Reagents
Lidocaine used in this experiment was purchased from Sigma-Aldrich (USA), The lidocaine was dissolved in standard growth medium at the concentration of 1 mg/mL for stock at -20℃. And final treatment concentrations were achieved by diluting with standard growth medium.
Cell culture
Human breast cancer cell lines MDA-MB-453 (ER−, HER2high), MCF-7/HER2 (ER+, HER2high) and MCF-7 (ER+, HER2low) were purchased from Shanghai Institutes for Biological Sciences, CAS. MDA-MB-453 cells were cultured in Leibovitz's L-15 Medium (Gibco, Carlsbad, CA, USA). MCF-7/HER2 and MCF-7 cells were cultured in Dulbecco's Minimum Essential Medium (Gibco, Carlsbad, CA, USA). All the culture medium was supplemented with 10% heated- Fetal Bovine Serum (FBS) and 1% penicillin/G-streptomycin sulfate solution. All the cells were cultured in an incubator at the condition of 37℃ and 5% CO2.
RNA isolation and RT-PCR
After treated with 100, 200 and 500 µM Lidocaine, the total RNA in breast cancer cell lines MDA-MB-453 (ER−, HER2high), MCF-7/HER2 (ER+, HER2high) and MCF-7 (ER+, HER2low) was extracted using TRIzol Reagent (Sigma, St. Louis, MO, USA) according to the manufacturer’s instructions [10]. Following that, the NanoDrop 2000C instrument was used to determine the quantity and quality of extracted RNA, and then the total RNA was reverse transcripted into cDNA according to the instructions of Reverse Transcription Kit (TaKaRa, Dalian, China). The SYBR Green Master Mix (Roche) was conducted for the RT-PCR detection of miRNA-29 and ADAM12, with the gapdh gene used as the internal control. Primer sequences used in this study were showed in Table 1. All data were normalized by using 2−ΔΔCt method as relative quantification.
Table 1
Sequences of the primers used in this research.
Genes | Sequences |
miRNA-29 | CGGGTACCGGTCCTTTCTAG GTT |
CGGAATT CAAAAATGTGGGC |
Adam12 | CGCTCGAAATTACACGGGTC |
CAGCGAGGTTTGGTGTGTTG |
gapdh | AATGGGCAGCCGTTAGGAAA |
GCGCCCAATACGACCAAATC |
Cell proliferation assay
To detect the inhibitory effect of the Lidocaine on breast cancer cell lines MDA-MB-453 (ER−, HER2high), MCF-7/HER2 (ER+, HER2high) and MCF-7 (ER+, HER2low), the CCK-8 assay (96992-500TESTS-F, Sigma-Aldric, USA) was carried out for the cancer cell proliferation detection after indicated treatment. This experiment was performed under the guidance of the manufactures’ instruction with a little modification [11]. In brief, these three cell lines were seeded in 96-well culture plates (1 × 104 cells/well, 100 µl each well) and cultured inappropriate medium containing 10% FBS in a 37℃, 5% CO2 humidified environment for 24 h. Subsequently, CCK-8 reagents (10 µl/well) were added to each well and cells were incubated according to the manufacturer's protocol, and the absorbance (optical density, OD) values of each well were detected at a wavelength of 450 nm on a microplate spectrophotometer system (Molecular Devices, Sunnyvale, CA, USA). This experiment was performed in triplicate.
Cell apoptosis assay
The percentages of the apoptotic breast cancer cells were measured with Cell Apoptosis Assay Kit (Life Technologies) in flow cytometry according to the manufacturer’s instruction with some modifications [12]. In short, the breast cancer cells in each group were collected, planted into 6-well plates and cultured in an incubator at the 37℃, 5% CO2 environment. After indicated treatment, the cells in each group were dissociated into single cells with trypsin, and further washed with PBS, then and resuspended in 1 × binding buffer at a concentration of 1 × 106 cells/mL. 10 Μm Annexin V-FITC and propidium iodide (PI) solution was subjected into suspension for 15 minutes incubation in the dark. Cell lines incubated with nothing were used as the negative group. Finally, all of cell samples were analyzed using a FACSCalibur cytometer (BD). All experiments with triplicate were performed.
MiRNA transfection experiments
To overexpress or knock down miR-29 expression, the miR-29 mimic, miR-29 mimic control, miR-29 mimic inhibitor, as well as the miR-29 mimic inhibitor control were designed and synthesized by Ruibobio (Guangzhou, China). The miRNAs were transfected into breast cancer cells using Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA) under the guidance of the manufacturer’s protocols [13]. Transfection efficiency of these miRNAs was examined by quantitative Real Time-Polymerase Chain Reaction (RT-PCR).
Bioinformatics methods and luciferase assay
To predicate the potential target genes of miR-29, four different available databases TargetScan, miRWalk, MiRanda and RNA22 were performed in this experiment. Screening for the common targets predicated by the above databases, the protein with the highest score was selected for the following binding assay.
Based on the bioinformatics results, the 3'-untranslated region (UTR) of ADAM12 gene was predicated having the binding site with the miR-29. In this experiment the luciferase assay was finished to confirm the interaction between the miR-29 and ADAM12 [14]. Firstly, the wild-type ADAM12 3’-UTR sequence and mutant 3’-UTR sequence of ADAM12 gene were synthesized and cloned into pMIR-REPORT luciferase reporter plasmids (Promega Corporation, Madison, WI, USA). Plasmids with WT or mutant 3'-UTR DNA sequences were co-transfected with miR-520a-3p mimic, inhibitor or negative control. After 24 cultivation at 37℃, 5% CO2 environment, cells were lysed using a dual luciferase reporter assay kit (Promega Corporation) according to the manufacturer's manual, and fluorescence intensity was measured using GloMax 20/20 illuminometer (Promega Corporation). All experiments were performed in triplicate.
Western blot
After indicated treatment, the relative expression of the ADAM12 in breast cancer cells was evaluated by western blot as previous described [15]. Briefly, the MDA-MB-453 (ER−, HER2high), MCF-7/HER2 (ER+, HER2high) and MCF-7 (ER+, HER2low) in this experiment were lysed with lysis buffer containing protease inhibitor cocktail (78437, Thermo Fisher Scientific, Inc.), and total protein was detected using BCA Protein Assay kit (23225, Pierce, USA). Then the BCA Protein Assay kit (23225, Pierce, USA) was used for the detection of the concentrations of protein samples. Next, equal amounts of protein samples were loaded on 10% sodium dodecyl sulfate-polyacrylamide denaturing gels and transferred onto a polyvinylidene difluoride membrane (PVDF, EMD Millipore, Billerica, MA). After blocked in 5% nonfat milk for 2 hours at room temperature, the membranes were incubated with the appropriate primary antibody against ADAM12 or GAPDH overnight at 4 °C. after incubated with horseradish peroxidase‐conjugated secondary antibody for 1 hour, the proteins were visualized using an enhanced chemiluminescence (ECL) detection kit (Thermo Fisher Scientific) and quantified using ImageJ software (BIO RAD). The experiment was repeated three times independently.
Statistical analysis
In this present research, the SPSS 19.0 Software (IBM, Armonk, NY, USA) was used for statistical analyses. All the data were presented as means ± SD from triplicate repeats. The student’s t-test was used for un-paired comparisons between two groups, and pearson correlation was performed for correlation analysis between miR-29 and ADAM12 gene expression. p < 0.05 was considered statistically significant.