Efficacy of lyophilized Lactobacillus sakei as a potential candidate for the prevention of carbapenem-resistant Klebsiella infection

doi:10.21203/rs.3.rs-2834556/v1

Download PDF

Research Article

Efficacy of lyophilized Lactobacillus sakei as a potential candidate for the prevention of carbapenem-resistant Klebsiella infection

https://doi.org/10.21203/rs.3.rs-2834556/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background

Antimicrobial resistance has been considered one of the greatest threats to human health, according to the World Health Organization (WHO). Gram-negative bacteria, especially carbapenem-resistant Enterobacteriaceae (CRE), drive this alarming trend.Among CRE pathogens, carbapenem-resistant Klebsiella pneumonia (CRKP) has recently been reported as a highly infectious one responsible of a high mortality and morbility in adults and immunocompromised patients. Additionally, CRKP-related infections are challenging to treat, as carbapenems are the last resort of antibiotics. Therefore, developing novel drugs with different mechanism of action from the existing drugs is urgently required to defeat this lethal menace. In these circumstances, probiotics intended for being a potential choice to be a therapeutic candidate and inhibit the pathogens. Thus, our research team has been focusing on probiotics for a long time to develop potential anti-CRKP drug agents.

Methods

After such efforts, we finally found a novel Lactobacillus sakei PMC104 derived from kimchi, a probiotic strain suitable for treating CRE infection. Next, as part of our expansion into therapeutic development, we did media optimization at food grade and then established a scale-up process to pilot scale. A lyophilizate was then obtained, which was subsequently used in a mouse model infected with CRKP.

Results

Data showed that treatment with L. sakei powder remarkably diminished the body weight loss, mortality, and illness severity in CRKP-infected mice which shows the preventive effect of our PMC 104 against CRKP infection.

Discussion

Our results exhibit the potential therapeutic effect of our candidate probiotic strain opposed to the CRKP, advocating that L. sakei can be congested as an antimicrobial candidate for treating CRKP infections. However, extensive studies such as toxicity tests and clinical trials are still needed to develop it as a new anti-CRE therapeutic agent.

carbapenem-resistant Klebsiella

Lactobacillus sakei

probiotics

pilot-scale production

food-grade medium

Antimicrobial resistance (AMR) caused by drugs used to treat infections can make drugs no longer practical for pathogens. It has emerged as a global public health threat of the 21st century (Hu et al., 2020). According to recently published data in 2022, 4.95 million deaths were associated with bacterial AMR in 2019, including 1.27 million deaths directly attributable to bacterial AMR (Murray et al., 2022). Among AMR infections, carbapenem-resistant Enterobacteriaceae (CRE) has been identified as one of the primary pathogens associated with high mortality and mobility, particularly in clinical settings over the last two decades (Munoz-Price et al., 2013; Ventola, 2015). Infections due to CRE in healthcare settings are on the rise. They are assigned to the category of “urgent threats.” According to the Center for Disease Control and Prevention (CDC), 13,100 CRE infections were estimated among hospitalized patients, with 1,100 deaths in the USA in 2017 (Control and Prevention, 2019).

Enterobacteriaceae is a Gram-negative bacterium that has progressively developed the broadest spectrum of resistance to nearly all last-resort antibiotics (Atterby et al., 2019; Janda and Abbott, 2021). Among them, K. pneumoniae is an opportunistic pathogen responsible for most CRE infections and deaths worldwide (Xu et al., 2017; Centers for Disease Control and Prevention, 2019; Vaez et al., 2019). According to the China Antimicrobial Surveillance Network (CHINET), the resistance of K. pneumoniae to meropenem and imipenem has increased rapidly from 2.9% and 3.0% in 2005 to 26.3% and 25% in 2018, respectively (Han et al., 2020). Moreover, studies have shown that combination therapy with antibiotics is ineffective against this deadly pathogen (Xiao et al., 2020). Therefore, it is urgently necessary to develop antimicrobial agents with different mechanisms of action to overcome the limitation of currently existing carbapenem drugs. Researchers are now trying to overcome this resistance problem by focusing on novel probiotics that can effectively fight against this deadly menace (Davies et al., 2013; Lawrence and Jeyakumar, 2013; Harikumar and Krishanan, 2022).

According to the World Health Organization (WHO) and the Food and Agriculture Organization (FAO), probiotics are nonpathogenic living microbes that can confer a health benefit to the host organism when they are administered in adequate amounts (Food and Food, 2002). Probiotics have enormous beneficial effects on the host by stimulating different types of immunomodulatory responses, lymphocyte proliferation, and the production of anti-inflammatory regulatory cytokines (Ashraf et al., 2014; Manuel et al., 2017). They also have medicinal properties. Thus, they are widely used as therapeutic candidates (Ishibashi and Yamazaki, 2001; Ukeyima et al., 2010; Ozyurt and Ötles, 2014; Owaga et al., 2015). Several studies have demonstrated the effectiveness of probiotics in treating cutaneous inflammation, managing diabetes, mediating metabolic disease, and treating gastrointestinal disorders (Bekkali et al., 2007; Hacini-Rachinel et al., 2009; Aggarwal et al., 2013; Homayouni-Rad et al., 2017). Additionally, previous studies have shown the potential activities of probiotics against urgent threats, including tuberculosis, HIV, and COVID-19 (Bolton et al., 2008; Olaimat et al., 2020; Liu et al., 2021; Rahim et al., 2022b). Furthermore, they possess antibacterial effects against superbugs such as CRE, vancomycin-resistant Enterococcus (VRE), multidrug-resistant Pseudomonas aeruginosa, and methicillin-resistant Staphylococcus aureus (MRSA). Thus, they could be used as an alternative treatment to nearly all pathogens (Sidjabat et al.; Manley et al., 2007; Mirnejad et al., 2013; McFarland, 2015; Kumar et al., 2016; Moghadam et al., 2018). Previous studies using in-vivo animal models have indicated that Lactobacillus sakei among probiotics can prevent pathogenic bacteria by reducing septic shock and body weight loss in mice and improve illness symptoms (Hong et al., 2014; Lim et al., 2016; Kwon et al., 2018; Ji et al., 2019; Jang and Min, 2020). Therefore, L. sakei has attracted particular attention. It is a good candidate for developing novel probiotic powder as an alternative to conventional antibiotics to treat CRE-related infections (Penchovsky and Traykovska, 2015).

This study aimed to determine the efficacy of L. sakei, isolated from Korean kimchi as a new pharmabiotic alternative among probiotic strains to treat infections caused by CRE, with terms of evaluating the scale-up study and novel food grade medium development.

CRK clinical strain

A CRK Clinical strains were collected from the Infectious Diseases Department of Soonchunhyang University. Upon receiving, they were cultured aerobically overnight at 37 ℃ in MacConkey broth (BD Difco, USA). Afterward, bacteria were cultivate

to OD 1.0, 2×10⁹ CFU/mL at 600 and CRK colonies were isolated as described in previous paper (Tajdozian et al., 2021a).

Isolation of PMC 104

Various fermented food products were used to isolate the candidate probiotic strain, including many fermented kimchi and soybean products. Fermented foods were streaked onto MRS agar (BD Difco, USA) plates containing vancomycin solution (Colombo et al., 2014) at 4 µg/mL (Sigma-Aldrich, USA) followed by incubation at 37 ℃ for 18 h using a microaerophilic chamber (Daeiltech, Korea). Next, single colonies were cultivated into MSR broth (Sigma-Aldrich, USA) and incubated under the same conditions. Subsequently, bacterial growth was measured, and bacteria were washed, centrifuged, and resuspended in 0.85% NaCl solution. The 16S rRNA sequencing analysis was then performed for probiotic culture at Biofact company, Korea.

16S rRNA identification

The 16S rRNA gene sequencing technology was conducted using sequencing protocol and the candidate probiotic was identified analyzed and analyzed at the BIOFACT Co, Korea sequencing company as reported in a previous study (Tajdozian et al., 2021a). The most popular unique sequences were searched against the NCBI (National Center for Biotechnology Information) 16S microbial database using NBLAST. The sequencing resulting hits were sorted first by e-value and then by bit score. The taxonomy of the hit with the highest scoring sequences was then reported.

PCR identification of the candidate probiotic strain

PCR amplification and qPCR analysis were conducted to confirm 16S rRNA sequencing results. Genomic DNA was extracted from the candidate probiotic culture using a bead-beating method, as described previously (Ritchie et al., 2010). We also extracted genomic DNAs from L. sakei KGMB05070 (used as positive control), Lactobacillus curvatus KGMB 05016, and Lactobacillus rhamnosus KGMB 06348 (used as negative control) obtained from the Korean Gut Microbiome Bank (KGMB) as reference organisms. DNA quality and concentrations analyzed using0.8% agarose gel electrophoresis and Qubit-4 fluorometer (Thermo Fisher Scientific, UK), respectively. After that, PCR amplification was performed using species-specific primers (F: GATAAGCGTGAGGTCGATGGTT, R: GAGCTAATCCCCCATAATGAAACTAT) (Justé et al., 2008; Andani et al., 2012) with a Thermal Cycler Applied Biosystems platform (Thermo Fisher Scientific, USA). PCR reactions were carried out and quality of the PCR products were checked using agarose gel electrophoresis. The bands were visualized with a Molecular Imager ChemiDoc XRS + imaging system platform (Thermo Fisher Scientific, USA) after ethidium bromide staining. Quantitative analysis of agarose gel was obtained by an image lab software (version, 6.0.1).

In addition, qPCR was carried out using a LightCycler 480® (BioRad Diagnostics, USA) based on SYBR Green detection (SYBR Green 2× Master mix; Qiagen, USA) with the same primers as described above. A triplicate reaction of each sample (Candidate stain, L. curvatus KGMB 05016, and L. rhamnosus KGMB 06348) and the PCR conditions optimized as described in (Seo et al., 2023).

Biochemical tests

The API 50CH Biochemical test was used to illustrate the biochemical profiles of our candidate probiotic. A single colony of our candidate strain culture was merged in a 1 mL suspension medium. Afterward, when turbidity caused by 2 McFarland reached its maximum, 1 mL of suspension was diluted in 10 mL of CHB medium (bioMerieux, France). Finally, the API kit strip (bioMerieux, France) wells were filled with the bacterial suspension and incubated at 37 ℃ for 48 h. Later, an identification table was assembled as (+/-) according to the color shifts of each well.

Preparation of food grade media (FGM) and edible FGM (EFGM)

According to a previous study, seven types of FGMs were prepared based on MRS medium to cultivate our probiotic strain using a lab-scale fermenter (Sawatari et al., 2006). FGM compositions containing the yeast-peptone standard type of F (MB cell, Korea), tween 80 (Sigma-Aldrich, USA), d-glucose (Sigma-Aldrich, USA), magnesium sulfate heptahydrate (Sigma-Aldrich, USA), sodium acetate 3M (Biosesang, Korea), sodium acetate (Sigma-Aldrich, USA), and trisodium citrate (MB cell, Korea) mentioned in Table 1 were used to develop FGM medium. After preparation, the pH values of all FGMs except FGM 1 were adjusted to 6.4 using NaOH (Sigma Aldrich, USA). Initial pHs of FGM 2, FGM 3, FGM 4, FGM 5, FGM 6, and FGM 7 were 6.3, 6.2, 6.5, 6.1, 5.8, and 6.0, respectively. Next, all FGMs were sterilized at 121 ℃ for 15 min. The probiotic strain was then inoculated into the prepared FGMs and incubated at 37 ℃ for 18 h. Subsequently, the OD was checked with a spectrophotometer. Bacterial culture from the best grown FGM was stored (OD₆₀₀ = 1.0, 2 × 10⁸ CFU/mL) at -80 ℃ using 20% glycerol.

Table 1

Ingredients of optimized food grade media (FGM)
Ingredients	Concentration (g/L)
Ingredients	MRS media	FGM 1	FGM 2	FGM 3	FGM 4	FGM 5	FGM 6	FGM 7
Glucose	-	20	20	20	20	20	20	20
Yeast peptone standard type F	-	25	25	25	25	25	25	25
Proteose peptone No. 3	10	-	-	-	-	-	-	-
Beef extract	10	-	-	-	-	-	-	-
Yeast extract	5	-	-	-	-	-	-	-
Dextrose	20	-	-	-	-	-	-	-
Tween 80	1*	1*	1*	1*	1*	1*	1*	1*
Triammonium citrate	2	-	-	-	-	-	-	-
Trisodium citrate	-	2.1	-	2	-	2	2.1	2
Sodium acetate	5	5	-	5	5	-	-	-
Sodium acetate 3M	-	-	-	-	-	-	5	-
magnesium sulfate	0.1	0.1	0.2	0.3	0.2	0.3	0.1	0.2
Manganese (II) sulfate	0.05	-	-	-	-	-	-	-
Dipotassium phosphate	2	-	-	2	-	-	-	2
*mL

We also prepared edible FGM (EFGM) for pilot plant fermentation by optimizing the FGM so that our probiotic strain could grow the best. The EFGM consisted of glucose (Dong-A Chemical Co., Ltd, Korea), yeast extract (Sensient Flavors, USA), sodium (hanjusalt, Korea), soy peptone A2 SC (Organotechnie, France), magnesium sulfate (Bittersalz chemisch rein, Germany), and tween-80 (Kao corporation, Japon). Detailed compositions of EFGM are listed in Table S1. After preparing EFGM, the pH was adjusted using NaOH.

Inoculum preparation for a scale-up process

For a scale-up process, we prepared L. sakei inoculum from lab scale to industrial scale step by step. 1 mL of stored probiotic culture broth was inoculated into 10 mL of EFGM and incubated at 37 ℃ for 18 h in a microaerophilic chamber. After that, 3 mL of grown culture was transferred into 500 mL of EFGM and incubated overnight under the abovementioned conditions. Next, for preparing industrial-scale inoculum, the previously grown whole culture was transferred into 5 L of fresh EFGM and incubated at 37 ℃ for 24 h in a shaking incubator at 200 rpm.

Fermentation, freeze-drying, and packaging

For an industrial-scale pilot plant fermentation, the grown culture inoculum was transferred to a 500 L pilot plant scale-up facility fermenter (Kobiotec, Korea) containing 200 L of autoclaved EFGM. Compositions of EFGM included glucose (5 kg), yeast extract (2.5 kg), sodium (1.25 kg), soy peptone A2 SC (2.5 kg), magnesium sulfate (50 g), tween 80 (250 mL), and distilled water. The fermentation process was performed at 37 ℃ with only agitation at 25 rpm (no sparging of air or N₂ gas) and the pH was maintained at 6.0 using 28% (w/v) NH₄OH. During fermentation, the culture broth was collected aseptically at 0, 8, 16, 18, and 22 h of incubation. The residual glucose concentration was analyzed using an Agilent 1200 series HPLC (high-performance liquid chromatography) system (Agilent Technologies, USA). The growth rate of the probiotic strain was also determined turbidimetrically with a spectrophotometer at 600_nm. After fermentation, centrifugation was performed with a disc centrifugal separator (DHC-400, Hanil, Korea) at 7,000 rpm. Cells were then collected and homogenized using 5% (w/v), 1.5 kg of reconstituted skim milk (RSM). Next, to produce probiotic powder from harvested cells, freeze-drying was performed at -60 ℃ for 72 h under a pressure of 6.7 × 10^− 2 mbar using a 50 L freeze-dryer (PVTFD 50R, Korea). 2.5 kg out of 3.0 kg produced powder was packed for further experiments. Before packaging, some food additive ingredients including D-glucose (5 kg), dextron (1 kg), and cornmeal (1 kg) were added into the powder and blended by pin crusher machine at 380.3-volt Power (Sung Chang Machinery, Korea). Subsequently, the mixed powder was packed using polyethylene material with an auto packaging machine (Sae Han F&B, Korea) in Techno pack, Cheonan, Korea. During 3 h of the packaging process, 1,672 probiotic powder bags were produced and stored at room temperature until use in further experiments.

Experimental design for in vivo efficacy test

Animal experiments using specific pathogen-free (SPF) BALB/c female mice (9 weeks old) purchased from Doo Yeol Biotech company, Korea were performed and approved as described previously (Tajdozian et al., 2021b) (approval number: SCH23-0004). All mice were randomly divided into two groups (infection and treatment groups; n = 5 per group) for both models. Briefly, two preventive mice experiments were performed to estimate the efficacy of our candidate probiotic against CRE infection. In the first model, we investigated the long-term preventive effect by administering probiotic culture before infection. In the second model, we treated mice with probiotic powder instead of culture. In both models, the group treated with probiotic received L. sakei culture or L. sakei powder during treatment with probiotic. In contrast, the infection group only received sterile saline through oral gavage similarly under the same conditions. Sodium bicarbonate (NaHCO₃) was administered before CRE infection to both models to increase the severity of infection by neutralizing stomach acidity (Czuprynski and Faith, 2002). Additionally, the neutropenia was induced three days prior to the infection at 450 mg/kg intraperitoneally by 200 µl of cyclophosphamide injection (Sigma Aldrich, USA) (Pan et al., 2015). The survival rate, body weight, and illness score of mice in both models were obtained during the experimental.

Long-term treatment efficacy of L. sakei in CRE-infected mice model

We estimateed the long-term preventive effect of our probiotic strain L. sakei in CRE- infected BALB/c mice. The probiotic culture was prepared using EFGM and adjusted to an approximate concentration of 3×10⁹ CFU/mouse (200 µL/mouse) using NaCl solution. The probiotic culture was administered twice a day by oral gavage from 3 days before infection to day 29. Three days after neutropenia, 200 µL of CRE was administered to mice orally at 4×10¹⁰ CFU/mouse and 6×10⁹ CFU/mouse on days 0 and 1, respectively. NaHCO₃ (0.2 M, 200 µl) (Sigma Aldrich, USA) was administered before infection.

Preventive effect of L. sakei on CRE-infected mice model

We investigated the preventive potential of L. sakei powder in CRE-infected BALB/c mice. The probiotic powder was first prepared using sterile water and administered to mice at 1×10⁸ CFU/mouse (200 µL per mouse) orally as a single dose from day − 3 to day 7. At the same time, 3 × 10⁸ CFU/mL of probiotic powder was provided through drinking water. In this model, infection was induced orally of CRE at 4×10¹⁰ CFU/mouse (200 µL) on day 0 and 6×10⁹ CFU/mouse on days 1 and 3 with pretreatment of NaHCO₃ (0.2 M, 200µL).

The study of acute toxicity of candidate probiotics

To examine the oral toxicity of L. sakei, a two weeks toxicity assay using adult male guinea pigs was performed and approved, as previously described (Lee et al., 2021), (IACUC) approved number was SCH-22-0111. Animals were separated into two groups (control group and a probiotic treatment, 4 animals per group). L. sakei powder was diluted with sterile water. Guinea pigs in the treatment group received L. sakei powder at 1×10⁸ CFU/animal (200 µL per animal) orally for 14 days whereas the control group received just saline. During the study the body weight and mortality measured and the clinical symptoms obtained.

Whole Genome Sequencing

In order to indicate a better identification for our candidate probiotic, Whole-genome sequencing test was done at the WGS service company (Chunlab Inc. Seoul, Korea). Briefly, Genomic DNA (gDNA) of L. sakei strain was extracted using the QIAamp DNA Mini kit (Qiagen, Germany). Then the PacBio sequencing results were obtained from the HGAP2 protocol using PacBio SMRT Analysis 2.3.0 and, Circlator 1.4.0 (Sanger Institute, UK) was performed resulting in circulated contigs from PacBio sequencing.

Cytotoxicity test

To determine the cell viability of L. sakei extract against RAW 264.7 macrophage cell line, a water-soluble tetrazolium salt (WST) assay was performed. Cells were seeded (1.5 × 10⁵ cells/mL) into a 96-well plate (SPL life science, Korea) and incubated at 37 ℃ overnight with 5% CO₂. After that, RAW cells submitted to the L. sakei extract diluted to various concentrations using fresh media, and incubated again at 37 ℃ for 24 h. Following incubation, 10 µl of WST solution was added to each well. After incubation for 30 min, absorbance was measured and cell viability was checked by a Victor Nivo Multiplate reader (Perkin Elmer, USA) at 450 nm and methylene blue staining, respectively. Cells were seeded onto 2-well cell culture slides (SPL life sciences, Korea), and submitted to our L. sakei strain extract. Finally, cells were counted by a hemocytometer (Marienfeld) using an optical microscope (AX10, Carl Zeiss, Germany).

16S rRNA-based identification of isolated strain

Among colonies isolated from fermented products, a kimchi-derived strain was an effective candidate against CRE infection. After 16S rRNA gene sequencing was conducted for this strain (Table 2), sequences were compared with sequences deposited in the database of NCBI. Results showed that our isolated strain indicates 99% sequence similarities with 16S rRNA gene sequences of L. sakei strains, including DSM 20017, NBRC 15893, and CCUG31331. Additionally, its sequences were similar to those of other strains of the Lactobacillus genus, with similarities ranging from 96–99%. Additionally, NBALST similarity scores showed 186 hits for L. sakei among unique sequences submitted to NCBI (Table S2). These findings identify the isolated strain as a Lactobacillus genus strain.

Table 2

Identification of the isolated bacterial strain based on 16S rRNA gene sequence analysis
NCBI reference	Organism	Length	Score	Identities	Gaps
NR_042443.1	Lactobacillus sakei subsp. sakei strain DSM 20017	1561	2778 bits (1504)	1508/1510 (99%)	0/1510 (0%)
NR_113821.1	Lactobacillus sakei strain NBRC 15893	1499	2763 bits (1496)	1498/1499 (99%)	0/1499 (0%)
NR_104208.1	Lactobacillus sakei subsp. carnosus strain CCUG	1414	2571 bits (1392)	1407/1414 (99%)	4/1414 (0%)
NR_115172.1	Lactobacillus sakei subsp. sakei strain DSM 20017	1406	2590 bits (1402)	1405/1406 (99%)	1/1406 (0%)
NR_042438.1	Lactobacillus graminis strain G90	1548	2712 bits (1468)	1497/1511 (99%)	2/1511 (0%)
NR_114916.1	Lactobacillus graminis strain LMG 9825	1466	2593 bits (1404)	1447/1467 (99%)	6/1467 (0%)
NR_113334.1	Lactobacillus curvatus strain NBRC 15884	1491	2673 bits (1447)	1480/1495 (99%)	6/1495 (0%)
NR_114915.1	Lactobacillus curvatus strain LMG 9198	1401	2505 bits (1356)	1388/1403 (99%)	3/1403 (0%)
NR_042437.1	Lactobacillus curvatus strain DSM 20019	1559	2708 bits (1466)	1497/1511 (99%)	5/1511 (0%)
NR_112753.1	Lactobacillus fuchuensis strain B5M10	1495	2564 bits (1388)	1463/1499 (98%)	6/1499 (0%)
NR_104976.1	Lactobacillus fuchuensis strain LMG 21669	1524	2571 bits (1392)	1469/1506 (98%)	6/1506 (0%)
NR_112157.1	Lactobacillus fuchuensis strain JCM 11249	1329	2193 bits (1187)	1293/1342 (96%)	15/1342(1%)

PCR identification of isolated probiotic

The PCR assay was performed to identify the isolated probiotic strain using a species-specific primer set (Fig. 1). To do that, DNA was extracted, quantified, and amplified. The PCR product was then checked by agarose gel electrophoresis. The resulting data showed clear bands for both the isolated probiotic and positive control strains (L. sakei KGMB 05070). However, non-L. sakei strains (L. curvatus KGMB 05016 and L. rhamnosus KGMB 06348) showed no visible bands (Fig. 1A). The fold change of the signal that appeared in the imaging system was analyzed. The signal was increased 0.9-fold for the isolated probiotic strain and 1.0-fold for the positive control strain, whereas it was 0.12 or 0.05-fold for the two non-L. sakei strains (L. curvatus KGMB 05016 and L. rhamnosus KGMB 06348) (Fig. 1B).

Furthermore, qRT-PCR assay was performed to quantify the isolated probiotic strain. The presence of the isolated strain was detected by a low threshold cycle (Ct) value (21.56 ± 1.19), whereas the two non-L. sakei strains presented high threshold values (~ 40) (Fig. 1C). These results confirmed that our isolated probiotic strain was L. sakei.

Wholegenome analysis results of the selected strain

The whole genome result showed that the PMC 104 strain had a genome size of 2,015,612 bp with an average GC content of 41.1 percent (Fig. 2). According to the functional categorization system Clusters of Orthologous Groups (COG), 1,960 coding sequences (CDSs) were predicted. Among these CDSs, 1,780 proteins were assigned to families of COG. Biological functions could be identified for 1,249 proteins, while 531 CDSs were homologous to conserved proteins whose functions were unknown in other organisms. The other 180 hypothetical proteins did not match any known proteins in the database. Furthermore, 66 t-RNA and 21 r-RNA genes were anticipated. PMC 104 sequences were later submitted to NCBI (National Center for Biotechnology Information).

OrthoANI genomic similarity

The OrthoANI analysis was performed to obtain similarity value between strains with substantial similarities in 16S rRNA analyses using the whole genome sequencing data of PMC 104 (Fig. 3). The ANI values between PMC 104, and all publicly available L. sakei genomes, including Lacticaseibacillus subsp. strain DSM 20017, subsp. strain TMW, and AMBR8 were 98.84, 98.86, and 97.83 percent, respectively, significantly above the cutoff value of 95% for species delineation30. Likewise, the ANI values of our strain with other Lacticaseibacillus species, including rhamnosus AMBR4, casi 12A, and fermentum PMC 101, ranged from 66.57, 67.11, and 65.55 percent, respectively which were all below 80%. These results strongly suggest that the newly discovered strain PMC 104 is L. sakei.

The genomic characteristics difference between L. sakei species strains

The differences of genomic characteristics between PMC 104 and other strains of L. sakei, such as DSM20017, TMW, AMBR8, DS4, and ELA214391 was investigated to shows that our isolated strain is newly discovered (Table 3). The PMC 104 strain differed from other L. sakei strains in genomic size, G + C content, and CDS. The finding showed that PMC 104 is a newly discovered strain of L. sakei.

Table 3

Comparison of chromosomal properties of *L. sakei* strains.
Strain	DSM 20017	TMW	AMBR8	DS4	ELA214391
Sources	Moto starter of sake	Raw sausage	Human nasopharynx	Korean kimchi	Foregut
Genome size (bp)	1,910,247	1,942,056	1,997,834	2,103,571	2,069,589
G + C content (%)	45.0	57.0	73.0	89.0	42.0
Predicted CDS	1,885	1,891	2,012	1,992	2,046
Number of rRNA genes	3	18	7	21	20
Number of tRNA genes	44	66	58	65	66

Biochemical characterization of PMC 104

The biochemical characterization was performed to investigate the phenotypic properties of our probiotic strain (Table 4). According to previous studies, an API kit can be used to identify Lactobacillus strains phenotypically and biochemically following complete fermentation based on color changes from purple to yellow in the strip capsule (Casaburi et al., 2016). The test enables the strain to be classified as specified by its ability to utilize 49 different carbohydrates. The result of API kit showed that the isolated strain could ferment four carbohydrates (galactose, fructose, mannose, and N-acetylglucosamine), similar to the carbon utilization pattern of other L. sakei strains (Bajpai et al., 2016).

Table 4

Biochemical proprieties of the candidate strain based on carbohydrate fermentation using API 50 CH kit
Substrates	Results
Control	-	D-Fucose	-
Glycerol	-	L-Fucose	-
Erythritol	-	D-arabitol	-
D-arabinose	-	L-arabitol	-
L-arabinose	-	Potassium gluconate	-
Ribose	-	Potassium 2 ketogluconate	-
D-Xylose	-	Potassium 5 ketogluconate	-
L-Xylose	-	D-Tagatose	-
Adonitol	-	Methyl-αD-mannopyranoside	-
Methyl-βD-xylopyranoside	-	Methyl-αD-glucopyranoside	-
D -galactose	+	N-acetylglucosamine	+
D-glucose	-	Amygdaline	-
D-fructose	+	Arbutin	-
D-mannose	+	Esculin	-
L-sorbose	-	Salicin	-
L-rhamnose	-	D-Cellobiose	-
Dulcitol	-	D-Maltose	-
Inositol	-	D-Lactose	-
D-mannitol	-	D-Melibiose	-
D-sorbitol	-	D-Saccharose	-
D-Melezitose	-	D-Trehalose	-
D-Raffinose	-	Inulin	-
Starch	-	D-Turanose	-
Xylitol	-	D-Lyxose	-
Gentibiose	-

Cultivation of L. sakei based on the food grade medium

The probiotic strain was cultured in seven types of FGMs, and bacterial growth after 18 h was checked with a spectrophotometer (Fig. 4). The data showed that our probiotic strain grew best in medium 2 (OD₆₀₀ = 1.3), whereas it had the lowest growth in medium 1 (OD₆₀₀ = 0.38) and medium 4 (OD₆₀₀ = 0.39), (Fig. 4). Based on this result, medium 2 was selected for culturing our probiotic strain using a lab-scale fermenter. Later, we prepared EFGM by optimizing ingredients used in medium 2.

Pilot fermentation, powder production, and packaging

The proposed industrial process scale-up steps from laboratory to packaging are shown in Fig. 5 and Fig. S1. Figure 5A depicts a schematic diagram of our study. Residual glucose concentration and bacterial growth rate were checked at the same time during the scale-up fermentation process (Fig. 5B, C). Data showed that at 0 to 8 h of fermentation, there was no significant growth of bacteria. Thus, there was no utilization of residual glucose before 8 h. However, after 8 h of incubation, significant growth and utilization of glucose were observed, which continued until 16 h. We also observed that bacterial growth became stable after 18 h of fermentation. After fermentation, bacterial cells were harvested and freeze-dried, and 3.0 kg of probiotic powder was produced. The powder contained a bacterial load of (3–10⁸) CFU/g. Next, 2.5 kg of freeze-dried powder out of 3.0 kg was mixed with some food additives and then packed using polyethylene material, in which each pack contained 4 g of powder.

Evaluation of long-term treatment of CRE infected mice with L. sakei

We investigated the long-term preventive effect of our probiotic strain (Fig. 6). Figure 6A depicts a schematic diagram of our study. During the experimental period the survival rate of the untreated group and treated group were 45% and 80%, respectively (Fig. 6B). We also observed the body weights changes of mice showed severe weight loss in the untreated group compared to the L. sakei treated group (p < 0.001) (Fig. 6C). Mice in the treated group also showed lower scores of illness severity than those in the untreated group (p < 0.05), (Fig. 6D).

Efficacy of L. sakei in preventing CRK infection in a mouse model

The treatment effect of L. sakei powder on CRK infection was evaluated (Fig. 7). Figure 7A depicts a schematic diagram of our study. During this study, we observed the survival rate of mice and found that mice belongs to untreated group died after 4 days of first infection. On the other hand, mice in the treatment group survived during the experimental period (Fig. 7B). We also observed the body weights of mice and found that mice without probiotic treatment indicated significant weight loss (p < 0.001) and died on day 4 while the treated mice were almost stable throughout the study period (Fig. 7C). Illness severity scores of the both group were also observed and we noticed a significant difference between the groups (Fig. 7D). Mice in the infected group suffered from diarrhea and developed weakness leading to higher illness scores, whereas probiotic powder-treated group showed low illness scores (p < 0.001).

Cytotoxicity of L. sakei

The cytotoxicity of L. sakei extract at various concentrations was evaluated using macrophage RAW 264.7 cells (Fig. 8). Data showed that L. sakei extract had no significant cytotoxicity at a concentration up to 20×10⁷ CFU/mL (Fig. 8A). Cell viability was also checked using methylene blue staining. Cells were then observed under a light microscope (Fig. 8B). No significant changes in the morphology of RAW 264.7 cells were observed after treatment with L. sakei extract at 2.5×10⁶ to 20×10⁷ CFU/mL.

Acute oral dose toxicity of L. sakei

Acute oral toxicity of L. sakei was performed through orally administered to guinea pigs at 2 ×10⁸ CFU/mL. No clinical symptoms or body weight changes were found between the group treated with candidate probiotic strain and the group treated with sterile water and all guinea pigs survived until the end of the experiment (Fig. 9) (Table S3).

Most studies have shown that CRE strains are among the main urgent threats due to the emergence of resistance to carbapenem. Over the last few decades, increasing mortality due to CRE infection has been progressively reported (Centers for Disease and Prevention, 2013).

Recently, probiotics have been among the main topics of research studies due to their strong pathogen-killing abilities to eliminate antibiotic-resistant superbugs, including multidrug-resistant Acinetobacter baumannii, vancomycin-resistant Enterococcus (VRE), multidrug-resistant Pseudomonas aeruginosa, methicillin-resistant Staphylococcus aureus (MRSA), and viral pathogens such as SARS-CoV-2 and HIV infections (Manley et al., 2007; Karska-Wysocki et al., 2010; Nagasaki et al., 2010; Asahara et al., 2016; Olaimat et al., 2020; Reikvam et al., 2020). Probiotics have been known for their bacterial mechanisms, such as controlling microbiota compositions at different body sites, killing enteric pathogens directly in the gastrointestinal tract, and enhancing host immunity (Coudeyras et al., 2008; Ishikawa et al., 2010; Yan et al., 2021). However, the effectiveness of probiotics as CRKP alternative drugs against CRE infections has yet to be thoroughly investigated. Therefore, we aimed to develop a new probiotic compound against CRE infection and examine its effect as a novel alternative treatment.

Results of our examination on the effect of probiotic strains against CRE pathogen revealed that the L. sakei strain (isolated from traditional Korean kimchi) had an excellent anti-infective activity to inhibit this deadly infection. The isolated strain was confirmed by 16srRNA sequencing and PCR methods. It was judged to be a new strain of L. sakei. It showed a different carbon use pattern from the existing standard L. sakei strain (Ghorbanian et al.; Rahim et al., 2022a). According to previous studies, the L. sakei strain has an incredible impact against many bacterial pathogens, including Enterococcus faecium, E. coli, K. pneumoniae, Listeria ivanovii subsp. ivanovii, Listeira monocytogenes, Pseudomonas spp., Staphylococcus aureus, Streptococcus caprinus, and Streptococcus spp (Todorov et al., 2012; Ciandrini et al., 2017). L. sakei as one of the main lactic acid bacterial (LAB) strains can protect the host against infections with potential preventive effects according to its bacteriocin production which has been frequently reported to be able to control multi-drug resistant pathogens and bacterial infections (Diep et al., 2000; Vaughan et al., 2001; Mandal et al., 2016; Benítez-Chao et al., 2021; Riesute et al., 2021). Moreover, previous reports have indicated that L. sakei can enhance IgA production and improve the host's immune systems to regulate the intestinal environment (Miyoshi et al., 2021).

According to FDA (U.S. Food and Drug Administration) regulation, probiotics may be drugs under the Food, Drug, and Cosmetic Act (Code, 2013), depending on the intended use of the product (Food, 1938; 1978; Degnan, 2008). Production of probiotic powder reported as an antibiotic alternative has increased dramatically due to their potential benefits for human health (Suvarna and Boby, 2005; da Cruz et al., 2007).

Hence, we used the L. sakei strain to develop a probiotic powder as an antibiotic alternative by constructing industrial processes from upscaling in the pilot plant to packaging. To administer reliable manufacturing processes, large-scale industrial supplements of candidate probiotics demand a safe and low-cost alternative medium with a high density for novel probiotic strains as alternatives to antibiotics (Fenster et al., 2019). Food grade medium has been shown to be safe in terms of food manufacture without causing any changes in industrial scale, making it potentially suitable for human consumption (Sawatari et al., 2006). Therefore, before scaling up from laboratory to pilot plant, L. sakei was grown in modified EFGM medium (edible) in order to improve the FGM from laboratory grade to edible medium grade. To start an industrial application, developing a pilot plant scale is the primary step between laboratory scale-up and new commercial production (Levin, 2001). Therefore, L. sakei culture was transferred to a 200 L pilot scale, and 3 kg of freeze-dried powder was obtained due to L. sakei pilot scale-up fermentation. Freeze-drying and packaging processes were performed to produce L. sakei powder, with its efficacy preserved while avoiding damage or death of lactic acid bacteria during freeze-drying and packaging processes. Freeze-drying and packaging are popular and necessary processes in developing industrial products to improve the shelf-life stability of the final product for a long time as the viability of probiotic bacteria should be maintained to the highest level in order to be able to execute its preventive and therapeutic effects (Vaudant, 2008; Fonseca et al., 2015; do Vale Morais et al., 2016; Quintana et al., 2017). Accordingly, the L. sakei powder was packed with polyethylene material at a ratio of 1:3 to preserve its treatment efficacy. From an industrial point of view, using probiotic powder instead of bacteria culture is preferred due to the higher viability of the product during storage and the ease of use (NAKSING et al., 2019; Oktavia et al., 2020). In addition, our data showed that L. sakei powder had higher efficacy in an in vivo model than L. sakei culture.

In the in vivo experiment of this study, unlike the long-term oral treatment with L. sakei culture, the L. sakei powder showed a more significant effect in reducing the illness severity with an inhibitory effect on CRK strain because all infected mice survived until the end of this study. Other studies have also reported that the probiotic powder can prevent infections by several Gram-negative and Gram-positive pathogens and reduce antibiotic-resistant infections in in vivo experiments (Kechagia et al., 2013; Ghoneum and Abdulmalek, 2021).

Moreover, as probiotic powder must be safe for consumption, a two-week acute oral toxicity study using a mouse model and a cytotoxicity study using macrophage cell lines were performed using L. sakei powder. Both in vivo and in vitro studies showed that L. sakei had no toxicity during treatment.

In conclusion, the results of this study indicate that L. sakei powder can potentially be used as a therapeutic candidate to treat infections caused by multi-resistant pathogens such as CRK in the future as a novel antibiotic alternative. However, further studies such as toxicity tests and clinical trials at the pharmaceutical grade level are needed to develop it as a new drug candidate with high efficacy against CRK infections.

Ethics approval

All animal experiments using specific pathogen-free (SPF) BALB/c female mice, were performed and approved as described by the Institutional Animal Care and Use Committee (IACUC) of Soonchunhyang University (approval number: SCH23-0004). The two weeks’ toxicity assay using adult male guinea pigs was performed and approved by the Institutional Animal Care and Use Committee (IACUC) of Soonchunhyang University, (IACUC) approved number was SCH-22-0111

Consent for publication

All authors of the manuscript have read and approved the final manuscript. That the article is original, has not already been published in a journal, and is not currently under consideration by another journal.

Availability of data and materials

The datasets used or analyzed during the preparation of the review manuscript are available from the corresponding author at reasonable request.

Authors' contributions

Conceptualization: HYS; Methodology: HT, YL, AH, YJ; Former analysis: HT, SK; Resources: SKK, JJ, BO, CK; Writing—review, and editing HT, MR, HS; Visualization: HS, SK; Supervision: HYS; Project administration: HT, HS, SL

Funding

This work was supported by the Technology Innovation Program (20018499), funded by the Korean Ministry of Trade, Industry, and Energy (MOTIE, Korea). It was also supported by MOTIE's Industrial innovation infrastructure construction project (P0021516). This research was also supported by Soonchunhyang University Research Fund.

Acknowledgment

We thank all the researchers at Soonchunhyang University PMC, Korea Research Institute of Bioscience and Biotechnology, and Chungnam Techno Park who helped us achieve the results of this study. Moreover, we also thank Uhjin Song for providing medical advice and for English proofreading this manuscript.

Conflict of interest

The authors have no conflicts of interest relevant to this study to disclose.

GB v, Lackner Cal. App. 3d. Cal: Court of Appeal, 1st Appellate Dist., 3rd Div., Vol. 80, p. 64
Aggarwal J, Swami G, Kumar M (2013) Probiotics and their effects on metabolic diseases: an update. J Clin Diagn research: JCDR 7:173
Andani H, Tukmechi A, Meshkini S, Sheikhzadeh N (2012) Antagonistic activity of two potential probiotic bacteria from fish intestines and investigation of their effects on growth performance and immune response in rainbow trout (Oncorhynchus mykiss). J Appl Ichthyol 28:728–734
Asahara T, Takahashi A, Yuki N, Kaji R, Takahashi T, Nomoto K (2016) Protective effect of a synbiotic against multidrug-resistant Acinetobacter baumannii in a murine infection model. Antimicrob Agents Chemother 60:3041–3050
Ashraf R, Vasiljevic T, Day SL, Smith SC, Donkor OJ J.o.F.F. 2014. Lactic acid bacteria and probiotic organisms induce different cytokine profile and regulatory T cells mechanisms. 6,395–409
Atterby C, Osbjer K, Tepper V, Rajala E, Hernandez J, Seng S, Holl D, Bonnedahl J, Börjesson S, Magnusson U (2019) Carriage of carbapenemase-and extended‐spectrum cephalosporinase‐producing Escherichia coli and Klebsiella pneumoniae in humans and livestock in rural Cambodia; gender and age differences and detection of blaOXA‐48 in humans. Zoonoses Public Health 66:603–617
Bajpai VK, Han J-H, Nam G-J, Majumder R, Park C, Lim J, Paek WK, Rather IA, Park Y-H (2016) Characterization and pharmacological potential of Lactobacillus sakei 1I1 isolated from fresh water fish Zacco koreanus. DARU J Pharm Sci 24:8
Bekkali N-L, Bongers ME, Van den Berg MM, Liem O, Benninga M.A.J.N.j. 2007. The role of a probiotics mixture in the treatment of childhood constipation: a pilot study. 6,1–6
Benítez-Chao DF, León-Buitimea A, Lerma-Escalera JA, Morones-Ramírez JR (2021) Bacteriocins: An Overview of Antimicrobial, Toxicity, and Biosafety Assessment by in vivo Models. Front Microbiol 12:630695
Bolton M, Van Der Straten A, Cohen CR (2008) Probiotics: potential to prevent HIV and sexually transmitted infections in women.Sexually transmitted diseases,214–225
Casaburi A, Di Martino V, Ferranti P, Picariello L, Villani F (2016) Technological properties and bacteriocins production by Lactobacillus curvatus 54M16 and its use as starter culture for fermented sausage manufacture. Food Control 59:31–45
Centers for Disease C, Prevention (2013) Vital signs: carbapenem-resistant Enterobacteriaceae. MMWR Morb Mortal Wkly Rep 62:165–170
Centers for Disease Control and Prevention, C (2019) Carbapenem-resistant Enterobacterales (CRE)
Ciandrini E, Campana R, Baffone W (2017) Live and heat-killed Lactobacillus spp. interfere with Streptococcus mutans and Streptococcus oralis during biofilm development on titanium surface. Arch Oral Biol 78:48–57
Code U (2013) Title. Chapter III• Articles L413-1 et seq., R413-1 et seq.• Articles L362-2, L362-3, R362-1 and A362-2• Article L310-12
Colombo M, Oliveira AEZd, Carvalho AFd, Nero LA (2014) Development of an alternative culture medium for the selective enumeration of Lactobacillus casei in fermented milk. Food Microbiol 39:89–95
Control CfD (2019) and Prevention. Antibiotic resistance threats in the United States, 2019. US Department of Health and Human Services, Centres for Disease Control and &#8230
Coudeyras S, Jugie G, Vermerie M, Forestier C (2008) Adhesion of Human ProbioticLactobacillus rhamnosus to Cervical and Vaginal Cells and Interaction with Vaginosis-Associated Pathogens. Infect Dis Obstet Gynecol 2008:549640
Czuprynski C, Faith N (2002) Sodium bicarbonate enhances the severity of infection in neutropenic mice orally inoculated with Listeria monocytogenes EGD. Clin Vaccine Immunol 9:477–481
da Cruz AG, de Faria AF, J., and, Van Dender AG (2007) Packaging system and probiotic dairy foods. Food Res Int 40:951–956
Davies DS, Grant J, Catchpole M (2013) The drugs don't work: a global threat. Penguin UK
Degnan FH (2008) The US Food and Drug Administration and probiotics: regulatory categorization. Clin Infect Dis 46:S133–S136
Diep DB, Axelsson L, Grefsli C, Nes IF (2000) The synthesis of the bacteriocin sakacin A is a temperature-sensitive process regulated by a pheromone peptide through a three-component regulatory system. Microbiology 146:2155–2160
do Morais V, do Nascimento Alencar AR, Júnior É, De Oliveira FHX, Marcelino CM, Barratt HR, Fessi G, Egito HDo, E.S.T., and, Elaissari A (2016) Freeze-drying of emulsified systems: A review. Int J Pharm 503:102–114
Fenster K, Freeburg B, Hollard C, Wong C, Rønhave Laursen R, Ouwehand AC (2019) The production and delivery of probiotics: A review of a practical approach. Microorganisms 7:83
Fonseca F, Cenard S, Passot S (2015) Freeze-drying of lactic acid bacteria. Cryopreservation and freeze-drying protocols. Springer, pp 477–488
Food, Food AO (2002) Guidelines for the evaluation of probiotics in food. FAO Rome. J.G.f.t.e.o.p.i.f.R.o.a.J.F.W.W.G.o.D.G.f.t.E.o.P.i
Food F (1938) Drug, and Cosmetic Act. Cal West Med 49:172–174
Ghoneum M, Abdulmalek S (2021) KDP, a lactobacilli product from kimchi, enhances mucosal immunity by increasing secretory IgA in mice and exhibits antimicrobial activity. Nutrients 13:3936
Ghorbanian F, Seo H, Tajdozian H, Lee Y, Rahim MA, Kim S, Jung I-Y, Lee S, Song H-Y Efficacy of Isolated from Korean Gochang Bokbunja Vinegar against Carbapenem-Resistant Infections.Polish Journal of Microbiology
Hacini-Rachinel F, Gheit H, Le Luduec J-B, Dif F, Nancey S, Kaiserlian DJPO (2009) Oral probiotic control skin inflammation by acting on both effector and regulatory T cells. 4, e4903
Han R, Shi Q, Wu S, Yin D, Peng M, Dong D, Zheng Y, Guo Y, Zhang R, Hu F, China Antimicrobial Surveillance Network Study, G (2020) Dissemination of Carbapenemases (KPC, NDM, OXA-48, IMP, and VIM) Among Carbapenem-Resistant Enterobacteriaceae Isolated From Adult and Children Patients in China. Front Cell Infect Microbiol 10:314
Harikumar G, Krishanan K (2022) The growing menace of drug resistant pathogens and recent strategies to overcome drug resistance: A review.Journal of King Saud University-Science, 101979
Homayouni-Rad A, Soroush A-R, Khalili L, Norouzi-Panahi L, Kasaie Z, Ejtahed H-S (2017) Diabetes management by probiotics: current knowledge and future pespective. 1:1–13J.I.J.V.N.R
Hong Y-F, Kim H, Kim HR, Gim MG, Chung DK (2014) Different immune regulatory potential of Lactobacillus plantarum and Lactobacillus sakei isolated from kimchi. J Microbiol Biotechnol 24:1629–1635
Hu X-Y, Logue M, Robinson N (2020) Antimicrobial resistance is a global problem – a UK perspective. Eur J Integr Med 36:101136
Ishibashi N, Yamazaki S (2001) Probiotics and safety. Am J Clin Nutr 73:465s–470s
Ishikawa H, Kutsukake E, Fukui T, Sato I, Shirai T, Kurihara T, Okada N, Danbara H, Toba M, Kohda N (2010) Oral administration of heat-killed Lactobacillus plantarum strain b240 protected mice against Salmonella enterica Serovar Typhimurium. Biosci Biotechnol Biochem 74:1338–1342
Janda JM, Abbott SL (2021) The changing face of the family Enterobacteriaceae (order:“Enterobacterales”): new members, taxonomic issues, geographic expansion, and new diseases and disease syndromes. Clin Microbiol Rev 34:e00174–e00120
Jang S-E, Min S-W (2020) Lactobacillus sakei S1 Improves Colitis Induced by 2, 4, 6-Trinitrobenzene Sulfonic Acid by the Inhibition of NF-κB Signaling in Mice
Ji Y, Park S, Chung Y, Kim B, Park H, Huang E, Jeong D, Jung H-Y, Kim B, Hyun C-K (2019) Amelioration of obesity-related biomarkers by Lactobacillus sakei CJLS03 in a high-fat diet-induced obese murine model. Sci Rep 9:1–11
Justé A, Thomma B, Lievens B (2008) Recent advances in molecular techniques to study microbial communities in food-associated matrices and processes. Food Microbiol 25:745–761
Karska-Wysocki B, Bazo M, Smoragiewicz W (2010) Antibacterial activity of Lactobacillus acidophilus and Lactobacillus casei against methicillin-resistant Staphylococcus aureus (MRSA). Microbiol Res 165:674–686
Kechagia M, Basoulis D, Konstantopoulou S, Dimitriadi D, Gyftopoulou K, Skarmoutsou N, Fakiri EM (2013) Health benefits of probiotics: a review. International Scholarly Research Notices 2013
Kumar M, Dhaka P, Vijay D, Vergis J, Mohan V, Kumar A, Kurkure NV, Barbuddhe SB, Malik S, Rawool DB (2016) Antimicrobial effects of Lactobacillus plantarum and Lactobacillus acidophilus against multidrug-resistant enteroaggregative Escherichia coli. Int J Antimicrob Agents 48:265–270
Kwon M-S, Lim SK, Jang J-Y, Lee J, Park HK, Kim N, Yun M, Shin M-Y, Jo HE, Oh YJ (2018) Lactobacillus sakei WIKIM30 ameliorates atopic dermatitis-like skin lesions by inducing regulatory T cells and altering gut microbiota structure in mice. Front Immunol 9:1905
Lawrence R, Jeyakumar E (2013) Antimicrobial resistance: a cause for global concern. BMC proceedings. BioMed Central, Vol. 7, pp. 1–14
Lee Y, Seo H, Kim S, Rahim M, Yoon Y, Jung J, Lee S, Ryu B, C., and, Song H-Y (2021) Activity of Lactobacillus crispatus isolated from vaginal microbiota against Mycobacterium tuberculosis. J Microbiol 59:1019–1030
Levin M (2001) Pharmaceutical process scale-up. CRC Press
Lim S-M, Jeong J-J, Woo KH, Han MJ, Kim D-H (2016) Lactobacillus sakei OK67 ameliorates high-fat diet–induced blood glucose intolerance and obesity in mice by inhibiting gut microbiota lipopolysaccharide production and inducing colon tight junction protein expression. Nutr Res 36:337–348
Liu Y, Wang J, Wu C (2021) Microbiota and tuberculosis: a potential role of probiotics, and postbiotics. Front Nutr 8:626254
Mandal SM, Pati BR, Chakraborty R, Franco OL (2016) New insights into the bioactivity of peptides from probiotics. Front Biosci (Elite Ed) 8:450–459
Manley KJ, Fraenkel MB, Mayall BC, Power DA (2007) Probiotic treatment of vancomycin-resistant enterococci: a randomised controlled trial. Med J Aust 186:454–457
Manuel PM, Elena B, Carolina MG, Gabriela PJJoN, Metabolism I (2017) Oral probiotics supplementation can stimulate the immune system in a stress process. 8:29–40
McFarland LV (2015) Probiotics for the primary and secondary prevention of C. difficile infections: a meta-analysis and systematic review. Antibiotics 4:160–178
Mirnejad R, Vahdati AR, Rashidiani J, Erfani M, Piranfar V (2013) The antimicrobial effect of lactobacillus casei culture supernatant against multiple drug resistant clinical isolates of Shigella sonnei and Shigella flexneri in vitro. Iran Red Crescent Med J 15:122
Miyoshi Y, Saika A, Nagatake T, Matsunaga A, Kunisawa J, Katakura Y, Yamasaki-Yashiki S (2021) Mechanisms underlying enhanced IgA production in Peyer's patch cells by membrane vesicles derived from Lactobacillus sakei. Biosci Biotechnol Biochem 85:1536–1545
Moghadam SS, Khodaii Z, Zadeh SF, Ghooshchian M, Aghmiyuni ZF, Shabestari TM (2018) Synergistic or antagonistic effects of probiotics and antibiotics-alone or in combination-on antimicrobial-resistant pseudomonas aeruginosa isolated from burn wounds.Archives of Clinical Infectious Diseases13
Munoz-Price LS, Poirel L, Bonomo RA, Schwaber MJ, Daikos GL, Cormican M, Cornaglia G, Garau J, Gniadkowski M, Hayden MK (2013) Clinical epidemiology of the global expansion of Klebsiella pneumoniae carbapenemases. Lancet Infect Dis 13:785–796
Murray CJ, Ikuta KS, Sharara F, Swetschinski L, Aguilar GR, Gray A, Han C, Bisignano C, Rao P, Wool EJTL (2022) Global burden of bacterial antimicrobial resistance in 2019: a systematic analysis. 399:629–655
Nagasaki A, Takahashi H, Iinuma M, Uchiyama T, Watanabe S, Koide T, Tokoro C, Inamori M, Abe Y, Nakajima A (2010) Ulcerative colitis with multidrug-resistant Pseudomonas aeruginosa infection successfully treated with bifidobacterium. Digestion 81:204–205
NAKSING T, HATAWEE P, WANLAPA A, TORPOL K, CHIU, C.-H., TEEKA, J., and, AREESIRISUK A (2019) THERMAL DEATH EVALUATION OF MULTI-STRAINS PROBIOTIC INOCULANT FOR SHELF-LIFE PREDICTION. Malaysian Appl Biology 48:147–152
Oktavia DA, Ayudiarti DL, Febrianti D (2020) Physical properties of the probiotic effervescent tablet from tapioca and maltodextrin coatings. E3S Web of Conferences. EDP Sciences, Vol. 147, p. 03024
Olaimat AN, Aolymat I, Al-Holy M, Ayyash M, Abu Ghoush M, Al-Nabulsi AA, Osaili T, Apostolopoulos V, Liu S-Q, Shah NP (2020) The potential application of probiotics and prebiotics for the prevention and treatment of COVID-19. npj Sci Food 4:1–7
Owaga E, Hsieh R-H, Mugendi B, Masuku S, Shih C-K, Chang J-S (2015) Th17 cells as potential probiotic therapeutic targets in inflammatory bowel diseases. Int J Mol Sci 16:20841–20858
Ozyurt VH, Ötles S (2014) Properties of probiotics and encapsulated probiotics in food. Acta Scientiarum Polonorum Technologia Alimentaria 13:413–424
Pan Y-J, Lin T-L, Lin Y-T, Su P-A, Chen C-T, Hsieh P-F, Hsu C-R, Chen C-C, Hsieh Y-C, Wang J-T (2015) Identification of capsular types in carbapenem-resistant Klebsiella pneumoniae strains by wzc sequencing and implications for capsule depolymerase treatment. Antimicrob Agents Chemother 59:1038–1047
Penchovsky R, Traykovska M (2015) Designing drugs that overcome antibacterial resistance: where do we stand and what should we do? Expert Opin Drug Discov 10:631–650
Quintana G, Gerbino E, Gómez-Zavaglia A (2017) Okara: A nutritionally valuable by-product able to stabilize Lactobacillus plantarum during freeze-drying, spray-drying, and storage. Front Microbiol 8:641
Rahim MA, Seo H, Kim S, Tajdozian H, Barman I, Lee Y, Lee S, Song H-Y (2022a) In vitro anti-tuberculosis effect of probiotic Lacticaseibacillus rhamnosus PMC203 isolated from vaginal microbiota. Sci Rep 12:8290
Rahim MA, Seo H, Kim S, Tajdozian H, Barman I, Lee Y, Lee S, Song HY (2022b) In vitro anti-tuberculosis effect of probiotic Lacticaseibacillus rhamnosus PMC203 isolated from vaginal microbiota. Scientific Reports 12
Reikvam DH, Meyer-Myklestad MH, Trøseid M, Stiksrud B (2020) Probiotics to manage inflammation in HIV infection. Curr Opin Infect Dis 33:34–43
Riesute R, Salomskiene J, Moreno DS, Gustiene S (2021) Effect of yeasts on food quality and safety and possibilities of their inhibition. Trends Food Sci Technol 108:1–10
Ritchie LE, Burke KF, Garcia-Mazcorro JF, Steiner JM, Suchodolski JS (2010) Characterization of fecal microbiota in cats using universal 16S rRNA gene and group-specific primers for Lactobacillus and Bifidobacterium spp. Vet Microbiol 144:140–146
Sawatari Y, Hirano T, Yokota A (2006) Development of food grade media for the preparation of Lactobacillus plantarum starter culture. J Gen Appl Microbiol 52:349–356
Seo H, Yoon SY, Ul-Haq A, Jo S, Kim S, Rahim MA, Park H-A, Ghorbanian F, Kim MJ, Lee M-Y (2023) The Effects of Iron Deficiency on the Gut Microbiota in Women of Childbearing Age. Nutrients 15:691
Sidjabat HE, Cottrell K, Bordin A, Cervin AReviving conventional microbiology approaches for probiotic discovery and development
Suvarna V, Boby V (2005) Probiotics in human health: A current assessment. Curr Sci 88:1744–1748
Tajdozian H, Seo H, Kim S, Rahim MA, Lee S, Song H-Y (2021a) Efficacy of Lactobacillus fermentum Isolated from the Vagina of a Healthy Woman against Carbapenem-Resistant Klebsiella Infections In Vivo. J Microbiol Biotechnol 31:1383–1392
Tajdozian H, Seo H, Kim S, Rahim MA, Lee S, Song H-Y, Tajdozian H (2021b) Efficacy of Lactobacillus fermentum Isolated from the Vagina of a Healthy Woman. against Carbapenem-Resistant Klebsiella Infections In Vivo
Todorov SD, Oliveira R, Vaz-Velho M (2012) Media optimization of bacteriocin ST22CH production by Lactobacillus sakei ST22CH isolated from salpicao, a traditional meat-product from Portugal. Chem Eng Trans 27:283–288
Ukeyima MT, Enujiugha VN, Sanni TA (2010) Current applications of probiotic foods in Africa.African Journal of Biotechnology9
Vaez H, Ghalehnoo ZR, Yazdanpour Z (2019) Low prevalence of carbapenem-resistant Klebsiella pneumoniae in Zabol, Southeast of Iran. Int J Basic Sci Med 4:34–37
Vaudant J (2008) Evaluation of drying technologies for storage and shipment of recombinant protein drug substance. Massachusetts Institute of Technology
Vaughan A, Eijsink V, O'Sullivan T, O'hanlon K, Van Sinderen D (2001) An analysis of bacteriocins produced by lactic acid bacteria isolated from malted barley. J Appl Microbiol 91:131–138
Ventola CL (2015) The antibiotic resistance crisis: part 1: causes and threats. Pharm Ther 40:277
Xiao T, Zhu Y, Zhang S, Wang Y, Shen P, Zhou Y, Yu X, Xiao Y (2020) A Retrospective Analysis of Risk Factors and Outcomes of Carbapenem-Resistant Klebsiella pneumoniae Bacteremia in Nontransplant Patients. J Infect Dis 221:S174–S183
Xu L, Sun X, Ma X (2017) Systematic review and meta-analysis of mortality of patients infected with carbapenem-resistant Klebsiella pneumoniae. Ann Clin Microbiol Antimicrob 16:1–12
Yan R, Lu Y, Wu X, Yu P, Lan P, Wu X, Jiang Y, Li Q, Pi X, Liu W, Zhou J, Yu Y (2021) Anticolonization of Carbapenem-Resistant Klebsiella pneumoniae by Lactobacillus plantarum LP1812 Through Accumulated Acetic Acid in Mice Intestinal. Frontiers in Cellular and Infection Microbiology 11

SupplementaryInformation.docx

Download PDF

Version 1

posted

You are reading this latest preprint version

Efficacy of lyophilized Lactobacillus sakei as a potential candidate for the prevention of carbapenem-resistant Klebsiella infection

Status:

Version 1

Abstract

Figures

Introduction

Materials and Methods

CRK clinical strain

Isolation of PMC 104

16S rRNA identification

PCR identification of the candidate probiotic strain

Biochemical tests

Preparation of food grade media (FGM) and edible FGM (EFGM)

Inoculum preparation for a scale-up process

Fermentation, freeze-drying, and packaging

The study of acute toxicity of candidate probiotics

Whole Genome Sequencing

Cytotoxicity test

Results

16S rRNA-based identification of isolated strain

PCR identification of isolated probiotic

Wholegenome analysis results of the selected strain

OrthoANI genomic similarity

Biochemical characterization of PMC 104

Pilot fermentation, powder production, and packaging

Discussion

Declarations

References

Supplementary Files

Status:

Version 1