimulated by dentin-pulp injury and was closely related to the regulation of Wnt/β-catenin signaling pathway. As a specific marker protein for odontoblasts^[33], Dspp (Dentin sialophosphoprotein) is a non-collagen protein with the most abundant content in dentin and plays a specific and crucial role in mineralized dentin formation. In our study, the expression of Dspp and Wnt10a increased after incisor injury and the activation of the Wnt/β-catenin pathway, suggesting that Wnt10a may promote the proliferation and odontoblasts differentiation of DPSCs, then promoting the repair of dental pulp injury. In vitro data analysis has shown that Wnt10a may be an upstream regulatory protein of Dspp, which can regulate the expression of Dspp^[34], indicating that Wnt/β-catenin signaling pathway and Wnt10a have important effects on the DPSCs differentiation into odontoblasts. Zhang’s^[35] results showed that increased expression of Wnt10a promoted the proliferation of hDPSCs and inhibited their odontoblast differentiation by overexpressing Wnt10a through lentiviral transfection of hPSC cells. However, different results were observed in our study. We observed that the activation of the Wnt/β-catenin signaling pathway can not only stimulate the proliferation of DPSCs, but also promote the odontoblasts differentiation of DPSCs and benefit the repair and regeneration of dentin-pulp injury through animal experiments and DPSCs culture in vitro. In this process, the expression of Wnt10a also increases. Moreover, the opposite result was observed with the inhibition of Wnt/β-catenin signaling.

The differences in the results of different studies suggest that the role of Wnt10a on the proliferation and differentiation of DPSCs is not absolute, but also depends on the type of cells and the interaction with other cytokines and signaling pathways. Previous studies on Wnt10a have focused on the formation of root furcation^[36–38] and congenital anodontia^[33] and Wnt10a was considered to be a regulatory factor acting on the classical Wnt pathway. But in recent years, some researchers^[34] have successively focused on the fact that Wnt10a also acts through the non-classical PCP and Wnt/Ca²⁺ pathways. In summary, Wnt10a and the Wnt/β-catenin signaling pathway play an important role in regulating the proliferation and odontoblast differentiation of DPSCs after injury, but the specific regulatory mechanism remains unclear. Téclès et al^[39] suggested that the balance between stem cell quiescence and activation is a momentous factor for maintaining tissue homeostasis, stimulating growth and initiating repair, etc. DPSCs also have completely similar characteristics. After the completion of tooth development, DPSCs are in the quiescent phase of the cell cycle. When the dentin and pulp are severely damaged, DPSCS will re-enter the cell cycle, stimulate the proliferation and differentiation into odontoblasts and then produce restorative dentin. We still need to develop a further in-depth study to reveal whether the regulation of the Wnt/β-catenin signaling pathway on proliferation and odontoblast differentiation of DPSCs after injury be related to the cell cycle, but the experimental results of this study are good inspirations for future studies and provide reliable basic experimental data for the clinical translation of restorative regeneration after dentin-pulp injury.

Availability of data and materials

All data generated or analyzed during this study are included in this published article.

Funding

Kunming Medical University Applied Basic Research Joint Special Fund of Science and Technology Department of Yunnan Province (No. 202101AY070001-188)
The National Natural Science Foundation of China (No. 82260184),
The Foundation of Oral Disease Clinical Medical Research Center of Yunnan Province (No. 2022LX004F)
The Scientific Research Fund Project of Education Department of Yunnan Province (No. 2020J0212)
The Science and Technology Innovation Team Project of Yunnan Province (No. 202105AE160004)
Scientific and technological innovation team of multi-stage and multidisciplinary integration prevention and treatment of malocclusion deformities of Kunming Medical University.（No.CXTD202213)

Author information

Yue Li and Meiying Wu contributed equally to this work.

Authors and Affiliations

Corresponding author: Congchong Shi, ORCID:0009-0001-0952-6549, Department of Orthodontics, Kunming Medical University School and Hospital of Stomatology, Kunming 650106, China; Yunnan Key Laboratory of Stomatology, Kunming 650106, China; Email: [email protected].
First author: Yue Li , Department of Orthodontics, Kunming Medical University School and Hospital of Stomatology, Kunming 650106, China; Yunnan Key Laboratory of Stomatology, Kunming 650106, China; Email: [email protected].
Co-first author: Meiying Wu, Department of Orthodontics, Kunming Medical University School and Hospital of Stomatology, Kunming 650106, China; Yunnan Key Laboratory of Stomatology, Kunming 650106, China; [email protected].
The Second author: Xinyu Xing , Department of Orthodontics, Kunming Medical University School and Hospital of Stomatology, Kunming 650106, China; Yunnan Key Laboratory of Stomatology, Kunming 650106, China; Email: [email protected].
Third author: Xingxing Li , Department of Prosthodontics，Kunming Medical University School and Hospital of Stomatology, Kunming 650106,China; Yunnan Key Laboratory of Stomatology, Kunming 650106, China; Email: [email protected].

Authors' contributions

Congchong Shi designed the research. Yue Li, Meiying Wu and Xinyu Xing conducted the experiment. Yue Li, Meiying Wu, Xinyu Xing and Xingxing Li andalyzed the data and wrote the paper. All authors read and approved the final manuscript.

Ethics approval and consent to participate

The experimental protocol had been reviewed and approved by the Animal Ethics Committee of Kunming Medical University, approval number: KMMU2020292.

Conflict of interest

All authors declare that they have no conflict of interest.

Informed consent

All participants signed the informed consent.

Consent for publication

All authors agree to publish this paper.

Anthony J, Smith HF, Duncan, Anibal D-iogenes, Simon S, Paul R, Cooper. Exploit-ing the Bioactive Properties of the Dentin-Pulp C-omplex in Regenerative Endodontics [J]. J Endod. 2016;42(1):47–56.
Chai Yang S, Harold C. Prospects for to-oth regeneration in the 21st century: a perspective [J]. Microsc Res Tech. 2003;60(5):469–79.
Petti S, Glendor U, Andersson L. World traumatic dental injury prevalence and incidence, a meta-analysis-One billion living people have had traumatic dental injuries. Dent Traumatol. 2018;34(2):71–86.
Sønstevold Tonje,Johannessen Anne Christine,Stuhr Linda. A rat model of radiatio injury in the m-andibular area [J]. Radiation oncology (London, England), 2015, 10(1): 129.
Tsutsui TW. Dental Pulp Stem Cells: Advanc-es to Applications [J] Stem Cells Cloning. 2020, 13(13):33–42.
About I. Dentin-pulp regeneration: the primord-ial role of the microenvironment and its modification by traumatic injuries and bioactive materials [J] End-od Top 2013, (28):61–89.
Yu T, Klein Ophir D. Molecular and cellular mechanisms of tooth development, homeos-tasis and repair [J]., Development. (Cambridge, Eng-land), 2020, 147(2): dev184754.
Shi C, Yuan Y, Guo Y, Jing J, Ho TV, Han X, Li J, Feng J, Chai Y. BMP Signaling in Reg-ulating Mesenchymal Stem Cells in Incisor Hom-eostasis [J]. J Dent Res. 2019;98(8):904–11.
Doolan BJ, Onoufriadis A, Kantaputra P, McGrath JA. WNT10A, dermatology and dentistry [J]. Br J Dermatol. 2021;185(6):1105–11.
Zhang Z, Guo Q, Tian H, Lv P, Zhou C, Gao X. Effects of WNT10A on proliferation and differentiat-ion of human dental pulp cells [J]. J Endod. 2014;40(10):1593–9.
Wang XP, Suomalainen M, Felszeghy S, Zelarayan LC, Alonso MT, Plikus MV, Maas RL, Chuong CM, Schimmang T, Thesleff I. An integ-rated gene regulatory network controls stem cell prol-iferation in teeth [J]. PLoS Biol. 2007;5(6):e159.
Sonoyama W, Liu Y, Fang D, Yamaza T, Seo BM, Zhang C, Liu H, Gronthos S, Wang CY, Wang S, Shi S. Mesenchymal stem cell-mediatedfunctional tooth regeneration in swine [J]. PLoS ONE. 2006;1(1):e79.
Zhang W, Walboomers XF, Shi S, Fan M, Jansen JA. Multilineage differentiation potential of stem cells derived from human dental pulp after cryopreservati-on [J]. Tissue Eng. 2006;12(10):2813–23.
Miura M, Gronthos S, Zhao M, Lu B, Fisher LW, Robey PG, Shi S. SHED: stem cells from human exfoliated deciduous teeth [J]. Proc Natl Acad-Sci USA. 2003;100(10):5807–12.
Chen Y, Lin MC, Yao H, Wang H, Zhang AQ, Yu J, Hui CK, Lau GK, He ML, Sung J, Kung HF. Lentivirus-mediated RNA interference targeting en-hancer of zeste homolog 2 inhibits hepatocellularcarcinoma growth through down-regulation of stath-min [J]. Hepatology. 2007;46(1):200–8.
Arthur A, Rychkov G, Shi S, Koblar SA, Gront-hos S. Adult human dental pulp stem cells different-iate toward functionally active neurons under approp-riate environmental cues [J]. Stem Cells. 2008;26(7):1787–95.
Király M, Porcsalmy B, Pataki A, Kádár K, Jelitai M, Molnár B, Hermann P, Gera I, Grimm WD, Ganss B, Zsembery A, Varga G. Simulta-neous PKC and cAMP activation induces differenti-ation of human dental pulp stem cells into functionally active neurons [J]. Neurochem Int. 2009;55(5):323–32.
Sakai K, Yamamoto A, Matsubara K, Nakamura S, Naruse M, Yamagata M, Sakamoto K, Tauchi R, Wakao N, Imagama S, Hibi H, Kadomatsu K, Ishiguro N, Ueda M. Human dent-al pulp-derived stem cells promote locomotor recove-ry after complete transection of the rat spinal cord by multiple neuro-regenerative mechanisms [J]. J Clin In-vest. 2012;122(1):80–90.
de Almeida FM, Marques SA, RamalhoBdos S, Rodrigues RF, Cadilhe DV, Furtado D, Kerkis I, Pereira LV, Rehen SK, Martinez AM. Human dental pulp cells: a new source of cell therapy in a mouse model of compressive spinal cord injury [J]. J Neu-rotrauma. 2011;28(9):1939–49.
Leong WK, Henshall TL, Arthur A, Kremer KL, Lewis MD, Helps SC, Field J, Hamilton-Bruce MA, Warming S, Manavis J, Vink R, Gr-onthos S, Koblar SA. Human adult dental pulp stem cells enhance poststroke functional recovery through nonneural replacement mechanisms [J]. Stem Cells Tr-ansl Med. 2012;1(3):177–87.
Taghipour Z, Karbalaie K, Kiani A, Niapour A, Bahramian H, Nasr-Esfahani MH, Baharvand H. Transplantation of undifferentiated and induced human exfoliated deciduous teeth-derived stem cells promote functional recovery of rat spinal cord contusion injury model [J]. Stem Cells Dev. 2012;21(10):1794–802.
Yamamoto A, Sakai K, Matsubara K, Kano F, Ueda M. Multifaceted neuro-regenerative activities of human dental pulp stem cells for functional recovery after spinal cord injury [J]. Neurosci Res. 2014;78:16–20.
Shimojima C, Takeuchi H, Jin S, Parajuli B, Hattori H, Suzumura A, Hibi H, Ueda M, Yamamoto A. Conditioned Medium from the Stem Cells of Human Exfoliated Deciduous Teeth Ameliorates Experimental Autoimmune Encephalomyelitis [J]. J Immunol. 2016;196(10):4164–71.
Doğan A, Demirci S, Apdik H, Apdik EA, Şahin F. Mesenchymal Stem Cell Isolation from Pulp Tissue and Co-Culture with Cancer Cells to Study Their Interactions [J]. J Vis Exp. 2019, (143).
Jernvall J, Thesleff I. Reiterative signaling and patterning during mammalian tooth morphogenesis [J]. Mech Dev. 2000;92(1):19–29.
Sarkar L, Sharpe PT. Expression of Wnt signaling pathway genes during tooth development [J]. Mech Dev. 1999;85(1–2):197–200.
Weltman B, Vig KW, Fields HW, Shanker S, Kaizar EE. Root resorption associated with orthodon-tic tooth movement: a systematic review [J]. Am J Orthod Dentofacial Orthop. 2010;137(4):462–76.
Minear S, Leucht P, Jiang J, Liu B, Zen A, Fuerer C, Nusse R, Helms JA. Wnt proteins prom-ote bone regeneration [J]. Sci Transl Med. 2010;2(29):29–30.
Grejtakova D, Gabrikova-Dojcakova D, Boro-nova I, Kyjovska L, Hubcejova J, Fecenkova M, Zigova M, Priganc M. BernasovskaJ. WNT10A variants in relation to nonsyndromichypodontia in eastern Slovak population [J]. J Genet. 2018;97(5):1169–77.
Park H, Song JS, Shin TJ, Hyun HK, Kim YJ, Kim JW. WNT10A mutations causing oligodontia [J]. Arch Oral Biol. 2019;103:8–11.
Téclès O, Laurent P, Zygouritsas S, Burger AS, Camps J, Dejou J, About I. Activation of human dental pulp progenitor/stem cells in response to odontoblast injury [J]. Arch Oral Biol. 2005;50(2):103–8.
Goldberg M, Smith AJ. Cells and extracellular matrices of dentin and pulp: a biological basis for repair and tissue engineering [J]. Crit Rev Oral Biol Med. 2004;15(1):13–27.
Fitzgerald M, Chiego DJ Jr, Heys DR. Autoradiographic analysis of odontoblast replaceme-nt following pulp exposure in primate teeth [J]. Arch Oral Biol. 1990;35(9):707–15.
Lee HK, Lee DS, Park SJ, Cho KH, Bae HS, Park JC. Nuclear factor I-C (NFIC) regulates dentin sialophosphoprotein (DSPP) and E-cadherin via control of Krüppel-like factor 4 (KLF4) during dentinogenesis [J]. J Biol Chem. 2014;289(41):28225–36.
Yamashiro T, Zheng L, Shitaku Y, Saito M, Tsubakimoto T, Takada K, Takano-Yamamoto T, Thesleff I. Wnt10a regulates dentin sialophosphop-rotein mRNA expression and possibly links odontob-last differentiation and tooth morphogenesis [J]. Differentiation. 2007;75(5):452–62.
Zhang Z, Guo Q, Tian H, Lv P, Zhou C, Gao X. Effects of WNT10A on proliferation and differentiat-ion of human dental pulp cells [J]. J Endod. 2014;40(10):1593–9.
Yu M, Liu Y, Wang Y, Wong SW, Wu J, Liu H, Feng H, Han D. Epithelial Wnt10a is Essential for Tooth Root Furcation Morphogenesis [J]. J Dent Res. 2020;99(3):311–9.
Park H, Song JS, Shin TJ, Hyun HK, Kim YJ, Kim JW. WNT10A mutations causing oligodontia [J]. Arch Oral Biol. 2019;103:8–11.
Cao X, Wang X, Zhang W, Xia G, Zhang L, Wen Z, He J, Wang Z, Huang J, Wu S. WNT10A induces apoptosis of senescent synovial resident stem cells through Wnt/calcium pathway-mediated HDAC5 phosphorylation in OA joints [J]. Bone. 2021;150:116006.
Téclès O, Laurent P, Zygouritsas S, et al. Activat-ion of human dental pulp progenitor/stem cells in response to odontoblast injury [J]. Arch Oral Biol. 2005;50(2):103–8.

No competing interests reported.

floatimage1.jpeg
Graphical Abstract

Download PDF

Version 1

posted

You are reading this latest preprint version

Effect of Wnt/β-catenin signaling pathway on repair and regeneration after dentin-pulp injury

Status:

Version 1

Abstract

Figures

In Brief

Highlights

1 Introduction

1 Materials and Reagents

1.1 Experimental Animals

1.2 Reagents

1.3 Instruments

2 Methods

2.1 Mice incisor injury model assay

2.2 qRT-PCR analysis

2.3 Immunofluorescence staining

2.4 Western Blotting analysis

2.5 Isolation and identification of mouse dental pulp stem cells

2.6 Osteogenesis, lipogenesis and chondrogenesis induction and identification of dental pulp stem cells

2.8 Statistical analysis

3 Results

3.1 LiCl intervention promoted the adult mouse incisor injury repair, whereas DKK1 inhibited the process

3.3 Wnt/β-catenin signaling pathway plays acritical role in the repair and regeneration of dentin-pulp injury

3.4 DPSCs have remarkable mesenchymal stem cell properties

4 Discussion

Declarations

Ethics approval and consent to participate

Conflict of interest

Informed consent

Consent for publication

References

Additional Declarations

Supplementary Files

Status:

Version 1