Robinin inhibits pancreatic cancer cell proliferation, EMT and inflammation via regulating TLR2-PI3k-AKT signaling pathway

doi:10.21203/rs.3.rs-2855241/v1

Download PDF

Research Article

Robinin inhibits pancreatic cancer cell proliferation, EMT and inflammation via regulating TLR2-PI3k-AKT signaling pathway

https://doi.org/10.21203/rs.3.rs-2855241/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 18 Dec, 2023

Read the published version in Cancer Cell International →

You are reading this latest preprint version

Purpose

To investigate the anti-tumor effect of Robinin (Toll-like receptor 2 inhibitor) in pancreatic cancer cells via regulating tumor microenvironment.

Methods

The effects of Robinin on cell proliferation or migration in Mia-PACA2 and PANC-1 were determined, using CCK8 or wound healing assay, respectively. The typical markers of EMT (αSMA and snail) and the inflammation markers (IL-6 and TNF-α) were all detected by western blot. CU-T12-9 (TLR2 agonist) was used to rescue Robinin’s effect. PI3k-p85α and Phosphorylated-AKT (p-AKT) were evaluated, compared to the β-actin and AKT, using western blot.

Results

Robinin significantly inhibited cell proliferation and migration in Mia-PACA2 and PANC-1, compared to HPNE (**P < 0.01). Robinin also attenuated the expression of α-SMA and snail in Mia-PACA2, and PANC-1 (**P < 0.01). Besides, it was found that expression of IL-6 and TNF-α were diminished in presence of Robinin in Mia-PACA2, and PANC-1 (**P < 0.01). Western blot confirmed that Robinin could target on TLR2, and further downregulated PI3k-AKT signaling pathway to exert biological function.

Conclusions

Robinin exerts anti-tumor effect perhaps via downregulating inflammation and EMT in pancreatic cancer cell through inhibiting TLR2-PI3k-AKT signaling pathway. Robinin may be a novel agent in adjuvant therapy of pancreatic cancer.

Robinin

pancreatic cancer

TLR2

inflammation

tumour microenvironment

Pancreatic cancer (PC) has projected as the second leading causes of cancer death by the year 2020, which kills at least 200,000 people worldwide each year[1]. Once pancreatic cancer patients develop distant metastasis, the median survival drops to about 6 months, even with the most advanced techniques treatment [2]. Early radical operation is the only effective treatment for PC. However, lack of detection means for early diagnosis of pancreatic cancer, most patients miss the chance to resect tumor completely. Only 15% of patients with PC have the chance to undergo complete resection, while the remaining 85% of PC patients can only treated with either systemic chemotherapy or radiotherapy[3]. Chemotherapy combined with immune checkpoint blocking therapy has been very successful in a variety of cancers, including breast, lung and stomach cancers, but the chemotherapy is still not ideal in pancreatic cancer[4, 5]. Thus, to explore new anti-tumor therapy for patients who are unable to perform surgery possess great clinical value.

Toll-like receptors (TLRs) are a conserved family of receptors, well recognized for their ability to respond to pathogenic structures, also known as pathogen-associated molecular patterns[6]. TLRs are broadly dispersed in numerous immune cells, including macrophages, dendritic cells (DC), neutrophils, B cells, epithelial and endothelial cells, as well as tumor-associated macrophages (TAMs) [7, 8]. Various TLRs signaling pathways have been certified correlated with tumor occurrence and prognosis in many types of cancer such as breast cancer, gastric cancer and pancreatic cancer [9]. The majority of TLR genes were usually up-regulated or down-regulated in different cancer tissues to varying degrees based on differential expression analyses and surrounding tissues in pancreatic cancer. In pancreatic cancer, TLR2 and TLR4 were found mainly over-expression and correlated with more mortality [10], while TLR9 was found low express in pancreatic cancer[11]. Other molecules of the TLR family (TLR3,7,8) were also confirmed to be closely related to occurrence, development and invasion of pancreatic cancer [12, 13]. Therefore, we speculated that TLR2 interference can similarly regulate tumor microenvironment so as to minimize pan-cancer cell growth and attenuate metastasis, which would be a good candidate of pancreatic cancer medical therapy.

Robinin, a compound with molecular weight of 740.66Da, is present in flavonoid fraction of Vigna unguiculata leaf[14]. Its chemical structure is shown in Fig. 1. Robinin can inhibit upregulated expression of TLR2 and TLR4 to alleviate inflammatory and immune response[15]. Considering the high expression of TLR2 in pancreatic cancer and higher mortality, we speculated that Robinin (TLR2inhibitor) may play a positive role in pancreatic cancer therapy. However, the association between TLR2 stimulation and tumor-genesis of pancreatic cancer and underlying mechanism need to be further elucidated.

The aim of this study was to investigate anti-tumor effect of Robinin in Mia-PACA2 and PANC-1 in vitro. The underlying mechanism was also investigated to illustrate the possible signal pathway which acted by Robinin. These findings may aid to develop Robinin as a novel adjuvant therapy for pancreatic cancer in clinical.

Cell culture

One normal human pancreatic ductal epithelial cell line HPNE (Shanghai Fuheng Biotechnology Co., Ltd., Shanghai, China) and two PC cell lines Mia-PACA2, and PANC-1 (ATCC, Manassas, VA, USA; www.atcc. org) were sourced from ATCC. These cells were cultured with high glaucous Dulbecco’s modified Eagle medium (DMEM, Hyclone Life Technologies) medium supplemented with 10% Fetal bovine serum (FBS, Gibco Life Technologies), 100 U/mL penicillin and 100g/mL streptomycin (Gibco Life Technologies). Subsequently, the cells were maintained at 37℃ in 5% CO₂ in a humidified condition, and the medium was changed every 2 days.

Cytotoxicity and cell proliferation assay

Cytotoxicity assay was detected, using Cell Counting kit‑8 (CCK‑8; Dojindo Molecular Technologies, Inc., Kumamoto, Japan) according to the manufacturer's instructions. Cells under logarithmic phase were seeded (1×10⁴ cells/well) in 96-well plates with FBS-free medium for 24 h. These cells were treated with the various concentrations of Robinin (500 nM, 1 µM, 5 µM or 10 µM/ml) at 37℃ for 24 h after pre-hungry. Following 24 h treatment, all the media in the well were discarded and 10 µl CCK‑8 solution was added at 37˚C incubation for 2 h. The colorimetric absorbance was recorded at 450 nm, using a microplate reader (Bio‑Rad Laboratories, Inc., Hercules, CA, USA).

Cells proliferation assay of cell lines were seeded at appropriate density in 96-well plates for assessment, using CCK-8 kit. Subsequently, the proliferation assay in Mia PaCa2 and PANC-1 was determined following treatment of Robinin (1 µM/ml) for 24, 48 and 72 h. After all exposure, 10 µl CCK8 was added in each well and incubated for 1.5 h. CU-T12-9 was selectively added to reverse the effect of Robinin. Finally, the colorimetric absorbance was also recorded at 450 nm to draw the proliferation curve.

Wound healing assay

Mia-PACA2 and PANC-1 were incubated till 100% confluence and the cell monolayer was scratched with a 200 µl pipette tip. The scratched area was photographed by phase‑contrast microscopy (magnification, x4). Cells were added with fresh DMEM or DMEM combined with Robinin (1 µM/ml) for 24 h. CU-T12-9 was selectively added to reverse the effect of Robinin. Following different treatments, the distance of cell migration was recorded by phase‑contrast microscopy (magnification, x4) and measured by Image J.

RNA isolation, quantitative real-time PCR (qRT-PCR)

Total RNA was isolated from indicated cells using Trizol reagent (Invitrogen, USA) according to the manufacturer's instructions. For qRT-PCR, 2 µg of total RNA was treated with DNase Ⅰ and reverse transcribed using an MMLV system (Promega, USA). RT-PCR was performed using an ABI 7900 RT-PCR system with SYBR Green Real-time PCR Master Mix (ABI, USA) and U6 RNA as the internal reference control. Primer sequences are listed in Table 1. For miRNA detection, stem-loop reverse transcription reactions were performed, and the 2^−∆∆Ct method was used to calculate the relative abundance of RNA genes compared with U6 expression. Details of primers are listed in Table.1. The expression of TLR2, α-SMA, snail, IL-6 and TNF-α in HPNE, Mia-PACA2and PANC-1was tested by RT-qPCR.

Western blot

For mechanistic determination, the PI3k-AKT signaling pathway was evaluated, using western blot. Mia-PACA2 and PANC-1 with appropriate density were seeded in 6-well plates and were treated with Robinin (1 µM/ml) for 2 days. CU-T12-9 was selectively added to reverse the effect of Robinin. Total protein samples were isolated from these cells, using RIPA lysis buffer (Thermo Fisher Scientific, Inc.) supplemented with phosphatase inhibitors (Thermo Fisher Scientific, Inc.) and protease inhibitors (Thermo Fisher Scientific, Inc.). The protein samples were immediately stored at -80°C until use after quantity of protein was measured using BCA protein kit (Beyotime, Inc.).

Protein samples (10 µg) were separated via SDS‑PAGE with 10% of separation gel and 5% stacking gel, and then proteins were transferred to a polyvinylidene fluoride membrane (PVDF membrane, Millipore Corp., Bedford, MA, USA). Protein transferred PVDF membranes were blocked with 5% bovine serum albumin (BSA) and incubated with primary antibodies, including Beta actin monoclonal antibody (β-actin, 1:20000, Proteintech, Inc.cat No 66009-1-Ig), TLR2 polyclonal antibody (1:2000, Proteintech, Inc.cat No 17236-1-AP), PI3 Kinase p85 Alpha Monoclonal antibody(1:10000, Proteintech, Inc. cat No 60225-1-Ig), AKT rabbit polyclonal antibody (1:5000, Proteintech, Inc. cat No 10176-2-AP), phospho-AKT(Ser473) polyclonal antibody (1:5000, Proteintech, Inc.cat No 28731-1-AP), IL-6 Polyclonal antibody (1:1000, Proteintech, Inc. cat No 21865-1-AP), TNF alpha monoclonal antibody (1:3000, Proteintech, Inc. cat No 60291-1-Ig), smooth muscle actin Polyclonal antibody (α-SMA, 1:3000, Proteintech, Inc. cat No 14395-1-AP) ,and rabbit anti-SNAIL polyclonal antibody (1:1000, Bioss Institute of Biotechnology, Beijing, China) on the shaker at 4℃ overnight. The PVDF membranes with targeted protein were incubated with HRP-labeled goat anti-mouse/rabbit antibodies (1:1000, Beyotime, Inc.) for 1 h at room temperature. Immunoreactive bands were visualized using an enhanced chemiluminescence (Beyotime, Inc.) and the density of protein bands were captured by a GS-700 Imaging Densitometer (BIO-RAD, Hercules, CA, USA) and analyzed by Image J.

Statistical analysis

Data were analyzed using SPSS V17.0 software (SPSS Inc.; Chicago, USA) and GraphPad Prism version 7.0 (GraphPad Software, Inc., La Jolla, CA, USA). Numerical data were presented as mean ± standard deviation (SD). Comparisons among multiple groups were performed by one‑way analysis of variance (ANOVA) with least-significant difference (LSD) post‑hoc test. The results are indicated as P values, where *P < 0.05 was considered to indicate a statistically significant difference. The normal distribution test was conducted to check whether the numerical variables were normally distributed.

Upregulated of TLR2, EMT and inflammation are determined in Mia-PACA2 and PANC-1

Compared with normal HPNE, TLR2 was found highly expressed in Mia-PACA2 and PANC-1 (**P < 0.01, Fig. 2A). Snail and α-SMA also highly expressed in Mia-PACA2 and PANC-1, which indicated that EMT was active in pancreatic cancer cells (**P < 0.01, Fig. 2B). Furthermore, inflammation markers (IL-6 and TNF-α) are highly expressed in Mia-PACA2 and PANC-1 (**P < 0.01, Fig. 2C).

Robinin attenuates cell proliferation of Mia-PACA2 and PANC-1

It was observed that Robinin (> 5 µM/mL) reduced cell viability significantly in Mia-PACA2 and PANC-1 compared that of the untreated groups (**P < 0.01, Fig. 3A). A slight cell toxicity in Mia-PACA2 was found in presence with Robinin (1 µM /ml) compared to the untreated group (450 nM OD values, Ctrl = 2.78 ± 0.16, Robinin 1 µM = 2.58 ± 0.18, *P = 0.019; Fig. 3A). A slight cell toxicity in PANC-1 was found in presence with Robinin (1 µM /ml) compared to the untreated group (450 nM OD values, Ctrl = 2.65 ± 0.11, Robinin 1 µM = 2.47 ± 0.15, *P = 0.029; Fig. 3A). No significant cell toxicity was observed in presence with CU-T12-9 (< 5 µM/ml, P > 0.01, Fig. 3A).

In HPNE, no cell toxicity was observed in presence with Robinin (1 µM/ml) compared to the untreated group (450 nM OD values, Ctrl = 2.26 ± 0.10, Robinin 1 µM = 2.16 ± 0.06, P = 0.144; Fig. 3A). Robinin o-cultivated with 1 µM/ml CU-T12-9 also showed no toxicity in HPNE (2.26 ± 0.10 vs 2.18 ± 0.15, P = 0.220, Fig. 3B). Based on the toxicity results, 1 µm Robinin and co-cultivated with 1µm CU-T12-9 were selected as the concentration for subsequent experiments.

Proliferation assay verified that Mia-PACA2 proliferation significantly diminished in the presence of Robinin of 1 µM/ml treatment for 72 h (3.37 ± 0.14 vs 2.44 ± 0.17, **P < 0.01, Fig. 3B), but CU-T12-9 can partially reversed Robinin’s inhibition on Mia-PACA2 (2.95 ± 0.15 vs 2.44 ± 0.17, ##P < 0.01, Fig. 3B). Similarly, 1 µM/ml Robinin strongly attenuated the proliferation of PANC-1 (3.20 ± 0.18 vs 2.29 ± 0.17, **P < 0.01, Fig. 3B). Co-cultivated with CU-T12-9 also partly attenuate the inhibition of Robinin in PANC-1 (2.84 ± 0.12 vs 2.29 ± 0.17, ##P < 0.01, Fig. 3B). Similar results were also found in the treatment of 5 µM/ml Robinin on Mia-PACA2 and PANC-1.

Robinin inhibits cell migration of Mia-PACA2 and PANC-1

Wound healing assay was conducted to evaluate the migratory activity of the cells in vitro. Robinin obviously attenuated the migration of Mia-PACA2 and PANC-1, but in the presence of CU-T12-9 can significantly reverse the effect of Robinin. Treated with Robinin for 24 h, the cell migration area of Mia-PACA2 was about 26.20 ± 2.74%, much narrower than the area of ctrl group (46.27 ± 3.89%, **P < 0.01, Fig. 4A), while this effect was reversed by Robinin co-cultivated with CU-T12-9 (42.61 ± 3.32%, ##P = 0.01, Fig. 4A). Treated with Robinin for 24 h, the cell migration area of PANC-1 was about 21.64 ± 3.00%, much narrower than the area of ctrl group (40.86 ± 2.15%, **P < 0.01, Fig. 4B), while this effect was reversed by Robinin co-cultivated with CU-T12-9 (33.84 ± 1.29%, ##P = 0.01, Fig. 4B).

Robinin attenuated EMT and inflammation of Mia-PACA2 and PANC-1

The typical markers of EMT were examined, including snail and α-SMA. Robinin (1 µM/ml) largely attenuated snail and α-SMA expression in Mia-PACA2 and PANC-1, which certified that Robinin can obviously inhibit the conversion progress of EMT in pancreatic cancer (Fig. 5A). Furthermore, the typical markers of inflammation were examined, including IL-6 and TNF-α. Robinin (1 µM/ml) largely attenuated IL-6 and TNF-α expression in Mia-PACA2 and PANC-1, which certified that Robinin can obviously inhibit the inflammation in pancreatic cancer (Fig. 5B).

Robinin downregulated PI3K/AKT signal pathway in Mia-PACA2 and PANC-1

TLR2, PI3k-p85α, and p-AKT protein levels were detected, using western blot and normalized to β-actin and AKT proteins. In Mia-PACA2, western blot analysis showed that the expression levels of expressions of TLR2, PI3k-p85α, and p-AKT were significantly decreased by Robinin treatment in Mia-PACA2 (all **P < 0.01, Fig. 6A), whereas the Robinin effect was partly reversed by CU-T12-9 (##P < 0.01, Fig. 6A). Expressions of TLR2, PI3k-p85α, and p-AKT in PANC-1were also significantly decreased by Robinin treatment (all **P < 0.01, Fig. 6B), while these effects were partly reversed by CU-T12-9 (#P < 0.05, Fig. 6B). These results suggested that Robinin might play its biological function targeted on TLR2 then through regulating the PI3k-AKT signaling pathway.

Pancreatic cancer is a malignancy with a high mortality rate and increasing incidence and associated mortality, and even with treatment, its prognosis is extremely poor[15]. The occurrence and development of tumors is inseparable from the interaction of multiple factors and mutual promotion. Toll-like receptors are a group of receptors that play a key role in innate immune signaling and initiating inflammatory responses[16]. In recent years, emerging evidence has emerged that TLRs play an extremely important part in the progression of cancer. Studies have shown that among many TLR subtypes, TLR2 is highly overexpressed in pancreatic cancer, and its expression is associated with cancer aggressiveness[17, 18]. According to previous literatures, the migration and invasion ability of epithelial tumors is enhanced, and EMT is an important biological process for epithelial cell-derived malignant tumor cells to acquire migration and invasion ability. Changes in the expression of epithelial and mesenchymal genes during EMT are regulated by multiple families of transcription factors, including SNAI1/Snail, ZEB1/ZEB2, and basic helix-loop-helix transcription factors[19]. Studies have confirmed that inflammatory factors can promote the growth of tumors and play an important role in the process of tumor cell migration, invasion and metastasis. Our results show significant upregulation of expression levels of TLR2, Snail and α-SMA, and symptomatic markers (IL-6 and TNF-α).

Robinin which is found in plants of the genus Astragalus has been reported to have explicit anti-inflammatory, pain relieving effects, however, research on its anti-tumor effect is still limited[20]. Robinin's anti-inflammatory effects has been confirmed by several studies. Eom et al. [21]have reported that Robinin can decrease the expression of several inflammation cytokines, such as IL-6, TNF-α, and cyclooxygenase-2 (COX-2) in inflammatory macrophages. In another adjuvant arthritis survey, Robinin has been applied combined with Methotrexate to strengthen the anti-inflammation effect through decreasing IL-17 in blood plasma[20]. However, only one manuscript focused on anti-tumor effect of Robinin on breast cancer has been found (Simultaneous determination of the flavonoids robinin and kaempferol in human breast cancer cells by liquid chromatography-tandem mass spectrometry)[22]. Thus, Robinin's role in pancreatic cancer has not been reported yet. Our study shows that Robinin, as an inhibitor of TLR2, significantly inhibits the proliferation and migration of pancreatic cancer cells, which is reversed by the combination of CU-T12-9 and Robinin. At the same time, we also observed that Robinin can inhibit the expression of inflammatory factors and EMT in pancreatic cancer cells. Therefore, we demonstrated that Robinin possess anti-cancer biological function in PC perhaps by regulating the tumor immune microenvironment. The results of our research has potent clinical application value in pancreatic cancer treatment.

Interference of signaling pathways in human cancers provides a new area of cancer treatment[23]. The PI3K-AKT pathway, an intracellular signaling pathway, is often dysregulated in human cancers and has been shown to be central to mediating various cellular processes, including cell proliferation, apoptosis, and cell migration[24–26]. Studies have shown that the PI3K/Akt signaling pathway is closely related to the regulation of CircNDST1 in the proliferation and invasion of papillary thyroid cancer[27]. Guo et al. [28]suggest that ROR2/PI3K/Akt regulatory network may help promote breast cancer progression. Furthermore, increasing research into this pathway favors effective drug development and cancer treatment[29]. Therefore, the expression of ATK may reflect the proliferative capacity of the tumor, and its overactivation plays a crucial role in the development and development of cancer. We then explored the relationship between Robinin, TLR2, and the PI3k/ATK pathway. We observed that TLR2 protein expression was significantly inhibited and the PI3k/ATK pathway was activated after Robinin treatment, leading to proliferation and migration of pancreatic cancer cells. However, when Robinin and CU-T12-9 were co-treated, the above effects were successfully reversed by CU-T12-9.

Our study demonstrated that Robinin plays a positive role in inhibiting pancreatic cancer cell proliferation and migration. Furthermore, EMT and inflammation were also attenuated by Robinin treatment. Considering TLR is the most classical immunomodulatory receptor, the agents targeted on TLR may obtain effective applications in regulating TME of pancreatic cancer. In our study, Robinin appears to be a good candidate for inhibition of pancreatic cancer, namely anti-proliferation, anti-migration, and anti-EMT, which indicates Robinin's potential value in the future clinical treatment of pancreatic cancer.

It should be stated that there are some limitations in the present study. In vitro assays are not ample to assess the anti-tumor effect of Robinin in vivo. Thus, it cannot be extrapolated directly in clinical situations. So, the anti-tumor effects of Robinin warrants investigation in animal model further.

In summary, Robinin inhibited cell migration, proliferation, and attenuated EMT perhaps via regulating inflammatory microenvironment in pancreatic cancer cells through targeted on TLR2- PI3k-AKT signaling pathway. Our data strongly supports that Robinin may be a potential adjuvant therapy for pancreatic cancer.

BSA: Bovine serum albumin; CCK-8: Cell counting kit‑8; DMEM: Dulbecco’s modified Eagle medium; EMT: Epithelial‑mesenchymal transition; FBS: Fetal bovine serum; IL-6: Interleukin- 6; TNF-α: Tumor necrosis factor-α; TLR: Toll like receptor; α-SMA: α-smooth muscle actin.

Acknowledgments

Not applicable.

Conflicts of interests

We declare that we have no financial and personal relationships with other people or organizations that can inappropriately influence our work, there is no professional or other personal interest of any nature or kind in any product, service and/or company that could be construed as influencing the position presented in the manuscript entitled.

Funding

This study was financially supported by the internal medical research funded by Changzhou No 2 Hospital to Hu XC. This work was supported by the National Youth Science Foundation of China (82202446).

Availability of data and materials

The datasets used and/or analyzed during the present study are available from the authors on reasonable request.

Authors' contributions

X.C. H. participated in the project design and revision of the manuscript. W.T. L. was responsible for cell culture, cell cytotoxicity, cell migration, immunofluorescent staining, Western blot. W.W. Z. performed the statistical analysis, drafted figures and the manuscript. All authors read and approved the final manuscript.

Ethics approval and consent to participate

This study is strictly conducted on the basis of the Declaration of Helsinki.

Rahib L, Smith BD, Aizenberg R, et al. Projecting cancer incidence and deaths to 2030: the unexpected burden of thyroid, liver, and pancreas cancers in the United States. Cancer Res. 2014;74:2913–21.
Kamisawa T, Wood LD, Itoi T, et al. Pancreat cancer Lancet. 2016;388:73–85.
Chen X, Zhang L, Jiang Y, et al. Radiotherapy-induced cell death activates paracrine HMGB1-TLR2 signaling and accelerates pancreatic carcinoma metastasis. J Exp Clin Cancer Res. 2018;37:77.
Lee SY, Jeong EK, Ju MK, et al. Induction of metastasis, cancer stem cell phenotype, and oncogenic metabolism in cancer cells by ionizing radiation. Mol Cancer. 2017;16:10.
De Bacco F, Luraghi P, Medico E, et al. Induction of MET by ionizing radiation and its role in radioresistance and invasive growth of cancer. J Natl Cancer Inst. 2011;103:645–61.
Newton K, Dixit VM. Signaling in innate immunity and inflammation. Cold Spring Harb Perspect Biol.2012; 4.
Janeway CA Jr, Medzhitov R. Innate immune recognition. Annu Rev Immunol. 2002;20:197–216.
Shime H, Matsumoto M, Oshiumi H, et al. Toll-like receptor 3 signaling converts tumor-supporting myeloid cells to tumoricidal effectors. Proc Natl Acad Sci U S A. 2012;109:2066–71.
Sanchez-Vega F, Mina M, Armenia J, et al. Oncogenic Signal Pathways Cancer Genome Atlas Cell. 2018;173:321–337e10.
Grimmig T, Moench R, Kreckel J et al. Toll Like Receptor 2, 4, and 9 Signaling Promotes Autoregulative Tumor Cell Growth and VEGF/PDGF Expression in Human Pancreatic Cancer. Int J Mol Sci.2016; 17.
Leppanen J, Helminen O, Huhta H, et al. Toll-like receptors 2, 4 and 9 and hypoxia markers HIF-1alpha and CAIX in pancreatic intraepithelial neoplasia. APMIS. 2018;126:852–63.
Ochi A, Graffeo CS, Zambirinis CP, et al. Toll-like receptor 7 regulates pancreatic carcinogenesis in mice and humans. J Clin Invest. 2012;122:4118–29.
Ye J, Mills BN, Qin SS et al. Toll-like receptor 7/8 agonist R848 alters the immune tumor microenvironment and enhances SBRT-induced antitumor efficacy in murine models of pancreatic cancer. J Immunother Cancer.2022; 10.
Gil CS, Eom SH. Two different anti-algal control mechanisms in Microcystis aeruginosa induced by robinin or tannin rich plants. Chemosphere. 2023;323:138202.
Oshi M, Tokumaru Y, Patel A et al. A Novel Four-Gene Score to Predict Pathologically Complete (R0) Resection and Survival in Pancreatic Cancer. Cancers (Basel).2020; 12.
Kawai T, Akira S. The role of pattern-recognition receptors in innate immunity: update on Toll-like receptors. Nat Immunol. 2010;11:373–84.
Ikebe M, Kitaura Y, Nakamura M, et al. Lipopolysaccharide (LPS) increases the invasive ability of pancreatic cancer cells through the TLR4/MyD88 signaling pathway. J Surg Oncol. 2009;100:725–31.
Binker-Cosen MJ, Richards D, Oliver B, et al. Palmitic acid increases invasiveness of pancreatic cancer cells AsPC-1 through TLR4/ROS/NF-kappaB/MMP-9 signaling pathway. Biochem Biophys Res Commun. 2017;484:152–8.
Lamouille S, Xu J, Derynck R. Molecular mechanisms of epithelial-mesenchymal transition. Nat Rev Mol Cell Biol. 2014;15:178–96.
Tsiklauri L, Svik K, Chrastina M et al. Bioflavonoid Robinin from Astragalus falcatus Lam. Mildly Improves the Effect of Metothrexate in Rats with Adjuvant Arthritis. Nutrients.2021; 13.
Eom SH, Jin SJ, Jeong HY et al. Kudzu Leaf Extract Suppresses the Production of Inducible Nitric Oxide Synthase, Cyclooxygenase-2, Tumor Necrosis Factor-Alpha, and Interleukin-6 via Inhibition of JNK, TBK1 and STAT1 in Inflammatory Macrophages. Int J Mol Sci.2018; 19.
Tsiklauri L, An G, Ruszaj DM, et al. Simultaneous determination of the flavonoids robinin and kaempferol in human breast cancer cells by liquid chromatography-tandem mass spectrometry. J Pharm Biomed Anal. 2011;55:109–13.
Dancey JE, Bedard PL, Onetto N, et al. The genetic basis for cancer treatment decisions. Cell. 2012;148:409–20.
Wang X, Xu X, Zhang T, et al. Estrogen upregulates DNA2 expression through the PI3K-AKT pathway in endometrial carcinoma. J Zhejiang Univ Sci B. 2023;24:262–8.
Wu K, Chen H, Fu Y, et al. Insulin promotes the proliferation and migration of pancreatic cancer cells by up-regulating the expression of PLK1 through the PI3K/AKT pathway. Biochem Biophys Res Commun. 2023;648:21–7.
Jiang W, Zhong S, Chen Z, et al. 2D-CuPd nanozyme overcome tamoxifen resistance in breast cancer by regulating the PI3K/AKT/mTOR pathway. Biomaterials. 2023;294:121986.
Shu C, Wang S, Hu J, et al. CircNDST1 promotes papillary thyroid cancer progression via its interaction with CSNK2A1 to activate the PI3K-Akt pathway and epithelial-mesenchymal transition. J Endocrinol Invest. 2023;46:545–57.
Guo M, Ma G, Zhang X, et al. ROR2 knockdown suppresses breast cancer growth through PI3K/ATK signaling. Aging. 2020;12:13115–27.
Guerrero-Zotano A, Mayer IA, Arteaga CL. PI3K/AKT/mTOR: role in breast cancer progression, drug resistance, and treatment. Cancer Metastasis Rev. 2016;35:515–24.

Table.1 Primer sequences for RT-qPCR

Name	Primer sequences (5’–3’)
TLR2	Forward: ATCCTCCAATCAGGCTTCTCT Reverse: GGACAGGTCAAGGCTTTTTACA
Snail	Forward: GCCGAGTGTAATCAGGAG
	Reverse: GGAGTGCTTGTTCAGGAG
α-SMA	Forward: CTTGAGAAGAGTTACGAGTTG
	Reverse: GATGCTGTTGTAGGTGGTT
IL-6	Forward: AGACAGCCACTCACCTCTTCA Reverse: GGCTTGTTCCTCACTACTCTC
TNF-α	Forward: CAGCCTTCATCCACTCTC Reverse: CATCTCTTGCCACATCTCT

No competing interests reported.

Download PDF

Journal Publication

published 18 Dec, 2023

Read the published version in Cancer Cell International →

Editorial decision: Major revision
11 May, 2023
Submission checks completed at journal
07 May, 2023
Editor assigned by journal
07 May, 2023
First submitted to journal
24 Apr, 2023

You are reading this latest preprint version

Robinin inhibits pancreatic cancer cell proliferation, EMT and inflammation via regulating TLR2-PI3k-AKT signaling pathway

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Materials and methods

Cell culture

Cytotoxicity and cell proliferation assay

Wound healing assay

RNA isolation, quantitative real-time PCR (qRT-PCR)

Western blot

Statistical analysis

Results

Upregulated of TLR2, EMT and inflammation are determined in Mia-PACA2 and PANC-1

Robinin attenuates cell proliferation of Mia-PACA2 and PANC-1

Robinin inhibits cell migration of Mia-PACA2 and PANC-1

Robinin attenuated EMT and inflammation of Mia-PACA2 and PANC-1

Robinin downregulated PI3K/AKT signal pathway in Mia-PACA2 and PANC-1

Discussion

Conclusion

Abbreviations

Declarations

References

Tables

Additional Declarations

Status:

Journal Publication

Version 1