Fetal origins of obesity: a novel pathway of regulating appetite neurons in the hypothalamus of growth restricted rat offspring

doi:10.21203/rs.3.rs-2840224/v1

Download PDF

Research Article

Fetal origins of obesity: a novel pathway of regulating appetite neurons in the hypothalamus of growth restricted rat offspring

https://doi.org/10.21203/rs.3.rs-2840224/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 28 Jun, 2023

Read the published version in Archives of Gynecology and Obstetrics →

You are reading this latest preprint version

Purpose

Fetal growth restriction causes a series of sequelae, some of which, such as hyperphagia, reduced satiety and postnatal obesity, are believed in associated with embryonic hypothalamic neurons impairment. The mechanisms underlying the linkage of fetal brain injuries to break the energy homeostasis have not been elucidated completely. Here, we aim to investigate the effect of intrauterine energy-restriction on remodeling appetite neurons in the hypothalamus of fetal and postnatal infant rats.

Methods

Low-protein (8%) diet combined with 75% energy restriction was used to establish an animal model. Rats offspring brain tissues, harvested from embryo day 18th and postnatal infant day 1st, were sampled for dependent regulator analyses and master neuron assessment.

Results

Growth restricted rats showed the increased expression of Bsx and NPY in the hypothalamus as well as remodeling hypothalamic neurons differentiation compared to controls. Intriguingly, in cells cultured in vitro test, we found that activated effects of Bsx and NPY could be exacerbated by DNMT1 inhibitor.

Conclusions

In embryonic and early postnatal stage of FGR rats, we detected high concentrations of orexigenic neurons in the hypothalamus. DNMT1 activity is correlated with early embryonic neurogenesis by mediating the expression of Bsx and NPY. It may be one of the reasons for the abnormal development of the appetite regulation pathway and higher susceptibility to obesity in FGR offspring.

Fetal growth restriction

DNMT1

Bsx

NPY

hypothalamus

In embryonic and early postnatal stage of FGR rats, we detected high concentrations of orexigenic neurons in the hypothalamus.
DNMT1-mediated methylation levels in the Bsx promoter region were associated to dysfunctional differentiation of hypothalamic NPCs.
The findings suggested that the changes of early undernutrition on offspring DNA methylation preset and programmed obesity and metabolic syndrome.

Fetal growth restriction (FGR) refers to the fetus who does not achieve the expected in utero growth potential due to genetic or environmental factors. It is defined as an estimated fetal weight < 10th percentile for gestational age[1]. In most cases, FGR is caused by dysfunction of the fetal-placental perfusion, resulting in hypoxia and acidosis in the fetal circulation[2]. Except for higher rates of fetal and neonatal morbidity and mortality, the damage can even last until adulthood, leading to an increased risk of obesity and metabolic diseases, also known as developmental origins of health and disease (DoHaD)[3–6]. Thereby, such chronic diseases of adulthood have been considered as having early developmental origins in the perinatal period.

Compelling evidences show that the early stage programming in hypothalamus development, in interaction with other epigenetic marks, add powerful layers of susceptibility to metabolic diseases[7, 8]. Hypothalamus is an endocrine and metabolic center. During embryonic development, hypothalamic neural precursor cells (NPCs) can differentiate into two types of appetite-regulating neurons, Neuropeptides Y (NPY) and proopiomelanocortin (POMC). NPY stimulates food intake and reduces energy consumption, while POMC inhibits food intake and promotes energy consumption. The dynamic balance with antagonistic functions maintains energy homeostasis[9, 10]. Moreover, infants small for gestational age demonstrate programmed dysfunction of NPCs proliferation, which preferentially differentiate to NPY as compared to POMC neurons³. To study obesity intensively, it is crucial to understand cellular and molecular mechanisms of NPCs differentiation. In closely relationship with hyperphagia and locomotory behavior, Brain Specific Homeobox (Bsx) was reported as a required factor in the transcriptional network of NPY/AgRP expression[11]. However, the specific molecular linkage of Bsx and NPY in FGR offspring is unclear.

The poor intrauterine environment affects gene expression and neuron differentiation through epigenetic modification[12–15], mainly including DNA methylation, histone modification, chromosome remodeling, non-coding RNA regulation, etc. Recently, more and more attention has been paid to the regulation of gene expression by DNA methylation. DNA methylation is the covalent addition of methyl group catalysed by DNA Methyltransferase(DNMTs)[16], leading to gene silence or expression down-regulation. The members of DNMTs famliy contains DNMT1, DNMT3a / 3b, and DNMT3-l[17]. DNMT1 maintains the stable passage of methylation pattern during mitosis. It exists in the cytoplasm and nucleus in undifferentiated NPCs and only expresses in differentiated and migrated neurons in the cytoplasm. In small for gestational age offspring, impaired neurogenesis is mediated via reduction in DNMT1 expression partly resulting in NPCs differentiation[18], suggesting that DNMT1 may be an potential target factor in altered neurogenesis for appetite regulation of FGR offspring.

Overall, we hypothesized that DNMT1, Bsx and NPY might involved in triggering dysfunctional differentiation of hypothalamic NPCs in FGR rat offspring, which directly led to the increased susceptibility to obesity in adulthood. Using both animal modeling and in vitro hypothalamic NPCs culturing, our study explored the possibility of a mechanistic link between DNMT1, Bsx and NPY pathways. This research will help provide a theoretical basis and clinical guidance for the early interventions of FGR, reducing the risk of adverse effects and improving the quality of life in the long term.

Animal modeling and grouping

Low protein content (8%) feeding combined with 75% maternal food restriction was used to establish an FGR rat model[19]. There were 24 first-time pregnant Sprague-Dawley (SD) rats (N = 24) (Beijing Vital River Laboratory Animal Technology Co., Ltd., Beijing, China) weighing approximately 230g and aging 90–120 days. They were housed in a specific pathogen-free (SPF) animal facility with a sterile barrier system, constant temperature (20°C), relative humidity of 60%-70%, and a 12-hour light/dark cycle. Water was not restricted during the whole gestation. On the first day of gestation (the first day of suppository was recorded as the first day of gestation), they were randomly divided into two groups. The FGR group (N = 12) rats were fed 8% protein feeding combined with 75% maternal food restriction. The control group rats (N = 12) were provided with breeding feed with no energy restriction. The pregnant rats in the control and FGR groups were randomly divided into two cohorts, the embryonic day 18th (E18) cohort, which was cesarean delivered at E18 (N = 6 pregnant rats), and the postnatal day 1st (P1) cohort, which was natural delivered (N = 6 pregnant rats). All of the offspring were weighed and recorded immediately delivered, whether cesarean or natural delivery. Two standard deviations lower than the average weight of control group offspring were considered successfully modeling. As fetal gender may confuse the results, only female rat offspring were used in this study. Females were distinguished from males by the presence of a uterus duplex.

Hypothalamic NPCs cultural in vitro

The hypothalamus of female rat offspring was used in this study. Fetuses were taken out and placed at pre-chilled PBS. After being weighed and recorded, twelve female rat offspring were collected from the FGR group and the control group (n = 6 in each group) for hypothalamic NPCs in vitro culture. The hypothalamus was bluntly dissected under aseptic conditions. Then, meninges and blood vessels were removed. They were cut into small pieces and digested with 0.1% trypsin-EDTA and 0.01% DNase for 30 min in a 37 ℃ carbon dioxide incubator. Trypsin was inactivated by fetal bovine serum (FBS). Then, the samples were filtered and centrifuged at 1500 rpm for 5 min. After discarding the supernatant, the samples were resuspended in serum-free complete medium (5x10⁴ cells /ml) (the complete medium consists of neurobasal™ medium, 1% penicillin-streptomycin mixture, 2% B-27 additive, 20ng / mlFGF2, 20ng / ml EGF, 1 µ g / ml heparin and 2.5 µ g/ ml L-glutamine). Then, the cells were cultured in a 37 ℃ carbon dioxide incubator for eight days. The medium and FGF2 (10ng/ ml) were exchanged every three days. On the 8th day, the Neurosphere cells were recorded as S0. S0 cells were collected and digested with 0.1% trypsin EDTA at 37 ℃ for 5 min to dissociate them into single cells. Then, the samples were filtered and centrifuged at 1000 rpm for 5 min. After discarding the supernatant, they were re-inoculated into a complete culture medium (5x10⁴ cells /ml) and cultured for eight days according to the above culture conditions. The cells were recalled as S1. S1 cells were collected for induction and differentiation culture. They were dissociated into single cells, filtered, and centrifuged according to the above method. Then, They were re-inoculated into a differentiation medium (neurobasal™ medium, 1% penicillin-streptomycin mixture, 2% B-27 additive, 2.5 µ G / MLL glutamine, without FGF2, EGF and heparin). The S1 cells in each group were randomly divided into two subgroups. One added DNMT1 specific inhibitor, 5-AZA (GIPBIO, 20µM), into the culture medium; the other did not add inhibitors. Both were cultured in a 37 ℃ carbon dioxide incubator for eight days. Then, the cells were collected for subsequent experimental detection.

Maternal rats in the P1 cohort were fed until natural delivery. Six brains of female rat offspring were collected (n = 6 in each group) for hypothalamic NPCs in vitro culture. The process was the same as mentioned above.

Immunofluorescence

Paraffin sections were used for IF. After dewaxing, antigen repairing, and detection area delineating, samples were permeated with 0.3% Triton X-100. Then, they were sealed and incubated in a wet box at room temperature for two hours. Next, NPY antibody (dilution ratio 1:500) was added. Fluorescent labeled Goat anti Rabbit antibody was used as a secondary antibody (dilution ratio 1:200). DAPI (dilution ratio 1:50) was used for nuclei counterstain. The sealing slices shall be dried in a 60 ℃ oven and sealed with anti-fluorescence quenching sealing agent. The images were collected by inverted fluorescence microscope (Nikon Ci-S, Nikon DS-U3) in a 100x field of vision.

RT-PCR

RNA was extracted from hypothalamic tissue and neurosphere cells in this section. cDNA was obtained through reverse transcription reaction. Dilute it ten times for amplification by real-time quantitative PCR (RT-qPCR). The 2^{− ΔΔ CT} method (livak method) was used for quantitative analysis. Primer and internal reference sequence were as follows:

GAPDH : F: 5’- GGCAAGTTCAACGGCACAG-3’

R: 5’- CGCCAGTAGACTCCACGACA-3’

DNMT1: F: 5’- CACTGTTCCTCCTTCTGCCATCAAT-3’

R: 5’- TCATCGTCCTTAGCGTCGTCGTA-3’

NPY: F: 5’- GCTCTGCGACACTACATCAATCTCAT-3’

R: 5’- GCAAGTTTCATTTCCCATCACCACAT-3’

Bsx: F: 5’- CGGTGCCTTCGTGCTTACAGAG-3’

R: 5’- GCCGCAGGAACAGTCTAGAGTCT-3’

Western Blot

Total protein was extracted from hypothalamic tissues. The target protein was separated and purified by SDS- polyacrylamide gel electrophoresis. 10µl of protein samples were added to each hole. Constant voltage power was supplied for electrophoresis (concentrated gel 80V, separation gel 120V). Electrophoretic separation would stop when the target protein was located at the best resolution position 1/3 below the surface of the separation gel. Then, samples were transferred to a PVDF membrane by constant current(200mA) for 90min at 4 ℃ (0.45µm thickness of PVDF). Next, they were sealed for 2h at room temperature with the sealing liquid containing 5% skimmed milk powder (prepared with 0.5% TBST). Then the primary antibody was added after dilution (DNMT1 1:1000, Bsx 1:2000, NPY 1:1000). HRP labeled Goat-anti-Rabbit antibody was used as a second antibody (1:5000 dilution). ECL kit was used for color exposure, and then gel images were collected by an automatic chemiluminescence image analysis system.

Methylation Specific PCR

Hypothalamic tissues and neurosphere cells were used as samples. DNA extraction shall be carried out according to the operating instructions of the DNA extraction kit. Then the DNA samples were transformed into bisulfite by PCR-cycler and were purified. Then DNA samples were amplified by methylation-specific PCR. The samples were concentrated through DNA agarose gel electrophoresis with 140V direct current for 30min. The loading quantity of the sample on each pore was 5µl. Primer sequences were as follows (M-Bsx: Bsx methylated primer pair; U-Bsx: Bsx unmethylated primer pair):

M-Bsx: F: TTCGTAGTTTTTTTATTGGTTTTTC

R: AAACCTACACCTACTCCTAATCGTC

U-Bsx: F: TGTAGTTTTTTTATTGGTTTTTTGG

R: AAACCTACACCTACTCCTAATCATC

Data Analysis

Mean and standard deviation (SD) were used to describe the average weight of rats. Differences between the FGR and control group were analyzed by ANOVA with Dunnett’s posthoc test. The relative expression levels of mRNA were normalized to GAPDH. The data was statistically analyzed by spss23.0 software. P < 0.05 was considered statistically significant.

1. The average birth weight in the FGR group was significantly lower than in the control group.

Currently, there are many methods to establish the FGR rat model, such as 50% energy restriction, uterine artery ligation, pharmacological method, chronic nitric oxide synthase inhibition-induced method, and so on[20–22]. The 50% diet restriction method is widely used, but maternal rats are prone to mania in the state of hunger. The incidence of abortion, stillbirth, and postpartum feeding would increase. Yue Jing et al. adopted an 8% low protein diet combined with 75% diet restriction modeling and achieved an excellent modeling success rate. In this experiment, we successfully established the FGR rat model by75% energy restriction combined with 8% low protein fed. The average success rate of modeling was 83.5%.

The birth weight of rat offspring we used in the subsequent analyses in the FGR group was significantly lower than that in the control group (P < 0.05) (Table 1). The birth weight in the FGR group met the diagnosis criteria of FGR as it was lower than the average birth weight of the control group by 2 SD.

Table 1

Comparison of birth weight between FGR and control group (x̄± s, g)
‾
	FGR	Control	P
	n = 12	n = 12
E18	1.28 ± 0.05	1.72 ± 0.07	<0.001
P1	5.22 ± 0.21	7.48 ± 0.22	<0.001
E18: Embryonic day 18th ; P1: Postnatal day 1st. FGR: fetal growth restriction.

2. The expression of NPY in the hypothalamus of FGR offspring increased.

In rats, the peak of neurogenesis is on gestational day 10.5th to 16.5th. NPY can be detected for the first time on day E14.5. Embryo day 18th and postnatal day 1st rat offspring were chosen as study subjects to confirm the expression difference of NPY and consistency of the difference in or out-utero.

We used IF to detect NPY expression qualitatively and positionally. As is shown in Fig. 1, green fluorescence is the expression part of NPY; Blue fluorescence is the nuclear expression part. NPY was mainly distributed around the third ventricle. Compared with the control group, the fluorescence intensity of NPY in the FGR group was brighter.

3. The protein and mRNA expression of DNMT1 decreased in the FGR group, while that of Bsx and NPY increased.

Hypothalamus tissues were used to detect the expression of DNMT1, Bsx, and NPY by RT-qPCR and WB. Results are shown in Fig. 2 and Fig. 3. Compared with the control group, the DNMT1 protein expression in the FGR group decreased. both in the E18 and P1 cohort (Fig. 2a). On the contrary, the Bsx and NPY protein expression increased (Fig. 2b, Fig. 2c). Besides, the result also displayed a decreased trend of DNMT1 protein expression from E18 to P1, while Bsx and NPY exhibited the opposite trend.

The DNMT1 mRNA expression in the FGR group, either the E18 cohort or the P1 cohort, was significantly lower than that in the control group (P < 0.05). The difference was much apparent in the E18 cohort(Fig. 3A). The Bsx and NPY mRNA expression in the FGR group, both the E18 cohort and P1 cohort, were significantly higher than that in the control group (Fig. 3B and Fig. 3C) (P < 0.05). Besides, the result also suggested a decreased trend of DNMT1 mRNA expression from E18 to P1, while NPY exhibited the opposite trend.

4. The methylation level of the Bsx promoter in the hypothalamus decreased in the FGR group.

To clarify whether there is a methylation change on Bsx, we detected the methylation level of Bsx by MSP. The result is shown in Fig. 4. The methylation level of Bsx promoter region in FGR group was lower than that in the control group, while the un-methylation level was higher (Fig. 4).

5. The expression of Bsx and NPY increased in NPCs cultured in vitro with DNMT1 specific inhibitor.

To clarify whether DNMT1 can regulate the expression of Bsx and NPY, we cultured NPCs in a differentiation medium with or without DNMT1 specific inhibitor. 5-AZA, a kind of DNMT1-specific enzyme activity inhibitor, was used in this experiment.

As shown in Fig. 5A, the DNMT1 mRNA expression in the FGR group was lower than in the control group (P < 0.05). In the groups that NPCs were cultured in vitro with 5-AZA, the expression of DNMT1 was inhibited (P < 0.05). There was no significant difference between groups cultured with 5-AZA.

In Fig. 5B, compared with the control group, the mRNA expression of Bsx in the FGR group increased with statistical significance (P < 0.05). The Bsx expression in groups cultured with 5-AZA was much higher than that cultured without 5-AZA (P < 0.05). NPY displayed the same expression mode as Bsx (Fig. 5C).

6. The methylation level in the Bsx promotor region decreased in NPCs cultured in vitro with DNMT1 specific inhibitor.

We also tested Bsx methylation levels among groups. The result is shown in Fig. 6. Compared with the control group, the methylation level in the Bsx promoter region in the FGR group decreased. Meanwhile, the methylation level decreased in NPCs cultured in vitro with 5-AZA compared with those cultured without the inhibitor. The inhibit phenomenon was much more evident in the P1 cohort than in the E18 cohort (Fig. 6).

Epigenetic mechanisms are emerging as mediators linking intrauterine environmental exposures with programmed alterations in gene expression that impact offspring growth and development[23]. In this work, we firstly identified that DNMT1 mediates the expression of Bsx and NPY by influencing methylation levels in the Bsx promoter region in early embryonic neurogenesis, suggesting that the changes of early undernutrition on offspring DNA methylation preset and programmed obesity and metabolic syndrome.

So far, it is well established that FGR and small birth weight lead to the initial increase in type 2 diabetes mellitus (T2DM), obesity, hypertension, dyslipidemia, insulin resistance and series of sequelae[24]. The association of FGR and long-term obesity remains an intersectional difficulty in both perinatal and endocrine medicine. It must be emphasized that poor growth in utero can modify neuroendocrine and metabolic systems. In particular, alterations in fetal adipose tissue development, hormone statuses as well as epigenome lead to later life obesity following intrauterine growth restriction[25–29]. Here, we highlight the potential linkages underlying relationship between FGR and altered chromatin structure.

Actually, hypothalamic appetite regulatory systems develop and mature in utero and early infancy[30]. There were abundant data indicating that intrauterine growth restriction exposure was associated with increased NPY levels[31–34]. Based on these, in this study, we detected high concentrations of NPY in the hypothalamus of FGR group. The result suggested abnormal differentiation exists in hypothalamic NPCs. Hypothalamus NPCs tend to differentiate into appetite-promoting neurons, resulting in hyperactivity of appetite-promoting activity and obesity.

Besides, since Bsx represents an essential factor for NPY/AgRP neuronal function[11], we conclude that Bsx may also be required for FGR-induced energy imbalance. Previous evidence indicated that, in Bsx mutant mice, NPY/AgRP expression as well as hypothalamic control of locomotory behavior depended on Bsx function[11]. In addition, Bsx has been shown to directly bind the promoter regions of Agrp and Npy[35]. In the present study, Bsx and NPY co-expressed much higher in the FGR hypothalamus than in the control group.

To further explore the mechanisms of FGR in altering orexigenic neuropeptides, we took DNA methylation (DNA methyltransferase; DNMT1) into consideration. Desai et al. confirmed that DNMT1 participants in the maintenance and steady-state regulation of hypothalamic NPCs proliferation to ensure the reserve of NPCs pool and the occurrence of a correct number of neurons[18]. Thus, we measured that the methylation level in Bsx promoter region in FGR group was lower than that in the control group, suggesting that the increased expression of Bsx may be related to the decreased methylation level in the Bsx promoter region. Combined with low expression of DNMT1, we suggested that DNMT1 might regulate Bsx expression through methylating specific gene sites of Bsx.

In order to further identify DNMT1 roles in Bsx and NPY abnormally high expression, we conducted an intervention test by using hypothalamic NPCs cultures in vitro. 5-AZA, a specific inhibitor of DNMT1 catalytic enzyme activity, was introduced to evaluate the mechanistic link between DNMT1 and Bsx. Notably, blockage of DNA methylation prevented the DNMT1 down-regulating action on Bsx and NPY mRNA expression. In other words, the expression of Bsx and NPY increased even further in the group cultured with 5-AZA. In addition, this effect was observed in both P1 and E18 cohort, suggesting that DNMT1 might play a continuous role in regulating Bsx and NPY expression either in-uterus or early postnatal stage. Of note, the differentiation of Bsx high expression between FGR- and control-groups with 5-AZA treated indicated a significant but non-unique role of DNMT1 in neural programming. Interestingly, by using DNMT1 specific inhibitor, the concentration of NPY in the P1 cohort did not elevate as much as that in E18 cohort. The altered expression might be the consequence of the maturation in central nervous system occurring throughout from the intrauterine period to early years of life[36–38]. On the other hand, we observed that the expression of NYP did not exhibit a coordinate increase as Bsx did, whereas the change ranges were consistent with the methylation status of Bsx promotor region in MSP test. However, as to why the methylation status of Bsx promotor region differs from prenatal to postnatal, the theories therein are not known. Given the fact that the offspring rats were not exposed to the same physiological conditions, and DNA methylation could be affected by metabolic phenotypes[39], it is tempting to speculate that gene expression variability due to DNA methylation may also be adjusted and steadied in preparation for postnatal life. Therefore, as nervous system continues to develop after birth in rodents[40], it is of importance for future researches to substantiate the long-term effects. Besides, further investigation is warranted to illustrate whether the experimental results are suitable for humans.

In conclusion, here our date support the hypothesis that the onset of Bsx and NPY activity occurs at the early embryonic development stage. Moreover, DNMT1 may regulate Bsx expression through methylation, which further affects the normal development of the hypothalamic appetite regulation pathway. These findings provide insight into the mechanism that the change of methylation level in the Bsx promoter region mediated by DNMT1 may be one of the reasons for the abnormal development of NPY in FGR offspring. Obviously, maternal undernutrition can alter epigenetic marks and cause widespread consequences.

Acknowledgements

None.

Funding

This study was supported by the National Natural Science Foundation of China (#81471521).

Competing Interests/Conflict of interest statement

The authors declare no potential conflicts of interest for the research, authorship, and publication of this article.

Author contributions

Qingyun Shi, as the director and fund gainer, contributed to the conception of the study. Weiling Han performed the data collection and drafted the article. Zhaoyi Song contributed to the analysis and manuscript. Dan Shan made contributions to the animal experiment. All authors approved the final version to be published.

Ethics approval

The study was approved by the Animal Ethics Committee of Capital Medical University (AEEI-2019-111). The experiment was conducted in Capital Medical University's animal laboratory and followed the guidelines for laboratory animal care and use.

Author contributions

Fetal Growth Restriction: ACOG Practice Bulletin, Number 227. Obstet Gynecol. 2021 Feb 1;137(2):e16-e28.
Salam RA, Das JK, Bhutta ZA. Impact of intrauterine growth restriction on long-term health. Curr Opin Clin Nutr Metab Care. 2014 May;17(3):249-54.
Ross MG, Desai M. Developmental programming of appetite/satiety. Ann Nutr Metab. 2014;64 Suppl 1:36-44.
Pels A, Beune IM, van Wassenaer-Leemhuis AG, Limpens J, Ganzevoort W. Early-onset fetal growth restriction: A systematic review on mortality and morbidity. Acta Obstet Gynecol Scand. 2020 Feb;99(2):153-166.
Levine TA, Grunau RE, McAuliffe FM, Pinnamaneni R, Foran A, Alderdice FA. Early childhood neurodevelopment after intrauterine growth restriction: a systematic review. Pediatrics. 2015 Jan;135(1):126-41.
Crispi F, Miranda J, Gratacós E. Long-term cardiovascular consequences of fetal growth restriction: biology, clinical implications, and opportunities for prevention of adult disease. Am J Obstet Gynecol. 2018 Feb;218(2S):S869-S879.
Candler T, Kühnen P, Prentice AM, Silver M. Epigenetic regulation of POMC; implications for nutritional programming, obesity and metabolic disease. Front Neuroendocrinol. 2019 Jul;54:100773.
Gali Ramamoorthy T, Allen TJ, Davies A, Harno E, Sefton C, Murgatroyd C, White A. Maternal overnutrition programs epigenetic changes in the regulatory regions of hypothalamic Pomc in the offspring of rats. Int J Obes (Lond). 2018 Aug;42(8):1431-1444.
Vohra MS, Benchoula K, Serpell CJ, Hwa WE. AgRP/NPY and POMC neurons in the arcuate nucleus and their potential role in treatment of obesity. Eur J Pharmacol. 2022 Jan 15;915:174611.
Krashes MJ, Lowell BB, Garfield AS. Melanocortin-4 receptor-regulated energy homeostasis. Nat Neurosci. 2016 Feb;19(2):206-19.
Sakkou M, Wiedmer P, Anlag K, Hamm A, Seuntjens E, Ettwiller L, Tschöp MH, Treier M. A role for brain-specific homeobox factor Bsx in the control of hyperphagia and locomotory behavior. Cell Metab. 2007 Jun;5(6):450-63.
Choudhry H, Harris AL. Advances in Hypoxia-Inducible Factor Biology. Cell Metab. 2018 Feb 6;27(2):281-298.
MuhChyi C, Juliandi B, Matsuda T, Nakashima K. Epigenetic regulation of neural stem cell fate during corticogenesis. Int J Dev Neurosci. 2013 Oct;31(6):424-33.
Hu XQ, Chen M, Dasgupta C, Xiao D, Huang X, Yang S, Zhang L. Chronic hypoxia upregulates DNA methyltransferase and represses large conductance Ca2+-activated K+ channel function in ovine uterine arteries. Biol Reprod. 2017 Feb 1;96(2):424-434.
Cheng Z, Zheng L, Almeida FA. Epigenetic reprogramming in metabolic disorders: nutritional factors and beyond. J Nutr Biochem. 2018 Apr;54:1-10.
Kumar R, Jain V, Kushwah N, Dheer A, Mishra KP, Prasad D, Singh SB. Role of DNA Methylation in Hypobaric Hypoxia-Induced Neurodegeneration and Spatial Memory Impairment. Ann Neurosci. 2018 Dec;25(4):191-200.
Ravichandran M, Jurkowska RZ, Jurkowski TP. Target specificity of mammalian DNA methylation and demethylation machinery. Org Biomol Chem. 2018 Feb 28;16(9):1419-1435.
Desai M, Han G, Li T, Ross MG. Programmed Epigenetic DNA Methylation-Mediated Reduced Neuroprogenitor Cell Proliferation and Differentiation in Small-for-Gestational-Age Offspring. Neuroscience. 2019 Aug 1;412:60-71.
Yue Jing, LI Juan, HU Yali. Model of fetal growth restriction induced by low protein diet in rats [J]. Chinese Perinatal Medicine Journal, 2014 (2) : 109-113.[in Chinese]
Eleftheriades M, Vafaei H, Dontas I, Vaggos G, Marinou K, Pervanidou P, Sebire NJ, Chrousos GP, Nicolaides KH. Assessment of body composition in Wistar rat offspring by DXA in relation to prenatal and postnatal nutritional manipulation. Pediatr Res. 2016 Aug;80(2):319-25.
Holemans K, Aerts L, Van Assche FA. Fetal growth restriction and consequences for the offspring in animal models. J Soc Gynecol Investig. 2003 Oct;10(7):392-9.
Neerhof MG, Synowiec S, Khan S, Thaete LG. Pathophysiology of chronic nitric oxide synthase inhibition-induced fetal growth restriction in the rat. Hypertens Pregnancy. 2011;30(1):28-36.
Desai M, Jellyman JK, Ross MG. Epigenomics, gestational programming and risk of metabolic syndrome. Int J Obes (Lond). 2015 Apr;39(4):633-41.
Longo S, Bollani L, Decembrino L, Di Comite A, Angelini M, Stronati M. Short-term and long-term sequelae in intrauterine growth retardation (IUGR). J Matern Fetal Neonatal Med. 2013 Feb;26(3):222-5.
Desai M, Ross MG. Fetal programming of adipose tissue: effects of intrauterine growth restriction and maternal obesity/high-fat diet. Semin Reprod Med. 2011 May;29(3):237-45.
Desai M, Guang Han, Ferelli M, Kallichanda N, Lane RH. Programmed upregulation of adipogenic transcription factors in intrauterine growth-restricted offspring. Reprod Sci. 2008 Oct;15(8):785-96.
Muhlhausler B, Smith SR. Early-life origins of metabolic dysfunction: role of the adipocyte. Trends Endocrinol Metab. 2009 Mar;20(2):51-7.
Martínez-Cordero C, Amador-Licona N, Guízar-Mendoza JM, Hernández-Méndez J, Ruelas-Orozco G. Body fat at birth and cord blood levels of insulin, adiponectin, leptin, and insulin-like growth factor-I in small-for-gestational-age infants. Arch Med Res. 2006 May;37(4):490-4.
Seki Y, Williams L, Vuguin PM, Charron MJ. Minireview: Epigenetic programming of diabetes and obesity: animal models. Endocrinology. 2012 Mar;153(3):1031-8.
Roth CL, Sathyanarayana S. Mechanisms affecting neuroendocrine and epigenetic regulation of body weight and onset of puberty: potential implications in the child born small for gestational age (SGA). Rev Endocr Metab Disord. 2012 Jun;13(2):129-40.
Rajakumar PA, He J, Simmons RA, Devaskar SU. Effect of uteroplacental insufficiency upon brain neuropeptide Y and corticotropin-releasing factor gene expression and concentrations. Pediatr Res. 1998 Aug;44(2):168-74.
Li C, McDonald TJ, Wu G, Nijland MJ, Nathanielsz PW. Intrauterine growth restriction alters term fetal baboon hypothalamic appetitive peptide balance. J Endocrinol. 2013 Apr 29;217(3):275-82. doi: 10.1530/JOE-13-0012.
Fukami T, Sun X, Li T, Desai M, Ross MG. Mechanism of programmed obesity in intrauterine fetal growth restricted offspring: paradoxically enhanced appetite stimulation in fed and fasting states. Reprod Sci. 2012 Apr;19(4):423-30.
Sarr O, Yang K, Regnault TR. In utero programming of later adiposity: the role of fetal growth restriction. J Pregnancy. 2012;2012:134758.
Lee B, Kim SG, Kim J, Choi KY, Lee S, Lee SK, Lee JW. Brain-specific homeobox factor as a target selector for glucocorticoid receptor in energy balance. Mol Cell Biol. 2013 Jul;33(14):2650-8.
Morgane PJ, Austin-LaFrance R, Bronzino J, Tonkiss J, Díaz-Cintra S, Cintra L, Kemper T, Galler JR. Prenatal malnutrition and development of the brain. Neurosci Biobehav Rev. 1993 Spring;17(1):91-128.
Lopes de Souza S, Orozco-Solis R, Grit I, Manhães de Castro R, Bolaños-Jiménez F. Perinatal protein restriction reduces the inhibitory action of serotonin on food intake. Eur J Neurosci. 2008 Mar;27(6):1400-8.
de Andrade Silva SC, da Silva AI, Braz GRF, da Silva Pedroza AA, de Lemos MDT, Sellitti DF, Lagranha C. Overfeeding during development induces temporally-dependent changes in areas controlling food intake in the brains of male Wistar rats. Life Sci. 2021 Nov 15;285:119951.
Yamazaki J, Meagawa S, Jelinek J, Yokoyama S, Nagata N, Yuki M, Takiguchi M. Obese status is associated with accelerated DNA methylation change in peripheral blood of senior dogs. Res Vet Sci. 2021 Oct;139:193-199.
Zeisel A, Hochgerner H, Lönnerberg P, Johnsson A, Memic F, van der Zwan J, Häring M, Braun E, Borm LE, La Manno G, Codeluppi S, Furlan A, Lee K, Skene N, Harris KD, Hjerling-Leffler J, Arenas E, Ernfors P, Marklund U, Linnarsson S. Molecular Architecture of the Mouse Nervous System. Cell. 2018 Aug 9;174(4):999-1014.

Download PDF

Journal Publication

published 28 Jun, 2023

Read the published version in Archives of Gynecology and Obstetrics →

Reviewers agreed at journal
07 May, 2023
Reviewers invited by journal
20 Apr, 2023
Editor invited by journal
20 Apr, 2023
Editor assigned by journal
20 Apr, 2023
First submitted to journal
20 Apr, 2023

You are reading this latest preprint version

Fetal origins of obesity: a novel pathway of regulating appetite neurons in the hypothalamus of growth restricted rat offspring

Status:

Journal Publication

Version 1

Abstract

Figures

What Does This Study Adds To The Clinical Workparagraphs

Introduction

Methods And Materials

Animal modeling and grouping

Hypothalamic NPCs cultural in vitro

Immunofluorescence

RT-PCR

Western Blot

Methylation Specific PCR

Data Analysis

Results

Discussion

Declarations

References

Status:

Journal Publication

Version 1