The splicing factor SRSF6 regulates AR activity and represents a potential therapeutic target in prostate cancer

doi:10.21203/rs.3.rs-2885147/v1

Download PDF

Research Article

The splicing factor SRSF6 regulates AR activity and represents a potential therapeutic target in prostate cancer

https://doi.org/10.21203/rs.3.rs-2885147/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background

Prostate cancer (PCa) is the fifth leading cause of cancer-related death worldwide. Finding novel therapeutic strategies to tackle PCa, especially its most advanced phenotype, named castration-resistant PCa (CRPC), is urgently needed. In this sense, although the dysregulation of the splicing process has emerged as a distinctive feature of advanced PCa, the potential role that splicing regulators may play in advanced PCa remains understudied. In this project, we aimed to explore the levels, pathophysiological role, and associated molecular landscape of the splicing factor SRSF6 in PCa.

Methods

SRSF6 alterations (CNA/mRNA/protein) were analyzed in eight well-characterized cohorts of PCa patients and in the Hi-MYC transgenic model. The effect of SRSF6 overexpression and silencing was tested in vitro (cell proliferation, migration, colony and tumorspheres formation), and in vivo (xenograft tumors). RNA-Seq was performed in PCa cells to analyze gene expression and splicing pattern changes in response to SRSF6 silencing.

Results

Our results showed that SRSF6 levels (mRNA/protein) were upregulated in PCa vs. non-tumor prostate samples, linked to clinical parameters of tumor aggressiveness (e.g., Gleason score, T-stage, perineural infiltration, metastasis at diagnosis), and associated with poor prognosis (i.e., shorter progression-free survival time) in PCa patients. Moreover, SRSF6 overexpression increased, while its silencing decreased, relevant functional parameters of aggressiveness in vitro and tumor growth in vivo. Mechanistically, SRSF6 modulation resulted in the dysregulation of key oncogenic pathways, especially AR-activity through transcriptional regulation of APPBP2 and TOP2B

Conclusions

SRSF6 could represent a new therapeutic target to inhibit persistent AR-signaling in advanced PCa.

SRSF6

therapeutic target

splicing factor

prostate cancer

Prostate cancer (PCa) is one of the most diagnosed cancer types worldwide and represents the fifth leading cause of cancer-related death worldwide (1). The main therapeutic approach to tackle PCa consists of targeting the androgen receptor (AR) signaling, initially by using the so-called androgen deprivation therapy (ADT), followed by second-generation antiandrogens such as enzalutamide or abiraterone (2). Unfortunately, advanced PCa will eventually become resistant to AR blockade mainly due to aberrations driving AR-persistent signaling, such as AR-amplification, AR truncated variants, AR mutations, and/or dysregulation of AR coregulators (2, 3). Although many efforts have been put into blocking AR-persistent signaling, to date there are not clinically available therapeutic strategies for that purpose. Therefore, discovering new therapeutic targets that could be exploited to uncover novel strategies to target AR-persistent pathway in advanced PCa represents a clinical unmet need. In this scenario, it has been suggested that the dysregulation of the splicing process represents an intrinsic characteristic of PCa inasmuch as a broad number of splicing variants (SVs) are altered in any stage of the disease, which can act as drivers of PCa progression, and/or modulate the expression, function or activity of key oncogenes and tumor-suppressor genes (4). Indeed, we and others have also recently shown that the components of the cellular machinery that catalyzes and regulates the splicing process [i.e., spliceosome components (SCs) and splicing factors (SFs)] are deeply dysregulated in PCa and can control pivotal PCa-related pathways, including AR activity (5–9).

In this sense, one important family of RNA processing factors is the serine/arginine-rich splicing factor (SR) family. The SR family of proteins is characterized by containing one or two RNA recognition motifs (RRM) at the N-terminus, and a domain rich in arginine and serine (RS) dipeptide repeats at the C-terminus. RS domains are frequently found in proteins involved in pre-mRNA splicing and mediate protein–protein interactions (10, 11). Among the SR family members, SRSF6 stands up due to its relationship with relevant diseases, including pleural fibrosis (12), Huntington’s disease (13), Alzheimer’s disease (14), diabetes (15), and systemic sclerosis (16) as well as different cancer types such as breast cancer (17), melanoma (18), lung (19), and colorectal cancer (19, 20). Despite the connection between SRSF6 and the oncogenic transformation and tumor-progression in the abovementioned cancer-types, there are not reports addressing the potential role that SRSF6 might play in PCa. For that reason, in this study we aimed to characterize the levels of SRSF6 in PCa, its pathophysiological function and molecular consequences of modulating (overexpression and silencing) its levels both on in vitro and in vivo PCa models, as well its potential role as diagnostic biomarker and therapeutic target in this disease.

Human samples

Our study analyzed three different cohorts of prostate samples:

- Cohort 1: Consisting of formalin-fixed, paraffin-embedded (FFPE) PCa tissues (n = 84) and their corresponding non-tumor adjacent regions (N-TAR; used as control tissues; n = 84), collected from patients diagnosed with clinically localized PCa who underwent radical prostatectomies (patients’ clinical data are summarized in Table 1). The presence or absence of tumors was established by histologically examining hematoxylin/eosin-stained tissue by an expert clinical pathologist.

Table 1

Demographic, biochemical and clinical parameters of PCa patients from cohort 1.
Patients [n]	84
Age, years [median (IQR)]	61 (57–66)
PSA levels, ng/mL [median (IQR)]	5.2 (4.2-8.0)
Gleason score ≥ 7 [n (%)]	76 (90.5%)
pT ≥ 3a [n (%)]	59 (70.2%)
Perineural infiltration [n (%)]	72 (85.7%)
Lymphovascular invasion [n (%)]	8 (9.52%)
Recurrence [n (%)]	35 (41.7%)
Metastasis [n (%)]	0 (0%)

PSA: Prostate specific antigen; pT: Pathological tumor staging.

- Cohort 2: Comprising fresh samples procured through (1) core needle biopsies from patients with significant PCa (n = 42; patients’ clinical data are summarized in Table 2) and (2) cystoprostatectomies from patients without PCa (n = 9; used as control tissues; patients’ clinical data are summarized in Table 2). The presence or absence of tumors was histologically confirmed by uro-pathologists.

Table 2

Demographic, biochemical and clinical parameters of PCa patients from cohort 2.
Control (non-prostate cancer)
Patients [n]	9
Age, years [median (IQR)]	67 (51–83)
Prostate cancer
Patients [n]	42
Age, years [median (IQR)]	75 (69–81)
PSA levels, ng/mL [median (IQR)]	62.0 (36.2-254.5)
Gleason score ≥ 7 [n (%)]	42 (100%)
Metastasis [n (%)]	28 (66.7%)

PSA: Prostate specific antigen.

- Cohort 3: Used for immunohistochemistry (IHC) analysis, consisting of tissue samples from benign prostatic hyperplasia (n = 4), and PCa (n = 10; a representative set of samples from cohort 2).

We gathered various clinical parameters from each patient, including the Gleason score (evaluated by uro-pathologists according to the modified 2014 ISUP criteria), T-Stage, perineural invasion, lymphovascular invasion, and the presence of metastases at the time of diagnosis (identified by computed tomography and bone scan).

In addition, SRSF6 mRNA levels were examined in The Cancer Genome Atlas (TCGA; n = 104) (21), Stand Up to Cancer/Prostate Cancer Foundation (SU2C; n = 266) (22), Memorial Sloan Kettering Cancer Center (MSKCC; n = 149) (23), Grasso (n = 88) (24), and Roudier (GSE74367; n = 56) (25) cohorts. Gene expression and genomic data were obtained from cBioPortal (26, 27) and Gene Expression Omnibus (GEO) (28) repositories. Copy Number Alteration (CNA) data were obtained from cBioPortal and generated by GISTIC 2.0 algorithm (29, 30). Samples with a GISTIC score higher or lower than default threshold for copy number amplification and deletion (± 0.1, respectively), were considered as amplified/gain or shallow/deep deletion, respectively. Otherwise, samples were considered as diploid.

Cell culture and reagents

Cell lines derived from normal prostate epithelium (RWPE-1) and PCa (LNCaP, 22Rv1, DU145, and PC-3) were obtained from the American Type Culture Collection (ATCC) and cultured in a humidified incubator with 5% CO₂ at 37°C following manufacturer’s recommendations. Cell line identity was validated by short tandem repeats sequences (STRs) analysis. All cell lines were tested for mycoplasma contamination by PCR, as previously reported (31). DMSO (A3672, PanReac AppliChem), enzalutamide (S1250, Selleckchem), dihydrotestosterone (DHT, D-073, Sigma-Aldrich), and R1881 (R0908, Sigma-Aldrich) were used to perform molecular assays (see AR activity and AR modulation section).

Preclinical models of PCa

To evaluate in vivo tumor growth in response to SRSF6 overexpression, ten-week-old male athymic BALB/cAnNRj-Foxn1nu mice (Janvier Labs) were subcutaneously grafted in both flanks with 100 µL of basement membrane extract (Trevigen) and RPMI 1640 complemented with 10% Fetal Bovine Serum (FBS, F7524, Sigma-Aldrich) (1:1 ratio) containing 3×10⁶ viable mock-transfected [empty pcDNA3.1 plasmid (GenScript); n = 5 mice; n = 10 tumors] or SRSF6-stably transfected [SRSF6-pcDNA3.1 plasmid (OHu19224, GenScript); n = 5 mice; n = 10 tumors] PC-3 cells. Tumor growth was monitored once per week for two months using a digital caliper.

To evaluate in vivo tumor growth in response to SRSF6 silencing, ten-week-old male athymic BALB/cAnNRj-Foxn1nu mice were subcutaneously grafted in both flanks with 3×10⁶ viable naïve 22Rv1 cells (n = 5 mice; n = 10 tumors) that were resuspended in 100 µL of basement membrane extract and RPMI 1640 complemented with 10% FBS (1:1 ratio). Once the tumors reached 100 mm³, each flank was transfected with scramble-control (AM4611, ThermoFisher Scientific) or SRSF6-targeting siRNA (siSRSF6; s12740, ThermoFisher Scientific) by using AteloGene reagent (Koken), following manufacturer’s recommendations.

In both cases, animals were euthanized, and each tumor was processed and divided in specular fragments for formalin-fixation followed by paraffin inclusion, and to store at -80°C for later RNA extraction using TRIzol reagent (ThermoFisher Scientific).

Additionally, we used the Hi-Myc (ARR2/Pbsn-Myc) mouse strain maintained in an FVB background (32) which was obtained originally from National Cancer Institute (NCI) and backcrossed to C57BL/6 for more than seven generations at Dr. Olmos lab to obtain pure genetic background. Hi-Myc mice were euthanized at four (no presence of tumor), six–eight (predominantly PIN) and 12–15 months (predominately invasive carcinoma). Genotyping was performed in genomic DNA extracted from the tail vein blood by PCR by using the primers recommended by NCI′ (sense: AAACATGATGACTACCAAGCTTGGC; antisense: ATGATAGCATCTTGTTCTT AGTCTTTTTCTTAATAGGG). For western blot analyses, a chunk from the prostate tissue was snap frozen and kept in liquid nitrogen. For immunohistological analyses, a chunk from the prostate tissues was processed for formalin-fixation followed by paraffin inclusion.

RNA extraction, retrotranscription, and real-time quantitative PCR (qPCR)

RNA was isolated from FFPE samples, fresh tissues, and cell lines using previously reported methods (5, 7). To isolate RNA from FFPE samples, the Maxwell 16 LEVRNA FFPE Kit (Promega) was used with the Maxwell MDx 16 Instrument (Promega). RNA was isolated from fresh tissues and PCa cell lines using the AllPrep DNA/RNA/Protein Mini Kit (Qiagen) and TRIzol Reagent, respectively. The RNA was treated with RNase-Free DNase Kit (Qiagen) to remove DNA. The Nanodrop One Spectrophotometer (ThermoFisher Scientific) was used to determine the total RNA concentration and purity. cDNA was synthesized from total RNA using the cDNA First Strand Synthesis kit (ThermoFisher Scientific) and random hexamer primers. Real-time qPCR was performed using the Stratagene Mx3000p device with the Brilliant III SYBR Green Master Mix (Stratagene, La Jolla, CA) as previously described (33), and normalization was done using a normalization factor calculated with GeNorm 3.3 software (34) using ACTB and GAPDH expression levels. The primers used in this study can be found in Supplemental Table 1. No differences were observed in ACTB and GAPDH expression levels between experimental groups (data not shown).

SRSF6 overexpression and silencing on in vitro prostate cell models

RWPE-1, 22Rv1, and PC-3 cells were transfected with empty pcDNA3.1 (mock) or SRSF6-pcDNA3.1 plasmid as previously reported (7). Experiments were performed with 1 µg of plasmid using Lipofectamine 2000 reagent (ThermoFisher Scientific) and medium supplemented with 1% Geneticin (ThermoFisher Scientific) was used to obtain stably transfected cells. In addition, LNCaP, 22Rv1, DU145, and PC-3 cells were transfected with scramble (AM4611, ThermoFisher Scientific) or SRSF6 siRNA (siSRSF6) at 100 nM using Lipofectamine RNAiMAX reagent (ThermoFisher Scientific) for 48 h following manufacturers’ indications.

Antibody validation

SRSF6 antibody was orthogonally validated by Western blot and IHC using whole-cell lysate and cell pellets from 22Rv1 cells (n = 3) treated with scramble and SRSF6 siRNA at a final concentration of 100 nM, during 72 h.

Western blot

SRSF6 protein levels were measured by western blot as previously reported (5). Briefly, proteins were isolated using RIPA buffer (ThermoFisher Scientific) supplemented with Pierce Protease and Phosphatase inhibitors (ThermoFisher Scientific). Then, proteins were sonicated and separated by SDS-PAGE (any kD Mini-Protean TGX gels, Bio-Rad), and then transferred to Immun-Blot PVDF Membranes (Bio-Rad). Membranes were blocked with 5% non-fat dry milk in Tris-buffered saline/0.05% Tween 20 (Sigma-Aldrich) and incubated overnight with the specific antibodies for SRSF6 (ab140623, Abcam) at 1:1000 or GAPDH (sc-32233, Santa Cruz Biotechnology) at 1:1000, and then with the secondary antibody HRP-conjugated anti-rabbit IgG (7074, Cell Signaling Technologies) or anti-mouse IgG (7076, Cell Signaling Technologies), both at 1:2000. Proteins were detected using an enhanced chemiluminescence detection system (Bio-Rad). A densitometry analysis of the bands obtained was carried out with ImageJ software. GAPDH protein levels were used to normalized SRSF6 protein levels.

Immunohistochemistry

IHC analysis was performed on samples from Cohort 3, and from the Hi-Myc mice (control and PCa samples, n = 3 per group). Briefly, deparaffinized sections were incubated overnight (4°C) with the anti-SRSF6 antibody at 1:100 dilution, followed by incubation with an anti-rabbit horseradish peroxidase-conjugated secondary antibody. Finally, sections were developed with 3,3-diaminobenzidine (EnVision system, Agilent), and contrasted with haematoxylin. 22Rv1 cell pellets (scramble and siSRSF6) were used to evaluate antibody specificity. Nuclear H-score was calculated as the sum of the percentage of stained nuclei with low, moderate, and high intensity following a blinded protocol as described elsewhere (8).

Cell proliferation and migration

Cell growth was examined by Resazurin assay (CA035, Canvax Biotech) following manufacturer’s instructions, as previously described (5, 7). Cell migration was determined by wound healing assay as described elsewhere (5, 7). Briefly, cells were plated and, once the cell-confluence was reached, serum-starved overnight. Then, a scratch was made, wells were washed with PBS and cells were incubated with no serum media. Images were taken immediately after scratching and after 16 h of incubation. Migration was calculated as the area observed 16 h after the wound was made vs. the area observed just after wounding, using ImageJ software.

Colonies and tumorspheres formation

To evaluate clonogenic capacity, 6-well plates were seeded with 2,000 cells per well and incubated for seven days. Colonies were then fixed and stained with a solution containing 6% glutaraldehyde and 1% crystal violet for 30 minutes, followed by air-drying. Tumorsphere formation was assessed using Corning Costar 24-well ultra-low attachment plates (CLS3473, Sigma-Aldrich), with 2,000 cells per well in DMEM-F12 medium supplemented with 20 ng/mL EGF (Sigma-Aldrich) and refreshed every three days. The number and size of colonies and tumorspheres were analyzed after 14 days using ImageJ software (Fiji plugins) (35).

RNA-Seq

RNeasy Plus Mini kit (Qiagen) was used to isolate high-quality RNA from siSRSF6 (n = 3) and scramble (n = 3) 22Rv1 cells. The integrity of total RNA was assessed using the 2100 Bioanalyzer (Agilent). RNA-Seq was performed at the Genomics Core Unit of The National Centre for Cancer Research (CNIO, Madrid, Spain) as previously reported (7). Differential gene expression analysis was performed using DESeq2 (36) as described elsewhere (37). Alternative splicing analysis was performed using SUPPA2 (38). Briefly, transcript per million (TPM) derived from Salmon tool were used to quantify alternative splicing events as Percent Spliced In (PSI). The differential PSI (dPSI) and its associated p-value was calculated for all the splicing events. Splicing events with p < 0.1 when comparing siSRSF6 vs. scramble 22Rv1 samples were considered as statistically different.

AR-Score and AR activity modulation

AR signaling activity (AR-Score) was determined as a sum of the ranked expression levels of eight canonical AR-regulated genes (ACSL3, FKBP5, KLK2, KLK3, NKX3-1, PLPP1, RAB3B, STEAP1) as previously described (39, 40).

To evaluate SRSF6 expression in response to AR modulation, LNCaP cells were cultured for 3 days in RPMI 1640 supplemented with 10% FBS or 10% Charcoal Stripped Serum (CSS, 12676029, ThermoFisher Scientific) and treated with DMSO (vehicle), enzalutamide (1 µM), DHT (10 nM), or R1881 (1 nM) for 24 h. Then, TRIzol Reagent was added to wells and RNA was extracted following manufacturer’s instructions.

Bioinformatic and statistical data analysis

At least three independent experiments were performed for all analyses (n ≥ 3). Statistical differences between two groups were calculated using unpaired parametric t-test and non-parametric Mann Whitney U-test, depending on normality, which was assessed by Kolmogorov-Smirnov test. For differences among three groups, one-Way ANOVA analysis was used. For correlations, Spearman or Pearson coefficients were calculated based on normality of variables. Statistical significance was considered when p < 0.05. A trend for significance was indicated when p values ranged between > 0.05 and < 0.1. All analyses were assessed using GraphPad Prism 8 (GraphPad Software). The heatmap of differentially expressed genes was created using pheatmap R package. Continuous and categorical Gene Set Enrichment Analyses (GSEA) were performed using hallmark gene sets in the SU2C cohort and 22Rv1 cells (siSRSF6 vs. scramble), respectively, using GSEA 4.2.0 software (41, 42).

SRSF6 is overexpressed in prostate cancer

We first interrogated the expression levels of SRSF6 in two independent cohorts (cohort 1 and 2) available in our laboratory comprising PCa and non-tumor prostate tissue samples. The clinical data from these two cohorts are summarized in Table 1 and Table 2. SRSF6 mRNA levels were higher in PCa samples as compared to non-tumor prostate tissue in both cohorts (Fig. 1A). In addition, SRSF6 expression significantly distinguished between PCa and non-tumor prostate samples in both cohorts (Fig. 1B). Consistently, SRSF6 was overexpressed in PCa and its levels distinguished between PCa and non-tumor prostate tissue samples in TCGA (21), MSKCC (23), and Grasso (24) cohorts (Fig. 1C-D). SRSF6 mRNA levels were especially elevated in castration-resistant prostate cancer (CRPC) samples in the Grasso cohort and were significantly higher in CRPC samples compared to primary PCa samples from the Roudier (24) cohort (Fig. 1C). In fact, SRSF6 expression levels perfectly discriminated between primary PCa and CRPC samples in the Roudier cohort (AUC = 1.0, p-value < 0.001; Fig. 1D). Of note, whole transcriptome analyses from TCGA and SU2C cohorts revealed that SRSF6 was among the top 25% of most-expressed transcripts in both primary and CRPC tumors, respectively (Fig. 1E). Then, to investigate putative genomic alterations associated with SRSF6 overexpression in PCa, we explored SRSF6 CNA and its association with SRSF6 mRNA levels in TCGA [primary PCa; (21)] and SU2C [CRPC; (22)] cohorts. Specifically, SRSF6 was amplified in 7.8%, and deep deleted in 2.5% of the PCa tumors from TCGA cohort (Supplemental Fig. 1A). Furthermore, SRSF6 was amplified in 22.6% and deep deleted in 4.3% of the PCa tumors from SU2C cohort (Supplemental Fig. 1B). In both TCGA and SU2C cohorts, SRSF6 CNA exhibited a significant association with SRSF6 mRNA levels (Fig. 1F). Besides that, SRSF6 mRNA levels did not consistently associate with any molecular subtype or common genomic aberration of PCa (Supplemental Fig. 1C-D).

SRSF6 expression levels are associated with clinical and molecular features of tumor aggressiveness

SRSF6 mRNA levels were positively correlated with Gleason score in our cohorts of PCa prostatectomies (Fig. 2A) and biopsies (Fig. 2B). Consistently, PCa samples with high T-Stage (pT > 3a), lymphovascular invasion, or perineural infiltration were associated with high SRSF6 expression levels in our cohort of samples derived from prostatectomies (Fig. 2C-E, respectively). On the same line, when analyzing our higher aggressive cohort of PCa biopsies, we found that patients with high SRSF6 levels tended to be associated with tumors presenting perineural infiltration (Fig. 2F). Moreover, primary PCa tumors from patients presenting high volume metastases at diagnosis had higher SRSF6 expression levels compared to those who presented low volume metastases or those not presenting metastasis at diagnosis (Fig. 2G). Indeed, patients with low SRSF6 expression levels (quartile 1; Q1) showed significantly longer biochemical recurrence-free survival as compared to the rest of the patients in prostatectomies and TCGA cohort (Fig. 2H-I). Aside that, the expression levels of SRSF6 did not associate with T-Stage nor differ between different metastasis sites in TCGA and SU2C, respectively (Supplemental Fig. 2A-B).

Furthermore, we interrogated the biopsies cohort to explore the association of SRSF6 expression levels with molecular parameters of PCa aggressiveness. Specifically, we observed that SRSF6 mRNA levels tended to be directly correlated with those of PCA3, SST₅TMD4, In1-Ghrelin, and ESRP1 (Supplemental Fig. 2C-E and 2H). Finally, no correlation was found between SRSF6 and AR nor ARV7 mRNA levels (Supplemental Fig. 2F-G).

SRSF6 protein levels are elevated in prostate cancer

To study the protein levels of SRSF6 in PCa we first validated the abcam SRSF6 antibody (ab140623). SRSF6 signal and staining decreased in response to SRSF6-siRNA by Western blot and IHC, respectively (Fig. 3A). Then, we analyzed a representative number of samples, including BPH (n = 4) and PCa (n = 10) tissues from cohort 3, and observed that SRSF6 protein levels were significantly higher in PCa as compared to BPH samples (Fig. 3B-C), and distinguished between both groups (AUC = 0.85, p = 0.048; Fig. 3D). Furthermore, when analyzing samples derived from the Hi-MYC transgenic mouse model, we found that SRSF6 protein levels were higher in PCa compared to non-tumor prostate tissue samples (Fig. 3E-F), and perfectly discriminated between the two groups (AUC = 1.0, p = 0.049; Fig. 3G).

Modulation of SRSF6 expression alters aggressiveness of prostate cancer cells in vitro

We found that SRSF6 is overexpressed in all the PCa cell lines analyzed herein (i.e., LNCaP, 22RV1, DU145, and PC-3) compared to the non-tumor prostate-derived cell line RWPE-1 (Fig. 4A), being its expression markedly pronounced in LNCaP and 22Rv1. Based on these data, we tested if the modulation in the expression of SRSF6 could alter aggressiveness parameters in these prostate-derived cell models. In vitro SRSF6 overexpression increased proliferation rate at 48- and 72 h in RWPE-1 and PC-3 cell lines (Fig. 4B; Supplemental Fig. 3). On the other hand, SRSF6 silencing decreased the proliferation rate at 72 h of LNCaP, 22Rv1, DU145, and PC-3 cells (Fig. 4B; Supplemental Fig. 3). Moreover, SRSF6 silencing decreased the number and size of colonies formed by LNCaP, 22Rv1, DU145, and PC-3 (Fig. 4C), and reduced the number and size of tumorspheres formed by LNCaP, 22Rv1, and DU145 cells (Fig. 4D). In addition, SRSF6 silencing decreased the migration rate of DU145 and PC-3 after 16 h (Fig. 4E).

Modulation of SRSF6 expression alters the aggressiveness of prostate cancer cells in vivo

To study the pathophysiological role of SRSF6 in PCa in vivo, we stably overexpressed SRSF6 in PC-3 cells and inoculated them in immunosuppressed mice to follow up the tumor growth (Fig. 5A). SRSF6-overexpressing tumors grew faster, formed larger tumors, and exhibited higher number of mitotic cells compared to control tumors (Fig. 5B-D). As a proof of concept, we explored the effect of SRSF6 silencing in vivo in already formed 22Rv1-derived tumors in immunosuppressed mice (Fig. 5F). Specifically, the silencing of SRSF6 resulted in a significant decrease of tumor growth and volume, as well as in a less proportion of mitosis as compared to control tumors (Fig. 5G-I).

SRSF6 controls a plethora of key oncogenic signaling pathways in PCa cells

To study the potential molecular consequences of SRSF6 alteration, we performed an RNA-Seq in SRSF6-silenced 22Rv1 cells. SRSF6 silencing altered the splicing of 1325 transcripts (Supplemental Data 1). Specifically, Alternative First exon (AF) and exon skipping (SE) were the splicing events more dysregulated in response to SRSF6 silencing in 22Rv1 cells (32.0% and 29.2%, respectively; Fig. 6A). In addition, SRSF6 silencing altered the expression of 240 genes (Fig. 6B-C; Supplemental Data). In order to explore potential molecular redundancies, we analyzed the expression levels of the SR family members in response to SRSF6 silencing and none of them was found to be significantly altered (Supplemental Fig. 4A). To unveil the most relevant pathways associated with SRSF6 silencing in PCa, we interrogated the RNA-Seq data and the SU2C cohort, and found that P53 pathway and apoptosis, among others key antitumor pathways, were enriched in siSRSF6 transfected 22Rv1 cells and in patients with low SRSF6 mRNA levels, while E2F targets, DNA repair and androgen response were enriched in scramble-siRNA transfected 22Rv1 cells and patients with high SRSF6 mRNA expression (Fig. 6D-E).

Moreover, given the relevant role of AR pathway on PCa development and aggressiveness (2), we further explored the potential relation between AR and SRSF6 in PCa. We first found that SRSF6 mRNA levels positively correlated with AR-Score in the SU2C cohort (Fig. 6F). In addition, SRSF6 silencing decreased, while its overexpression increased, AR-Score value, as indicative of AR-activity, in 22Rv1 cells (Fig. 6G; Supplemental Fig. 4B-C). However, SRSF6 silencing did not alter the expression of AR not AR-V7 in 22Rv1 cells (Supplemental Fig. 4D-E). On the other hand, androgen deprivation (i.e., CSS media) increased, while AR stimulation with DHT and R1881 decreased, SRSF6 expression in LNCaP cells (Fig. 6H). To uncover the mechanism by which SRSF6 regulates AR activity, we further interrogate the RNA-Seq performed in response to siSRSF6 in 22Rv1 cells, looking for AR-coregulators (Fig. 6I). The heat shock proteins HSP90AA1, HSPA1B, and HSP90B1, which can act as AR chaperones (43, 44), were upregulated in response to SRSF6 silencing (Fig. 6J). In addition, we identified that TOP2B, an AR positive regulator (45) was downregulated, while APPBP2, a negative AR regulator (46), was upregulated in response to SRSF6 silencing in 22Rv1 cells (Fig. 6J-K).

Splicing process is an adaptative mechanism that allows the cells to increase the flexibility of their transcriptome, therefore playing a key role in tumor evolution and response to treatment (47, 48). Consequently, its dysregulation has emerged as a new key hallmark of cancer development and progression (49). Specifically, our group and others have proven that multiple alternative and aberrant splicing variants emerge in tumor conditions, including PCa (50–52). This altered splicing variant landscape could be a consequence of a marked alteration of the expression levels of spliceosome components and splicing factors in cancer, including PCa (5–8, 53). Interestingly, given the relevance of certain splicing variants in the development, progression, and response to treatment of PCa, splicing regulators play a pivotal role in this pathology (5–9). In this context, the serine/arginine (SR)-rich proteins comprise one of the most relevant families of regulators of the splicing process (10, 11), with many members reported as key factors, such as SRSF1 and SRSF3, have been involved in the progression of several cancer-types, including PCa (5–9). Among the SR family, SRSF6 may represent an important factor based on its involvement in the regulation of several biological processes other than splicing process, such as transcription and protein translation (11, 54, 55).

In this study, we analyzed several PCa cohorts to define the levels of SRSF6 and its potential implication in this disease. We demonstrated for the first time that both mRNA and protein levels of SRSF6 levels are higher in PCa tissue as compared to non-tumor prostate or BPH-derived samples, which is in keeping with previous studies showing that SRSF6 is upregulated in certain tumor types, such as melanoma (18), colorectal (19, 20), lung cancer (19) and glioblastoma (56). Consistent with the upregulation at mRNA and protein level, SRSF6 is amplified in a relevant proportion of patients with mCRPC, from the SU2C cohort but also in low-risk early disease from the TCGA cohort, suggesting that SRSF6 amplification-driven upregulation might be also an early event in PCa tumorigenesis. In line with this hypothesis, the amplification of the SRSF6 locus, 20q13, has been proposed as an early event involved in cancer initiation (57). Furthermore, we also found that SRSF6 amplification is more common in highly aggressive disease, mCRPC samples, indicating that SRSF6 upregulation might be also associated with PCa aggressiveness. Consistently, SRSF6 is associated with aggressiveness parameters such as Gleason score, T-stage, perineural infiltration, lymphovascular invasion, and high-volume metastases, in two different cohorts of patients available in our laboratory.

Moreover, we also found that SRSF6 directly modulate PCa cells aggressiveness at the in vivo and in vitro levels. Specifically, the overexpression of SRSF6 increased, while its silencing decreased, functional parameters of tumor aggressiveness including cell proliferation, cell migration, colony and tumorspheres formation. Therefore, these data suggest that SRSF6 plays a relevant pathophysiological role in the progression of PCa, in a similar manner to other SR members, such as SRSF3 (5). Mechanistically, we identified that the “alternative first exon” and “exon skipping” are the most altered splicing event types in response to SRSF6 silencing in PCa cells. Similarly, Wan et al. showed that exon skipping was the most altered splicing type in response to the stable silencing of SRSF6 in colorectal cancer cells (20). These data suggest that some of the mechanisms by which SRSF6 drive tumorigenesis and tumor progression might be shared across different tumor-types, although further experimental evidence is required in this regard. We then cross-compared the pathways altered in response to SRSF6 siRNA in PCa cells and those altered in mCRPC patients with low and high levels of SRSF6 to find potential clinically relevant pathways controlled by SRSF6. As a result, we found that high levels of SRSF6 were associated, among other pathways, with the androgen response hallmark. Consistent with this, SRSF6 mRNA levels correlated positively with a signature of androgen receptor (AR) activity (40) in mCRPC patients. It should be noted that although therapeutic strategies targeting AR still represents the cornerstone of the treatment for patients with advanced PCa, their long-term use is compromised as the tumors eventually develop resistance (2). Therefore, finding novel therapeutic targets that could be exploited to target AR signaling more efficiently and avoid treatment resistance is an urgent unmet clinical need. In this sense, we found that the overexpression of SRSF6 increased, while its silencing reduced, the activity of AR in 22Rv1 cells, a CRPC model resistant to AR inhibition (58). Interestingly, SRSF6 modulation did not result in a change in the expression levels of neither AR nor AR-V7, therefore suggesting that SRSF6 might control AR activity through the modulation of certain regulator(s) of this receptor, such as co-regulators, pioneer factors, etc. In keeping with this, we found that SRSF6 directly control the expression of TOP2B, a topoisomerase required for efficient androgen-mediated gene expression (45), while negatively regulates APPBP2 expression, which promotes cytoplasmatic retention of AR (46). These data indicate that SRSF6 control the expression of key regulators of AR activity and might modulate androgen response by upregulating TOP2B and downregulating APPBP2, suggesting that SRSF6 might represent an exploitable therapeutic target to efficiently block persistent AR signaling in advanced PCa patients. Nevertheless, we also found that SRSF6 levels were associated with additional major tumor-related signaling pathways, other than AR activity. For instance, TP53 and apoptosis pathways (59, 60) were enriched in SRSF6 silenced cells and patients with low SRSF6 expression levels, suggesting that these pathways might be involved in the antitumor effects observed in response to SRSF6 silencing in PCa cells, which may explain the sensitivity of AR negative cell lines (PC-3 and DU145) to SRSF6 depletion. Besides, high SRSF6 levels (in both 22Rv1 cell line and patient samples) were associated with a higher expression of E2F target genes. In this sense, it is widely known that the hyperactivation of the CDK–RB–E2F axis leads to uncontrolled proliferation and is a common feature of highly-aggressive cancer types, including advanced PCa (61). The association between SRSF6 and E2F pathway, in combination with the fact that patients with high SRSF6 levels had worse biochemical free survival in our study, highlights a potential prognostic value for SRSF6 in PCa which could be exploitable clinically.

Taken together, our results unveiled new conceptual and functional avenues in PCa, with potential therapeutic implications, by demonstrating for the first time that SRSF6 is upregulated in PCa which is likely of clinical interest, inasmuch as this alteration directly associates to critical aggressiveness features of PCa. Moreover, we unveil a role of SRSF6 in crucial pathophysiological processes of PCa, such as cell proliferation, colony and tumorspheres formation, and cell migration. These actions are likely mediated through the modulation of key oncogenic pathways in PCa including AR, TP53, E2F, and apoptosis. Therefore, our study provides solid, convincing evidence demonstrating that SRSF6 has a functional role in the pathophysiology of PCa and invites to suggest that SRSF6 may represent an effective prognostic biomarker and exploitable therapeutic target in PCa, offering a clinically relevant opportunity that should be tested for their use in humans.

Our study reveals that the serine/arginine-rich splicing factor 6 (SRSF6) is a crucial splicing factor regulating clinically relevant pathological processes with potential therapeutic implications in prostate cancer (PCa). SRSF6 exhibited consistent upregulation and its levels were associated with clinical features of tumor aggressiveness in different cohorts of primary and castration-resistant PCa. Modulation of SRSF6 expression (by silencing and overexpression approaches) significantly impacted key aggressiveness features on different in vitro and in vivo PCa models. Notably, our findings demonstrated that SRSF6 plays a crucial role in the modulation of androgen receptor (AR) activity by regulating the expression of key AR regulators including TOP2B and APPBP2. Therefore, we highlight SRSF6 as a potential diagnostic and prognostic biomarker and a potential pharmacological target in PCa, offering a clinically relevant opportunity worth to be explored in humans.

ACSL3 acyl-CoA synthetase long chain family member 3

ACTB actin beta

ADT androgen-deprivation therapy

AF alternative first exon

APPBP2 amyloid beta precursor protein binding protein 2

AR androgen receptor

AR-V7 androgen receptor variant 7

ATCC American Type Culture Collection

BPH benign prostatic hyperplasia

CNA copy number alteration

CRPC castration-resistant prostate cancer

CSS Charcoal Stripped Serum

DHT dihydrotestosterone

DMEM Dulbecco's Modified Eagle Medium

DMSO dimethyl sulfoxide

dPSI differential Percent Spliced In

EGF epidermal growth factor

ESRP1 epithelial splicing regulatory protein 1

FBS Fetal Bovine Serum

FFPE formalin-fixed paraffin-embedded

FKBP5 FKBP prolyl isomerase 5

GAPDH glyceraldehyde-3-phosphate dehydrogenase

GEO Gene Expression Omnibus

GISTIC Genomic Identification of Significant Targets In Cancer

GSEA Gene Set Enrichment Analyses

HSP90AA1 heat shock protein 90 alpha family class A member 1

HSP90B1 heat shock protein 90 beta family member 1

HSPA1B heat shock protein family A (Hsp70) member 1B

IHC immunohistochemistry

ISUP International Society of Urologic Pathologists

KLK2 kallikrein related peptidase 2

KLK3 kallikrein related peptidase 3

mCRPC metastatic castration-resistant prostate cancer

MSKCC Memorial Sloan Kettering Cancer Center

N-TAR non-tumor adjacent region

NCI National Cancer Institute

NKX3-1 NK3 homeobox 1

PCa prostate cancer

PCA3 prostate cancer associated 3

PIN prostatic intraepithelial neoplasia

PLPP1 phospholipid phosphatase 1

PSI Percent Spliced In

PVDF Polyvinylidene fluoride

RAB3B RAB3B, member RAS oncogene family

RIPA Radio-Immunoprecipitation Assay

RPMI Roswell Park Memorial Institute

RRM RNA recognition motif

SE exon skipping

SF splicing factor

SRSF1 serine/arginine-rich splicing factor 1

SRSF3 serine/arginine-rich splicing factor 3

SRSF6 serine/arginine-rich splicing factor 6

STEAP1 STEAP family member 1

STRs short tandem repeats

SU2C Stand Up to Cancer/Prostate Cancer Foundation

SV splicing variant

TCGA The Cancer Genome Atlas

TOP2B DNA topoisomerase II beta

TPM transcript per million

Ethics approval and consent to participate

The present study was conducted in accordance with the principles of the Declaration of Helsinki and was approved by the Reina Sofia University Hospital Ethics Committee. The regional Biobank coordinated the collection, processing, management, and assignment of biological samples according to standard procedures. All patients provided written informed consent. Experiments with mice were carried out according to the European Regulations for Animal Care under the approval of the university/regional government research ethics committees.

Consent for publication

Not applicable

Availability of data and materials

All data generated or analysed during this study are included in this article (Supplementary Data).

Competing interests

The authors declare that they have no competing interests.

Funding

This research was funded by the Spanish Ministry of Science, Innovation, and Universities (Research‐Grant: PID2019‐105564RB‐I00; Predoctoral contracts: FPU16/05059, FPU17/00263, FPU18/02485, FPU18/06009, FPU18/02275), Instituto de Salud Carlos III, co-funded by European Union (ERDF/ESF, “Investing in your future”; DTS Grant DTS20/00050), Junta de Andalucia (BIO-0139, PI-0094-2020), and CIBERobn (CIBER is an initiative of Instituto de Salud Carlos III, Ministerio de Sanidad, Servicios Sociales e Igualdad, Spain).

Authors' contributions

JMJV, AJMH, and RML were major contributors for the conception of the study. JMJV, AJMH, EGG, MDG, and RML designed the work. JMJV, AJMH, EGG, PSM, JPG, ACFF, RBE, RSS, TGS, EC, PFLS, JCV, and ASC acquired and/or analyzed the data. JMJV, AJMH, EGG, AJMF, EE, JPC, AS, DO, MDG, and RML interpreted the data. JMJV, AJMH, MDG, and RML were major contributors for drafting and revising the work. All the authors have read and approved the final version of the manuscript.

Acknowledgements

Some of the figures have been created with BioRender. Special thanks to the staff of Biobank of the IMIBIC and of the experimental animal service (SAE) of the UCO/IMIBIC. We are gratefully indented to all the patients and their families for generously donating the samples and clinical data for research purposes.

Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, et al. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J Clin. 2021;71(3):209-49.
Westaby D, Fenor de La Maza MLD, Paschalis A, Jimenez-Vacas JM, Welti J, de Bono J, et al. A New Old Target: Androgen Receptor Signaling and Advanced Prostate Cancer. Annu Rev Pharmacol Toxicol. 2022;62:131-53.
Watson PA, Arora VK, Sawyers CL. Emerging mechanisms of resistance to androgen receptor inhibitors in prostate cancer. Nat Rev Cancer. 2015;15(12):701-11.
Paschalis A, Sharp A, Welti JC, Neeb A, Raj GV, Luo J, et al. Alternative splicing in prostate cancer. Nat Rev Clin Oncol. 2018;15(11):663-75.
Jiménez-Vacas JM, Herrero-Aguayo V, Montero-Hidalgo AJ, Gómez-Gómez E, Fuentes-Fayos AC, León-González AJ, et al. Dysregulation of the splicing machinery is directly associated to aggressiveness of prostate cancer. EBioMedicine. 2020;51:102547.
Jiménez-Vacas JM, Herrero-Aguayo V, Gómez-Gómez E, León-González AJ, Sáez-Martínez P, Alors-Pérez E, et al. Spliceosome component SF3B1 as novel prognostic biomarker and therapeutic target for prostate cancer. Transl Res. 2019;212:89-103.
Jiménez-Vacas JM, Montero-Hidalgo AJ, Gómez-Gómez E, Sáez-Martínez P, Fuentes-Fayos AC, Closa A, et al. Tumor suppressor role of RBM22 in prostate cancer acting as a dual-factor regulating alternative splicing and transcription of key oncogenic genes. Transl Res. 2022.
Paschalis A, Welti J, Neeb AJ, Yuan W, Figueiredo I, Pereira R, et al. JMJD6 Is a Druggable Oxygenase That Regulates AR-V7 Expression in Prostate Cancer. Cancer Res. 2021;81(4):1087-100.
Liu LL, Xie N, Sun S, Plymate S, Mostaghel E, Dong X. Mechanisms of the androgen receptor splicing in prostate cancer cells. Oncogene. 2014;33(24):3140-50.
Boucher L, Ouzounis CA, Enright AJ, Blencowe BJ. A genome-wide survey of RS domain proteins. Rna. 2001;7(12):1693-701.
Howard JM, Sanford JR. The RNAissance family: SR proteins as multifaceted regulators of gene expression. Wiley Interdiscip Rev RNA. 2015;6(1):93-110.
Liang LM, Xiong L, Cheng PP, Chen SJ, Feng X, Zhou YY, et al. Splicing factor SRSF6 mediates pleural fibrosis. JCI Insight. 2021;6(10).
Neueder A, Dumas AA, Benjamin AC, Bates GP. Regulatory mechanisms of incomplete huntingtin mRNA splicing. Nat Commun. 2018;9(1):3955.
Mai H, Fan W, Wang Y, Cai Y, Li X, Chen F, et al. Intranasal Administration of miR-146a Agomir Rescued the Pathological Process and Cognitive Impairment in an AD Mouse Model. Mol Ther Nucleic Acids. 2019;18:681-95.
Juan-Mateu J, Alvelos MI, Turatsinze JV, Villate O, Lizarraga-Mollinedo E, Grieco FA, et al. SRp55 Regulates a Splicing Network That Controls Human Pancreatic β-Cell Function and Survival. Diabetes. 2018;67(3):423-36.
Manetti M, Guiducci S, Romano E, Ceccarelli C, Bellando-Randone S, Conforti ML, et al. Overexpression of VEGF165b, an inhibitory splice variant of vascular endothelial growth factor, leads to insufficient angiogenesis in patients with systemic sclerosis. Circ Res. 2011;109(3):e14-26.
Park S, Brugiolo M, Akerman M, Das S, Urbanski L, Geier A, et al. Differential Functions of Splicing Factors in Mammary Transformation and Breast Cancer Metastasis. Cell Rep. 2019;29(9):2672-88.e7.
Jensen MA, Wilkinson JE, Krainer AR. Splicing factor SRSF6 promotes hyperplasia of sensitized skin. Nat Struct Mol Biol. 2014;21(2):189-97.
Cohen-Eliav M, Golan-Gerstl R, Siegfried Z, Andersen CL, Thorsen K, Ørntoft TF, et al. The splicing factor SRSF6 is amplified and is an oncoprotein in lung and colon cancers. J Pathol. 2013;229(4):630-9.
Wan L, Yu W, Shen E, Sun W, Liu Y, Kong J, et al. SRSF6-regulated alternative splicing that promotes tumour progression offers a therapy target for colorectal cancer. Gut. 2019;68(1):118-29.
Sanchez-Vega F, Mina M, Armenia J, Chatila WK, Luna A, La KC, et al. Oncogenic Signaling Pathways in The Cancer Genome Atlas. Cell. 2018;173(2):321-37.e10.
Abida W, Cyrta J, Heller G, Prandi D, Armenia J, Coleman I, et al. Genomic correlates of clinical outcome in advanced prostate cancer. Proc Natl Acad Sci U S A. 2019;116(23):11428-36.
Taylor BS, Schultz N, Hieronymus H, Gopalan A, Xiao Y, Carver BS, et al. Integrative genomic profiling of human prostate cancer. Cancer Cell. 2010;18(1):11-22.
Grasso CS, Wu YM, Robinson DR, Cao X, Dhanasekaran SM, Khan AP, et al. The mutational landscape of lethal castration-resistant prostate cancer. Nature. 2012;487(7406):239-43.
Roudier MP, Winters BR, Coleman I, Lam HM, Zhang X, Coleman R, et al. Characterizing the molecular features of ERG-positive tumors in primary and castration resistant prostate cancer. Prostate. 2016;76(9):810-22.
Cerami E, Gao J, Dogrusoz U, Gross BE, Sumer SO, Aksoy BA, et al. The cBio cancer genomics portal: an open platform for exploring multidimensional cancer genomics data. Cancer Discov. 2012;2(5):401-4.
Gao J, Aksoy BA, Dogrusoz U, Dresdner G, Gross B, Sumer SO, et al. Integrative analysis of complex cancer genomics and clinical profiles using the cBioPortal. Sci Signal. 2013;6(269):pl1.
Edgar R, Domrachev M, Lash AE. Gene Expression Omnibus: NCBI gene expression and hybridization array data repository. Nucleic Acids Res. 2002;30(1):207-10.
Beroukhim R, Getz G, Nghiemphu L, Barretina J, Hsueh T, Linhart D, et al. Assessing the significance of chromosomal aberrations in cancer: methodology and application to glioma. Proc Natl Acad Sci U S A. 2007;104(50):20007-12.
Beroukhim R, Mermel CH, Porter D, Wei G, Raychaudhuri S, Donovan J, et al. The landscape of somatic copy-number alteration across human cancers. Nature. 2010;463(7283):899-905.
Uphoff CC, Drexler HG. Detection of mycoplasma contaminations. Methods Mol Biol. 2005;290:13-23.
Ellwood-Yen K, Graeber TG, Wongvipat J, Iruela-Arispe ML, Zhang J, Matusik R, et al. Myc-driven murine prostate cancer shares molecular features with human prostate tumors. Cancer Cell. 2003;4(3):223-38.
Gahete MD, Córdoba-Chacón J, Hergueta-Redondo M, Martínez-Fuentes AJ, Kineman RD, Moreno-Bueno G, et al. A novel human ghrelin variant (In1-ghrelin) and ghrelin-O-acyltransferase are overexpressed in breast cancer: potential pathophysiological relevance. PLoS One. 2011;6(8):e23302.
Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, et al. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002;3(7):Research0034.
Schindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T, et al. Fiji: an open-source platform for biological-image analysis. Nat Methods. 2012;9(7):676-82.
Love MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014;15(12):550.
Alors-Perez E, Blázquez-Encinas R, Alcalá S, Viyuela-García C, Pedraza-Arevalo S, Herrero-Aguayo V, et al. Dysregulated splicing factor SF3B1 unveils a dual therapeutic vulnerability to target pancreatic cancer cells and cancer stem cells with an anti-splicing drug. J Exp Clin Cancer Res. 2021;40(1):382.
Trincado JL, Entizne JC, Hysenaj G, Singh B, Skalic M, Elliott DJ, et al. SUPPA2: fast, accurate, and uncertainty-aware differential splicing analysis across multiple conditions. Genome Biol. 2018;19(1):40.
Faisal FA, Sundi D, Tosoian JJ, Choeurng V, Alshalalfa M, Ross AE, et al. Racial Variations in Prostate Cancer Molecular Subtypes and Androgen Receptor Signaling Reflect Anatomic Tumor Location. Eur Urol. 2016;70(1):14-7.
Spratt DE, Alshalalfa M, Fishbane N, Weiner AB, Mehra R, Mahal BA, et al. Transcriptomic Heterogeneity of Androgen Receptor Activity Defines a de novo low AR-Active Subclass in Treatment Naïve Primary Prostate Cancer. Clin Cancer Res. 2019;25(22):6721-30.
Mootha VK, Lindgren CM, Eriksson KF, Subramanian A, Sihag S, Lehar J, et al. PGC-1alpha-responsive genes involved in oxidative phosphorylation are coordinately downregulated in human diabetes. Nat Genet. 2003;34(3):267-73.
Subramanian A, Tamayo P, Mootha VK, Mukherjee S, Ebert BL, Gillette MA, et al. Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proc Natl Acad Sci U S A. 2005;102(43):15545-50.
Heemers HV, Tindall DJ. Androgen receptor (AR) coregulators: a diversity of functions converging on and regulating the AR transcriptional complex. Endocr Rev. 2007;28(7):778-808.
Echeverria PC, Picard D. Molecular chaperones, essential partners of steroid hormone receptors for activity and mobility. Biochim Biophys Acta. 2010;1803(6):641-9.
Haffner MC, Aryee MJ, Toubaji A, Esopi DM, Albadine R, Gurel B, et al. Androgen-induced TOP2B-mediated double-strand breaks and prostate cancer gene rearrangements. Nat Genet. 2010;42(8):668-75.
Zhang Y, Yang Y, Yeh S, Chang C. ARA67/PAT1 functions as a repressor to suppress androgen receptor transactivation. Mol Cell Biol. 2004;24(3):1044-57.
Matera AG, Wang Z. A day in the life of the spliceosome. Nat Rev Mol Cell Biol. 2014;15(2):108-21.
Scotti MM, Swanson MS. RNA mis-splicing in disease. Nat Rev Genet. 2016;17(1):19-32.
Oltean S, Bates DO. Hallmarks of alternative splicing in cancer. Oncogene. 2014;33(46):5311-8.
Jiménez-Vacas JM, Montero-Hidalgo AJ, Gómez-Gómez E, Fuentes-Fayos AC, Ruiz-Pino F, Guler I, et al. In1-Ghrelin Splicing Variant as a Key Element in the Pathophysiological Association Between Obesity and Prostate Cancer. J Clin Endocrinol Metab. 2021;106(12):e4956-e68.
Hormaechea-Agulla D, Gahete MD, Jiménez-Vacas JM, Gómez-Gómez E, Ibáñez-Costa A, F LL, et al. The oncogenic role of the In1-ghrelin splicing variant in prostate cancer aggressiveness. Mol Cancer. 2017;16(1):146.
Hormaechea-Agulla D, Jiménez-Vacas JM, Gómez-Gómez E, F LL, Carrasco-Valiente J, Valero-Rosa J, et al. The oncogenic role of the spliced somatostatin receptor sst5TMD4 variant in prostate cancer. Faseb j. 2017;31(11):4682-96.
Zhang D, Hu Q, Liu X, Ji Y, Chao HP, Liu Y, et al. Intron retention is a hallmark and spliceosome represents a therapeutic vulnerability in aggressive prostate cancer. Nat Commun. 2020;11(1):2089.
Sanford JR, Gray NK, Beckmann K, Cáceres JF. A novel role for shuttling SR proteins in mRNA translation. Genes Dev. 2004;18(7):755-68.
Swanson CM, Sherer NM, Malim MH. SRp40 and SRp55 promote the translation of unspliced human immunodeficiency virus type 1 RNA. J Virol. 2010;84(13):6748-59.
Fuentes-Fayos AC, Vázquez-Borrego MC, Jiménez-Vacas JM, Bejarano L, Pedraza-Arévalo S, F LL, et al. Splicing machinery dysregulation drives glioblastoma development/aggressiveness: oncogenic role of SRSF3. Brain. 2020;143(11):3273-93.
Tabach Y, Kogan-Sakin I, Buganim Y, Solomon H, Goldfinger N, Hovland R, et al. Amplification of the 20q chromosomal arm occurs early in tumorigenic transformation and may initiate cancer. PLoS One. 2011;6(1):e14632.
Li Y, Chan SC, Brand LJ, Hwang TH, Silverstein KA, Dehm SM. Androgen receptor splice variants mediate enzalutamide resistance in castration-resistant prostate cancer cell lines. Cancer Res. 2013;73(2):483-9.
Westaby D, Jimenez-Vacas JM, Padilha A, Varkaris A, Balk SP, de Bono JS, et al. Targeting the Intrinsic Apoptosis Pathway: A Window of Opportunity for Prostate Cancer. Cancers (Basel). 2021;14(1).
Robinson D, Van Allen EM, Wu YM, Schultz N, Lonigro RJ, Mosquera JM, et al. Integrative clinical genomics of advanced prostate cancer. Cell. 2015;161(5):1215-28.
Kent LN, Leone G. The broken cycle: E2F dysfunction in cancer. Nat Rev Cancer. 2019;19(6):326-38.

SupplementalFigure1.jpg
Supplemental Figure 1: SRSF6 genomic alterations in PCa. (a-b) Percentage of patients with SRSF6 copy number alteration (CNA; left panels) and mRNA alterations [samples with high and low expression of SRSF6 were defined as those with two standard deviations away from the mean of expression of all profiled samples (Z-score ±2, respectively); right panels) from TCGA (a) and SU2C (b) cohort. (c-d) Association of SRSF6 mRNA with molecular subtypes and common genetic alterations of PCa, in TCGA cohort (c) and SU2C (d) cohort.
SupplementalFigure2.jpg
Supplemental Figure 2: Associations and correlations of SRSF6 expression levels with clinical and molecular parameters of PCa aggressiveness. (a) Association between SRSF6 mRNA levels and T-Stage in TCGA cohort. (b) Association between SRSF6 mRNA levels and metastasis site in SU2C cohort. Data represent the mean ± SEM of mRNA expression levels. (c-h) Correlation between SRSF6 mRNA levels and PCA3 (c), SST₅TMD4 (d), In1-Ghrelin (e), AR-FL (f), AR-v7 (g), and ESRP1 (h) expression levels in biopsies cohort. mRNA levels are adjusted by normalization factor (calculated from ACTB and GAPDH expression levels). Correlations data are represented by mean (connecting line) and error bands (pointed line).
SupplementalFigure3.jpg
Supplemental Figure 3: Validation by qPCR of SRSF6 modulation in human prostate-derived cell lines. (a-c) Validation of SRSF6 overexpression in RWPE-1 (a), 22Rv1 (b), and PC-3 (c) cells. (d-g) Validation of SRSF6silencing in LNCaP (d), 22Rv1 (e), DU145 (f), and PC-3 (g) cells. SRSF6mRNA levels are adjusted by ACTB expression levels. Data are represented as percent of control (mock or scramble) cells (mean ± SEM). Asterisks (*p<0.05; ***p<0.001) indicate statistically significant differences between groups.
SupplementalFigure4.jpg
Supplemental Figure 4: Expression of SR-proteins and AR-related genes in response to the modulation of SRSF6. (a) Expression of SR-proteins in response to SRSF6 silencing in 22Rv1 cells. (b-c) Expression of AR-Score genes in response to SRSF6 silencing (b) and overexpression (c) in 22Rv1 cells. (d-e) Expression of AR(d) and AR-V7 (e) in response to SRSF6 silencing in 22Rv1 cells. mRNA levels are adjusted by ACTB expression levels. Data are normalized by control cells (mean ± SEM).
SupplementalTable1.docx
SupplementalDataTable.xlsx

Download PDF

Version 1

posted

You are reading this latest preprint version

The splicing factor SRSF6 regulates AR activity and represents a potential therapeutic target in prostate cancer

Status:

Version 1

Abstract

Figures

BACKGROUND

Methods

Human samples

Cell culture and reagents

Preclinical models of PCa

RNA extraction, retrotranscription, and real-time quantitative PCR (qPCR)

SRSF6 overexpression and silencing on in vitro prostate cell models

Antibody validation

Western blot

Immunohistochemistry

Cell proliferation and migration

Colonies and tumorspheres formation

RNA-Seq

AR-Score and AR activity modulation

Bioinformatic and statistical data analysis

Results

SRSF6 is overexpressed in prostate cancer

SRSF6 expression levels are associated with clinical and molecular features of tumor aggressiveness

SRSF6 protein levels are elevated in prostate cancer

Modulation of SRSF6 expression alters aggressiveness of prostate cancer cells in vitro

Modulation of SRSF6 expression alters the aggressiveness of prostate cancer cells in vivo

SRSF6 controls a plethora of key oncogenic signaling pathways in PCa cells

Discussion

CONCLUSIONS

List Of Abbreviations

Declarations

References

Supplementary Files

Status:

Version 1