Traditional Chinese medicine andrographolide sulfonate alleviates airway inflammation by supressing TRL3-TRIF in mice post respiratory syncytial virus infection

doi:10.21203/rs.3.rs-2871979/v1

Download PDF

Research Article

Traditional Chinese medicine andrographolide sulfonate alleviates airway inflammation by supressing TRL3-TRIF in mice post respiratory syncytial virus infection

https://doi.org/10.21203/rs.3.rs-2871979/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Background

Andrographolide sulfonate is a proprietary Traditional Chinese Medicine used for the treatment of childhood respiratory tract infections. However, its effective role in respiratory syncytial virus (RSV) infection remain unclear.

Methods

BALB/c mice were infected with RSV and inoculated intraperitoneally or intranasally with andrographolide sulfonate daily for 5 days. Lung damage was measured using hematoxylin and eosin staining. Bronchoalveolar lavage fluid (BALF) was used for total cell counts and interferon-γ (IFN-γ) detection based on enzyme-linked immunosorbent assay (ELISA). The expression levels of the RSV N gene and Toll-like receptor (TLR) mRNA were detected by quantitative real-time polymerase chain reaction (qRT-PCR), and the expression levels of the N protein, TLR2/3, and TRIF were detected by western blot analysis.

Results

Intraperitoneal injection of andrographolide sulfonate did not suppress RSV-induced inflammation, whereas intranasal administration reduced the total number of inflammatory cells in the BALF and pathological damage in the lungs. Furthermore, IFN-γ production was significantly decreased in the BALF, as were the N gene and protein expression levels. The RSV N gene was positively correlated with lung inflammation. After intranasal treatment with andrographolide sulfonate, lung TLR3 and TRIF expression were also reduced compared to the the RSV group.

Conclusions

Intranasal administration of andrographolide sulfonate reduces RSV replication and RSV infection-induced substance inflammation via TLR3-TRIF. Andrographolide sulfonate aerosol inhalation may be a better treatment for viral respiratory diseases.

Andrographolide sulfonate

RSV

TLR3

TRIF

Traditional Chinese medicine (TCM) is an integral part of the Chinese identify. Medicinal plants have historically proven their value as sources of molecules with therapeutic potential and remain an important resource for the identification of novel drug candidates. Andrographolide sulfonate (sodium 9-dehydro-17-hydro-andrographolide-19-yl sulfate) (Xiyanping injection) is a proprietary TCM that has been used for more than three decades to treat upper respiratory tract infections, viral pneumonia, influenza, and bronchitis (Yang et al., 2019). Andrographolide sulfonate is prepared by sulfonation of andrographolide, which improves its water solubility and bioavailability (Zheng et al., 2016). Andrographolide sulfonate is also considered a multitarget drug with myriad anti-inflammatory, antioxidant, and antineoplastic effects on different cells (Burgos et al., 2020). It has been reported that andrographolide sulfonate can protect neurons from inflammation-mediated injury via nuclear factor-κB (NF-κB) inhibition and Nrf2/HO-1 activation, attributed to the reduction in NO, TNF-α, and IL-6 release and reactive oxygen species (ROS) production in microglia (Xu et al., 2019), and it may also protect against LPS-induced inflammatory responses by inducing Nrf2 activation (Fu et al., 2021).

Atomization inhalation targets the lungs, greatly reducing systemic drug exposure while retaining a high concentration of the drug in the lungs, thus increasing efficacy. With the development of nebulizers, growing evidence supports the advantages of inhalation over other routes of drug administration. Inhaled drugs can localize to target organs, thus allowing lower doses than would be required for systemic delivery, resulting in fewer and less severe adverse effects (Zhang et al., 2021a) .

Respiratory syncytial virus (RSV) is a common cause of acute lower respiratory tract infection (ALRI) and hospitalization in children, placing a substantial burden on healthcare services. There were 2.5–4.1 million hospitalisations in children is associated with RSV in a 58 countries estimate in 2019 (Li et al., 2021b). About 45% of hospital admissions and in-hospital deaths due to RSV-ALRI occur in children younger than 6 months (Shi et al., 2017). Furthermore, RSV-ALRI is an important cause of overall morality in children after pneumococcal pneumonia and Haemophilus influenzae type B(Hib)(Nair et al., 2010). In addition, RSV infection is associated with recurrent wheezing during the first year of life (Minagawa et al., 2016). As passive RSV immunization, such as maternal vaccination and monoclonal antibodies, only grants a temporary period of protection, effectiveness and efficacy depend on the timing of immunization relative to underlying RSV seasonality (Li et al., 2021a). Thus, accelerating the development of new prevention and treatment strategies should be a priority.

After RSV infection, airway epithelial cells, macrophages, and dendritic cells (DCs) are the main inducers of innate immune responses. Several Toll-like receptors (TLRs) have been identified that act as pattern recognition receptors (PRRs) for RSV-derived pathogen associated molecular pattern (PAMPs) (Takeda et al., 2003) (Gong et al., 2021). Previous studies have shown that RSV triggers TLR3-TRIF signaling to mediate airway inflammation (Zang et al., 2011) and resveratrol can suppress RSV-induced airway inflammation through TRIF-dependent signals (Liu et al., 2014). Although there is no direct evidence that andrographolide sulfonate targets the TLR-TRIF pathway, it can suppress poly I:C-induced lung inflammation by inhibiting activation of NF-κB (Cui et al., 2020).

Here, we used a mouse model of RSV infection to investigate the anti-inflammatory effects of andrographolide sulfonate. We determined whether andrographolide sulfonate acts through the TLR3-TRIF pathway.

Cell culture, virus, and infection

The RSV A2 strain was obtained from the Viral Laboratory (Capital University of Medical Sciences, Beijing, China). RSV was grown in HEp-2 cells and purified by a density gradient, as described previously (Zang et al., 2011). In all experiments, mice were intranasally infected with 100 µl of RSV at a total concentration of 1.0 × 10⁸ PFU/ml as described previously(Zang et al., 2015).

Animals

Female BALB/c mice (6–8 weeks old) were purchased from the Chongqing Medical University Animal Laboratory. The mice were housed in separate filter-top cages under accredited specific-pathogen-free conditions as described previously (Zang et al., 2011). This study was approved by the Ethics Committee of Chongqing Medical University of Medical Sciences, and the experiments were performed according to the guidelines provided by the Chinese Council on Animal Care (license numbers SCXK[Yu] 2012-0001 and SYXK[Yu] 2012-0001).

RSV infection and andrographolide sulfonate treatment

Mice were treated intraperitoneally with cyclophosphamide (CYP) as described previously (Kong et al., 2005). Briefly, CYP was first administered to the mice in a single dose of 100 mg/kg of body weight. After 5 days, the mice were inoculated intranasally with 1.0 × 10⁸ PFU RSV in 100 µl of phosphate-buffered saline (PBS), or sham-infected with 100 µl of PBS alone as described previously(Xie et al., 2017). The mice were then injected intraperitoneally with either andrographolide sulfonate (Xiyanping injection, XYP, Jiangxi Qingfeng Pharmaceutical Co. Ltd, China, WS-10863(d-0863)-2002-2011Z) at 10 mg/kg or 100 mg/kg or with normal saline on day 0 (2 h post-RSV infection) and days 1 to 4, consecutively. Other mice were administered intranasally with either andrographolide sulfonate at 20 µl (0.5 mg/mice/d) or normal saline on day 0 (2 h post-RSV infection) and days 1 to 4, consecutively. According to the previous data of the research group, it was found that the lung inflammation was most obvious on the 5th day after RSV infection in mice(Zhou et al., 2017). So all mice were sacrificed on day 5 post RSV infection.

Lung histology

Left lung tissue samples were fixed in 10% (vol/vol) neutral buffered formalin for > 24 h, then all the samples were dehydrated, embedded in paraffin, cut into sections (4-mm thick), and stained with hematoxylin and eosin (H&E) as described previously (Zang et al., 2011). The degree of lung tissue inflammation was scored, as described previously (Peebles RS, 2001).

Bronchoalveolar lavage fluid (BALF) analysis

Mice were deeply anaesthetized by an intraperitoneal injection of pentobarbital (90 mg/kg body weight). The lungs were lavaged six times with 0.5 ml PBS. The BALF was centrifuged (2500 rpm, 5 min) and the supernatant was stored at − 80°C for cytokine test. The cellular pellets were resuspended in 1 ml of PBS, and total cell number was counted. For differential cell counts, the resuspended cells was spun onto microscope slides, airdried. After stained with Giemsa, 200 cells were counted to calculate the number of macrophages, neutrophils, lymphocytes in BALF.

Measurement of inflammatory mediators in BALF

Cytokine levels in the BALF were measured by enzyme-linked immunosorbent assay (ELISA). IFN-γ (Sizhengbai, Beijing, China) were performed according to the manufacturer’s directions. In this experiment, 100µl BALF was added to each well, and double wells were used for the same sample.

Quantitative real-time polymerase chain reaction (qRT-PCR)

Total RNA was extracted from whole lung tissue using Trizol reagent (Takara, Japan), followed by cDNA synthesis. The RSV N gene were determined using a hydrolysis probes after RSV infection as described previously (Zhou et al., 2017). For absolute quantification, the number of RSV copies was quantified with a hydrolysis probe with 2 µl of cDNA in a total volume of 20 µl and the exact number of copies of the RSV N gene was calculated using a plasmid DNA standard curve(Chen et al., 2019). Primers specific for the nucleocapsid (N) gene are shown in Table 1. We also performed qRT-PCR to detect the relative expression levels of TLR1-9. We choose GAPDH as the internal parameter. Primer sequences used are shown in Table 2.

Table 1

Primer and probe sequences used for RSV N gene
N gene	Forward primer (5’-3’)	AGATCAACTTCTGTCATCCAGCAA
	Reverse primer (5’-3’)	TTCTGCACATCATAATTAGGAGTATCAAT
	probe	FAM-5’-CACCATCCAACGGAGCACAGGAGAT-3’-BHQ1

Table 2

Primer sequences used for RT-PCR
No.	Gene	Forward primer (5’-3’)	Reverse primer (5’-3’)
1	TLR1	GGTAGCAAGAGAAGTGGTGGAG	CGATGGTGACAGTCAGCAGAAC
2	TLR2	ACAGCAAGGTCTTCCTGGTTCC	GCTCCCTTACAGGCTGAGTTCT
3	TLR3	GTCTTCTGCACGAACCTGACAG	TGGAGGTTCTCCAGTTGGACCC
4	TLR4	AGCTTCTCCAATTTTTCAGAACTTC	TGAGAGGTGGTGTAAGCCATGC
5	TLR5	TCCTGACCAGAGCACATTTGCC	CCTTCAGTGTCCCAAACAGTCG
6	TLR6	TGAGCCAAGACAGAAAACCCA	GGGACATGAGTAAGGTTCCTGTT
7	TLR7	ATGTGGACACGGAAGAGACAA	GGTAAGGGTAAGATTGGTGGTG
8	TLR8	AAGTGCTGGACCTGAGCCACAA	CCTCTGTGAGGGTGTAAATGCC
9	TLR9	GCTGTCAATGGCTCTCAGTTCC	CCTGCAACTGTGGTAGCTCACT

Immunoblotting

Extracts of the total protein from the lung tissues were obtained using a total protein extraction kit (KeyGEN, Nanjing, China), and the protein concentrations were determined using the BCA assay reagent (Bioteke) following the manufacturer’s instructions(Chen et al., 2019). Whole lung protein was resolved using 10% Tris sodium dodecyl-sulfate polyacrylamide gel electrophoresis (SDS-PAGE), then transferred onto polyvinylidene difluoride (PVDF) membranes. The membranes were incubated with primary antibodies against TLR2 (1:1 000, ABclonal, USA), TLR3 (1:1 000, ABclonal, USA), TRIF (1:1 000, Abcam, UK), RSV (1:1 000, Millipore, USA) and β-Actin (1:2 000,Proteintech, USA), followed by incubation with appropriate secondary antibodies. The protein bands were visualized using a chemiluminescence kit (BioRad, UAS).

Statistical analysis

Data analyses were performed using SPSS v19.0 software. One-way analysis of variance (ANOVA) was used to detect differences among groups. Two-way ANOVA was used to analyze the significance of differences between two variables. Unpaired Student’s t-test was used to detect differences between two groups. The pearson method was used for correlation analysis. A P-value of 0.05 was considered significant.

Intranasal administration but not intraperitoneal administration of andrographolide sulfonate (XYP) suppresses lung inflammation in RSV infected mice

To determine its potential anti-inflammatory effects on mice, we administered andrographolide sulfonate intraperitoneally or intranasally for 5 consecutive days after RSV infection. Results showed that intraperitoneal administration of XYP did not reduce the total number of inflammatory cells in the BALF (Fig. 1A). However, total number of inflammatory cells in the BALF was significantly lower with intranasal administration of XYP, and among the cells, lymphocytes showed the most obvious decrease (Fig. 2A).

Our previous study domenstrated that the critical role of IFN-γ in mediating inflammatory and airway hyperresponsive after RSV infection. And the IFN-γ levels were significantly increased after RSV infection. Intraperitoneal injection of XYP did not reduce IFN-γ expression in the BALF (Fig. 1B). While, intranasal administration of XYP, IFN-γ production was reduced (Fig. 2D).

The lungs of infected mice were analyzed using histopathology. Inflammation of the bronchioles and perivascular tissue as well as alveolitis in the lung were observed on day 5 post RSV infecion. Compared with the control group, lung inflammation in the RSV group was significantly aggravated, but was not reduced by intraperitoneal administration of XYP (Fig. 1C,D). While, intranasal administration of XYP improved airway inflammation in mice infected with RSV. Lung pathology showed that inflammation of the bronchioles and perivascular tissue as well as alveolitis in the lung of RSV-infected mice were significantly increased compared with the control group but were markedly decreased after intranasal administration of XYP (Fig. 2B, C).

Intranasal administration of XYP reduces RSV N gene expression

To determine viral loads, viral N gene RNA was isolated from RSV-infected mice and measured by qRT-PCR. Results showed that N gene expression was increased after RSV infection and decresed after treatment with XYP(Fig. 3A).

We then detected RSV N protein expression in lung tissue. Results showed that N protein expression was increased after RSV infection and decresed after treatment with XYP, as well as the fusion protein(F) of RSV.These results reveal that XYP can supress RSV replication(Fig. 3B).

RSV N gene is positively correlated with lung inflammation

We explored correlations between the RSV N gene and lung inflammation, such as total cell number and IFN-γ content in the BALF. Results demonstrated a positive correlation between the RSV N gene and total cell number in the BALF (P = 0.01, r = 0.99) and a positive correlation between the RSV N gene and IFN-γ levels in the BALF (P = 0.01, r = 0.99).

Intranasal administration of XYP suppresses TLR3 and TRIF expression

We next detected the relative mRNA expression levels of TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, and TLR9 in lung tissue to explore the mechanism of action of XYP as TLRs mediated the inflammation after RSV infection.

Results showed that the mRNA expression levels of TLR1, TLR2, and TLR3 in the lung was increased in the RSV group. After XYP administration, the expression levels of TLR2 and TLR3 showed decreasing trend but no significance compared to RSV group.(Fig. 4)

As we detected the same in A549 cells as in mice that RSV increased TLR2 and TLR3 expression (data no shown). We next detected the protein expression levels of TLR2, TLR3 in lung tissue. Results showed that the TLR2 expression remain unchanged, while the expression level of TLR3 were significantly increased after RSV infection then decreased when treatment with XYP. Next, we detected the Toll-interleukin-1 receptor (TIR)-domain-containing adaptor-inducing IFN-β (TRIF) expression in lung tissue which was a critical adoptor downstream of TLR3; showed the same as TLR3, TRIF increased after RSV infection then decreased when treatment with XYP (Fig. 5).

RSV infection in infants is a major public health concern. With the exception of palivizumab for preterm infants, no specific drug is currently available for RSV treatment. In the present study, we found that intranasal administration of andrographolide sulfonate reduced RSV-induced inflammation in mice via TLR3-TRIF.

Previous studies have shown that andrographolide sulfonate can inhibit enterovirus 71(EV71) infection in mice (Li et al., 2018). Cui (Cui et al., 2020) reported that andrographolide sulfonate (1, 3, 10 mg/kg) dissolved in saline were given to mice once (i.p) immediately after poly I:C, and found that andrographolide sulfate remarkably alleviated pneumonia induced by poly I:C in mice. However, we found that intraperitoneal injection of andrographolide sulfonatedid not supress RSV induced inflammation. The reason is probably because we use live virus and the virus titer is high.

Pulmonary drug delivery is a noninvasive method to deliver drugs to damaged lung tissue and improve systemic lung absorption. Inhalation-based drug delivery, which can reduce systemic side effects and improve therapeutic effects, has thus received increasing attention. Pulmonary drug delivery is considered ideal for the treatment of respiratory diseases, including asthma, chronic obstructive pulmonary disease, pneumonia, and pulmonary fibrosis (Wang et al., 2022). In recent years, a growing number of TCMs and spray-type drugs have been modified for use with different atomization devices, showing better targeting and therapeutic effects. For example, aerosol inhalation rather than conventional oral spray of Kai Hou Jian results in better dispersal on the lesion surface, thereby maximizing therapeutic effects (Feng et al., 2022). Our results showed that intranasal administration of andrographolide sulfonate reduced total inflammatory cell number, especially lymphocytes, in RSV-infected mice. Based on lung histopathology, we also found that intranasal administration of andrographolide sulfonate reduced inflammation of the bronchioles and perivascular tissue as well as alveolitis in the lung of RSV-infected mice. In our previous study, IFN-γ production was shown to be significantly increased in RSV-infected mice compared to control mice after 5 days (Liu et al., 2014) (Zhou et al., 2017). Here, IFN-γ production was also significantly increased in the RSV group but was significantly reduced after intranasal administration of andrographolide sulfonate. These results suggest that andrographolide sulfonate can inhibit airway inflammation caused by RSV infection in mice. Atomization inhalation of budesonide is effective in treating children with asthmatic pneumonia, and can improve immune function and reduce inflammatory cytokine levels (Duan et al., 2021). Inhalation of salvianolic acid B (SAB) solution exerts antifibrotic and anticoagulant effects by preventing the expression of proteinase activated receptor(PAR-1) and phosphorylation of protein kinase C (PKC) (Zhang et al., 2021a). Thus, aerosol inhalation of TCM may be a good choice for suppressing airway inflammation.

The synthesis of RSV is completely dependent on the N, P, and L proteins. RNA synthesis is enhanced when the N plasmid is present in the same amount as or more than the P plasmid (Grosfeld et al., 1995). The previous data of our group showed that the replication of the RSV-N gene and quantitative plaque assay have the same trend after RSV infection(Chen et al., 2019). In our experiment, RSV N gene expression was lower after treatment with andrographolide sulfonate. Andrographolide sulfonate administration exhibited an antiviral effect, consistent with previous research (Yang et al., 2019) (Li et al., 2018) (Zhang et al., 2021b). Viral-induced inflammation is a possible driver of many lung diseases, and therefore it is important to determine the relationships between viral infection and the development of lung disease. We found that the RSV N gene was positively correlated with lung inflammation. Early response and viral clearance are important for determining long-term disease processes (Lawley et al., 2022). Therefore, we speculate that andrographolide sulfonate may exert an anti-inflammatory effect by reducing viral replication of RSV. Rudd (Rudd et al., 2005) reported that TLR3 did not affect viral replication, since equivalent viral loads were recovered from RSV-infected cells despite altered TLR3 expression. However, this conclusion was only made in epithelial cells, and the mechanism of the virus in animals is more complex and may require further study.

There are reports indicate a critical cooperation of the RIG-I/MDA5-type I IFN and the TLR3-type II IFN signaling axes for efficient innate antiviral immune responses, and the TLR3-type II IFN pathway has evolved to recognize and respond to classes of viruses (Negishi et al., 2008). TLR3-mediated IFN-γ but not type-I IFN signaling is required for protection against coxsackievirus group B serotype 3 infection. In the current study, we detected significantly higher TLR3 expression levels at 5 days after RSV infection compared with the controls (Zang et al., 2011). Our research group also previously reported that TRIF expression is increased after RSV infection (Liu et al., 2014). In the current mouse model, we found that intranasal administration of andrographolide sulfonate reduced TRIF expression after RSV infection. These results are consistent with previous studies showing that TLR3 and TLR4 signals activate the adaptor protein TRIF after RSV infection (Zang et al., 2011) (Liu et al., 2014) and andrographolide modulates the TLR TRIF-dependent pathway by targeting TBK1, thus representing a potential new anti-inflammatory candidate (Kim et al., 2018). Here, IFN-γ expression was higher in the RSV group but declined after andrographolide sulfonate application.

In conclusion, we showed that intranasal administration of andrographolide sulfonate can reduce inflammation in RSV-infected mice through TLR3-TRIF. We speculate that, as a direct method of administration to target the lungs with less systemic side effects, aerosol inhalation of andrographolide sulfonate may be a better treatment for virus respiratory diseases. These findings may help elucidate the underlying pathology of RSV infection and suggest potential therapeutic targets for drug development and prevention of RSV-induced diseases.

In our experiment, there are the following limitations: Only animal experiments were considered in the design of the experiment, and cell experiments were not included. The use of drugs earlier after RSV infection, but in clinical practice, intervention may not be so timely. However, there was no guarantee of when to intervene in the actual situation, so we used this ideal intervention method.

Yin Liu is employed by Jiangxi Qingfeng Pharmaceutical Co., Ltd. (China). The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. The authors declare no other conflicts of interest.

Acknowledgments

This work was supported by the Chongqing Natural Science Foundation Project (CSTB2022NSCQ-MSX0129) and the Open Project of the State Key Laboratory of Innovative Natural Medicine and TCM Injections (QFSKL2020020).

Ethical approval

This study was approved by the Ethics Committee of Chongqing Medical University of Medical Sciences, and the experiments were performed according to the guidelines provided by the Chinese Council on Animal Care (license numbers SCXK[Yu] 2012-0001 and SYXK[Yu] 2012-0001).

Credit author statement

All authors contributed to the study conception and design. Zhou Na performed the experiments and data analysis and drafted the manuscript. Xie Jun critically revised the manuscript. All authors read and approved the final manuscript.

Burgos, R.A., Alarcon, P., Quiroga, J., Manosalva, C., Hancke, J., 2020. Andrographolide, an Anti-Inflammatory Multitarget Drug: All Roads Lead to Cellular Metabolism. Molecules 26.
Chen, S., Yu, G., Xie, J., Tang, W., Gao, L., Long, X., Ren, L., Xie, X., Deng, Y., Fu, Z., Liu, E., 2019. High-mobility group box-1 protein from CC10 club cells promotes type 2 response in the later stage of respiratory syncytial virus infection. American journal of physiology. Lung cellular and molecular physiology 316, L280-L290.
Cui, J., Gao, J., Li, Y., Fan, T., Qu, J., Sun, Y., Liu, W., Guo, W., Xu, Q., 2020. Andrographolide sulfate inhibited NF-kappaB activation and alleviated pneumonia induced by poly I:C in mice. J Pharmacol Sci 144, 189-196.
Duan, Y., Zhou, H., Chen, J., 2021. The effects of the atomization inhalation of budesonide, salbutamol, and ipratropium bromide on the T-lymphocyte subset and inflammatory cytokine levels in children with asthmatic pneumonia. Am J Transl Res 13, 10517-10526.
Feng, W., Chen, H., Lu, Y., Liu, R., Yuan, M.Y., An, J., Li, M., Chua, L.S., Kait, J.A., Xin, L., 2022. Comparing the efficacy and safety of atomization of traditional Chinese medicine Kai Hou Jian and budesonide suspension in adult acute laryngitis: a randomized control trial. Ann Transl Med 10, 1019.
Fu, K., Chen, H., Wang, Z., Cao, R., 2021. Andrographolide attenuates inflammatory response induced by LPS via activating Nrf2 signaling pathway in bovine endometrial epithelial cells. Res Vet Sci 134, 36-41.
Gong, R., Wu, J., Jin, Y., Chen, T., 2021. STAT3Defective Toll-Like Receptors Driven B Cell Response in Hyper IgE Syndrome Patients With Mutations. Frontiers in pediatrics 9, 738799.
Grosfeld, H., Hill, M.G., Collins, P.L., 1995. RNA replication by respiratory syncytial virus (RSV) is directed by the N, P, and L proteins; transcription also occurs under these conditions but requires RSV superinfection for efficient synthesis of full-length mRNA. J Virol 69, 5677-5686.
Kim, A.Y., Shim, H.J., Shin, H.M., Lee, Y.J., Nam, H., Kim, S.Y., Youn, H.S., 2018. Andrographolide suppresses TRIF-dependent signaling of toll-like receptors by targeting TBK1. Int Immunopharmacol 57, 172-180.
Kong, X., Hellermann, G.R., Patton, G., Kumar, M., Behera, A., Randall, T.S., Zhang, J., Lockey, R.F., Mohapatra, S.S., 2005. An immunocompromised BALB/c mouse model for respiratory syncytial virus infection. Virol J 2, 3.
Lawley, K.S., Rech, R.R., Perez Gomez, A.A., Hopkins, L., Han, G., Amstalden, K., Welsh, C.J., Young, C.R., Jones-Hall, Y., Threadgill, D.W., Brinkmeyer-Langford, C.L., 2022. Viral Clearance and Neuroinflammation in Acute TMEV Infection Vary by Host Genetic Background. Int J Mol Sci 23.
Li, M., Yang, X., Guan, C., Wen, T., Duan, Y., Zhang, W., Li, X., Wang, Y., Zhao, Z., Liu, S., 2018. Andrographolide sulfonate reduces mortality in Enterovirus 71 infected mice by modulating immunity. Int Immunopharmacol 55, 142-150.
Li, Y., Hodgson, D., Wang, X., Atkins, K.E., Feikin, D.R., Nair, H., 2021a. Respiratory syncytial virus seasonality and prevention strategy planning for passive immunisation of infants in low-income and middle-income countries: a modelling study. Lancet Infect Dis 21, 1303-1312.
Li, Y., Johnson, E.K., Shi, T., Campbell, H., Chaves, S.S., Commaille-Chapus, C., Dighero, I., James, S.L., Mahe, C., Ooi, Y., Paget, J., van Pomeren, T., Viboud, C., Nair, H., 2021b. National burden estimates of hospitalisations for acute lower respiratory infections due to respiratory syncytial virus in young children in 2019 among 58 countries: a modelling study. Lancet Respir Med 9, 175-185.
Liu, T., Zang, N., Zhou, N., Li, W., Xie, X., Deng, Y., Ren, L., Long, X., Li, S., Zhou, L., Zhao, X., Tu, W., Wang, L., Tan, B., Liu, E., 2014. Resveratrol inhibits the TRIF-dependent pathway by upregulating sterile alpha and armadillo motif protein, contributing to anti-inflammatory effects after respiratory syncytial virus infection. J Virol 88, 4229-4236.
Minagawa, A., Omodaka, T., Okuyama, R., 2016. Melanomas and Mechanical Stress Points on the Plantar Surface of the Foot. N Engl J Med 374, 2404-2406.
Nair, H., Nokes, D.J., Gessner, B.D., Dherani, M., Madhi, S.A., Singleton, R.J., O'Brien, K.L., Roca, A., Wright, P.F., Bruce, N., Chandran, A., Theodoratou, E., Sutanto, A., Sedyaningsih, E.R., Ngama, M., Munywoki, P.K., Kartasasmita, C., Simões, E.A.F., Rudan, I., Weber, M.W., Campbell, H., 2010. Global burden of acute lower respiratory infections due to respiratory syncytial virus in young children: a systematic review and meta-analysis. The Lancet 375, 1545-1555.
Negishi, H., Osawa, T., Ogami, K., Ouyang, X., Sakaguchi, S., Koshiba, R., Yanai, H., Seko, Y., Shitara, H., Bishop, K., Yonekawa, H., Tamura, T., Kaisho, T., Taya, C., Taniguchi, T., Honda, K., 2008. A critical link between Toll-like receptor 3 and type II interferon signaling pathways in antiviral innate immunity. Proc Natl Acad Sci U S A 105, 20446-20451.
Peebles RS, J.R.S., Robert D. Collins, A. Kasia, Jarzecka DBM, Robert A. Parker, and Barney S.Graham., 2001. Respiratory syncytial virus infection does not increase allergen-induced type 2 cytokine production, yet increases airway hyperresponsiveness in mice. . Journal of Medical Virology 63(2):178–188., 10.
Rudd, B.D., Burstein, E., Duckett, C.S., Li, X., Lukacs, N.W., 2005. Differential role for TLR3 in respiratory syncytial virus-induced chemokine expression. J Virol 79, 3350-3357.
Shi, T., McAllister, D.A., O'Brien, K.L., Simoes, E.A.F., Madhi, S.A., Gessner, B.D., Polack, F.P., Balsells, E., Acacio, S., Aguayo, C., Alassani, I., Ali, A., Antonio, M., Awasthi, S., Awori, J.O., Azziz-Baumgartner, E., Baggett, H.C., Baillie, V.L., Balmaseda, A., Barahona, A., Basnet, S., Bassat, Q., Basualdo, W., Bigogo, G., Bont, L., Breiman, R.F., Brooks, W.A., Broor, S., Bruce, N., Bruden, D., Buchy, P., Campbell, S., Carosone-Link, P., Chadha, M., Chipeta, J., Chou, M., Clara, W., Cohen, C., de Cuellar, E., Dang, D.-A., Dash-yandag, B., Deloria-Knoll, M., Dherani, M., Eap, T., Ebruke, B.E., Echavarria, M., de Freitas Lázaro Emediato, C.C., Fasce, R.A., Feikin, D.R., Feng, L., Gentile, A., Gordon, A., Goswami, D., Goyet, S., Groome, M., Halasa, N., Hirve, S., Homaira, N., Howie, S.R.C., Jara, J., Jroundi, I., Kartasasmita, C.B., Khuri-Bulos, N., Kotloff, K.L., Krishnan, A., Libster, R., Lopez, O., Lucero, M.G., Lucion, F., Lupisan, S.P., Marcone, D.N., McCracken, J.P., Mejia, M., Moisi, J.C., Montgomery, J.M., Moore, D.P., Moraleda, C., Moyes, J., Munywoki, P., Mutyara, K., Nicol, M.P., Nokes, D.J., Nymadawa, P., da Costa Oliveira, M.T., Oshitani, H., Pandey, N., Paranhos-Baccalà, G., Phillips, L.N., Picot, V.S., Rahman, M., Rakoto-Andrianarivelo, M., Rasmussen, Z.A., Rath, B.A., Robinson, A., Romero, C., Russomando, G., Salimi, V., Sawatwong, P., Scheltema, N., Schweiger, B., Scott, J.A.G., Seidenberg, P., Shen, K., Singleton, R., Sotomayor, V., Strand, T.A., Sutanto, A., Sylla, M., Tapia, M.D., Thamthitiwat, S., Thomas, E.D., Tokarz, R., Turner, C., Venter, M., Waicharoen, S., Wang, J., Watthanaworawit, W., Yoshida, L.-M., Yu, H., Zar, H.J., Campbell, H., Nair, H., 2017. Global, regional, and national disease burden estimates of acute lower respiratory infections due to respiratory syncytial virus in young children in 2015: a systematic review and modelling study. The Lancet 390, 946-958.
Takeda, K., Kaisho, T., Akira, S., 2003. Toll-like receptors. Annu Rev Immunol 21, 335-376.
Wang, W., Liu, Y., Pan, P., Huang, Y., Chen, T., Yuan, T., Ma, Y., Han, G., Li, J., Jin, Y., Xie, F., 2022. βPulmonary delivery of resveratrol--cyclodextrin inclusion complexes for the prevention of zinc chloride smoke-induced acute lung injury. Drug delivery 29, 1122-1131.
Xie, J., Long, X., Gao, L., Chen, S., Zhao, K., Li, W., Zhou, N., Zang, N., Deng, Y., Ren, L., Wang, L., Luo, Z., Tu, W., Zhao, X., Fu, Z., Xie, X., Liu, E., 2017. Respiratory Syncytial Virus Nonstructural Protein 1 Blocks Glucocorticoid Receptor Nuclear Translocation by Targeting IPO13 and May Account for Glucocorticoid Insensitivity. The Journal of infectious diseases 217, 35-46.
Xu, Y., Tang, D., Wang, J., Wei, H., Gao, J., 2019. Neuroprotection of Andrographolide Against Microglia-Mediated Inflammatory Injury and Oxidative Damage in PC12 Neurons. Neurochem Res 44, 2619-2630.
Yang, Q.W., Li, Q., Zhang, J., Xu, Q., Yang, X., Li, Z.Y., Xu, H., 2019. Crystal structure and anti-inflammatory and anaphylactic effects of andrographlide sulphonate E in Xiyanping, a traditional Chinese medicine injection. J Pharm Pharmacol 71, 251-259.
Zang, N., Li, S., Li, W., Xie, X., Ren, L., Long, X., Xie, J., Deng, Y., Fu, Z., Xu, F., Liu, E., 2015. Resveratrol suppresses persistent airway inflammation and hyperresponsivess might partially via nerve growth factor in respiratory syncytial virus-infected mice. Int Immunopharmacol 28, 121-128.
Zang, N., Xie, X., Deng, Y., Wu, S., Wang, L., Peng, C., Li, S., Ni, K., Luo, Y., Liu, E., 2011. Resveratrol-mediated gamma interferon reduction prevents airway inflammation and airway hyperresponsiveness in respiratory syncytial virus-infected immunocompromised mice. J Virol 85, 13061-13068.
Zhang, T., Liu, M., Gao, Y., Li, H., Song, L., Hou, H., Chen, T., Ma, L., Zhang, G., Ye, Z., 2021a. Salvianolic acid B inhalation solution enhances antifibrotic and anticoagulant effects in a rat model of pulmonary fibrosis. Biomed Pharmacother 138, 111475.
Zhang, X.Y., Lv, L., Zhou, Y.L., Xie, L.D., Xu, Q., Zou, X.F., Ding, Y., Tian, J., Fan, J.L., Fan, H.W., Yang, Y.X., Ye, X.Q., 2021b. Efficacy and safety of Xiyanping injection in the treatment of COVID-19: A multicenter, prospective, open-label and randomized controlled trial. Phytother Res 35, 4401-4410.
Zheng, D., Shao, J., Chen, W., Luo, Y., 2016. In vitro Metabolism of Sodium 9-dehydro-17-hydro-andrographolide-19-yl Sulfate in Rat Liver S9 by Liquid Chromatography-Mass Spectrometry Method. Pharmacognosy magazine 12, S102-108.
Zhou, N., Li, W., Ren, L., Xie, X., Liu, E., 2017. An Interaction of LPS and RSV Infection in Augmenting the AHR and Airway Inflammation in Mice. Inflammation 40, 1643-1653.

renamedbeebf.tif

Download PDF

Editorial decision: Major revisions
02 Jun, 2023
Reviewers agreed at journal
11 May, 2023
Reviewers invited by journal
08 May, 2023
Editor assigned by journal
03 May, 2023
First submitted to journal
01 May, 2023

You are reading this latest preprint version

Traditional Chinese medicine andrographolide sulfonate alleviates airway inflammation by supressing TRL3-TRIF in mice post respiratory syncytial virus infection

Status:

Version 1

Abstract

Figures

Introduction

Methods

Cell culture, virus, and infection

Animals

RSV infection and andrographolide sulfonate treatment

Lung histology

Bronchoalveolar lavage fluid (BALF) analysis

Measurement of inflammatory mediators in BALF

Quantitative real-time polymerase chain reaction (qRT-PCR)

Immunoblotting

Statistical analysis

Results

Intranasal administration of XYP reduces RSV N gene expression

RSV N gene is positively correlated with lung inflammation

Intranasal administration of XYP suppresses TLR3 and TRIF expression

Discussion

Declarations

References

Supplementary Files

Status:

Version 1