Thermotoga maritima MSB pullulanase was preserved in laboratory. The vector pET22b + and Escherichia coli (DE3) were donated from Chinese Academy of Agricultural Sciences.
Reagents
Restriction endonuclease NcoI (1160A, TaKaRa Bio), XhoI (1094A, TaKaRa Bio), Ligase (2011A, TaKaRa Bio), Amylopectin (KV370014, Biosharp), Pullulan polysaccharide (P816954, Shanghai MACKLIN reagent), Yeast extract powder (LP0021, Thermo Fisher), TRYPTONE (LP0042B, Thermo Fisher). SDS-PAGE kit (P0012AC, Ace biotechnology), Plasmid kit (Axygen Biotechnology), Gel DNA Mini Purification Kit (Axygen Biotechnology), Gold Band 3-color Regular Range Protein Marker (Shanghai Yisheng Biotechnology), BCA Protein Assay Kit (T9310A, TaKaRa Bio). The remaining reagents were domestic analytically pure.
Sequence analysis and structure simulation
Thermotoga maritima MSB8 pullulanase was found in NCBI database (GenBank Accession: AKE29594.1). The three-dimensional structure of pullulanase was simulated by PyMol (www.pymol.org). The protein model was evaluated rationality by Ramachandran Polt. Three-dimensional structure of pullulanase was analyzed by using the conservative domain analysis tool (CD-search) to mark the names of each domain and construct four truncated mutants (Fig. 1). After obtaining the functional relationship of related domains, PyMol was used to analyze the linked amino acids of each domain, and carry out site-directed mutagenesis to reveal the role (Fig. 2).
Design and construction of truncation and site-directed mutagenesis
The designed primers were synthesized by Tsingke Biotech (Wuhan, China) (Table 1). Using Thermotoga maritima MSB8 pullulanase genome as a complete (GenBank: CP011107.1). PulA (wild-type), PulA1 (ΔCBM41), PulA2 (ΔCBM41-X), PulA3 (ΔCBM41-X-CBM48), PulA4 (ΔC-domain) were amplified by PCR. M1 (E172G), M2 (E172G/R190G), M3 (E172G/D198G), M4 (PulA-E172G/R190G/D198G) were amplified by overlapping extended PCR. Restriction endonuclease NcoⅠ and XhoⅠ were utilized for double digestion of target gene and pET22b + vector, the product was ligated by T4 ligase and converted to Escherichia coli BL21 (DE3) (Mumcu et al. 2023). The monoclonal colony verified by colony PCR were selected and sent to Tsingke Biotech (Wuhan, China) for sequencing. The correctly sequenced recombinant bacteria were stored and marked as PulA, PulA1, PulA2, PulA3, PulA4, M1, M2, M3 and M4 (Table 2).
Table 1
Primers for amplification of pullulanase PulA and mutants
Primer | Nucleotide sequence (5’-3’) | Endonuclease site |
PulA-F | CATGCCATGGAAACCACCATCGTAGTCC | Nco Ⅰ |
PulA-R | CCGCTCGAGCTCTCTGTACAGAACGTACG | Xho Ⅰ |
PulA1-F | CATGCCATGGATAGAATCTTCTTCGCACAGGC | Nco Ⅰ |
PulA2-F | CATGCCATGGGAGAGCTCGGAGCCG | Nco Ⅰ |
PulA3-F | CATGCCATGGGTCTGGGAAGCGGTTG | Nco Ⅰ |
PulA4-F | CATGCCATGGATCCAGAAGGATGGGAAAAC | Nco Ⅰ |
PulA4-R | CCGCTCGAGCGGGAGAAATTCCAGGTG | Xho Ⅰ |
172-F | CTTTCTGAATCCCTGAAAGGTGAAGACCTCAG | Nco Ⅰ |
172-R | CTGAGGTCTTCACCTTTCAGGGATTCAGAAAG | Xho Ⅰ |
190-F | GAAGGTTACAAACCGGCAGGTGTCATCATGATGGAGAGA | Nco Ⅰ |
190-R | CTCCATCATGATGACACCTGCCGGTTTGTAACCTTC | Xho Ⅰ |
198-F | CATGATGGAGATCCTGGGCGACTACTATTACGATGGAC | Nco Ⅰ |
198-R | CATCGTAATAGTAGTCGCCCAGGATCTCCATCATG | Xho Ⅰ |
Table 2
Summary of pullulanase PulA and mutants with structures and enzymatic proterties
| Mutations | Kma (mol/L) | Kmb (mol/L) | Specific activitya (U/mg) | Specific activityb (U/mg) | Optimial temperaturea (oC) | Optimial temperatureb (oC) | Optimial pHa | Optimial pHb | \({\text{T}}_{m}^{app}\) (oC) |
PulA | / | 0.18 ± 0.02 | 0.19 ± 0.01 | 15.02 ± 0.42 | 492.62 ± 0.99 | 95 | 90 | 5.5 | 5.5 | 76.5 |
PulA1 | ΔCBM41 | 11.74 ± 0.62 | 1.02 ± 0.03 | 17.21 ± 0.44 | 607.77 ± 5.22 | 85 | / | 5.5 | / | 78.8 |
PulA2 | ΔCBM41-X | 2.40 ± 0.07 | 0.46 ± 0.08 | 2.02 ± 0.02 | 62.86 ± 2.32 | 65 | / | 6.0 | / | 66.6 |
M1 | E172G | 0.23 ± 0.01 | 0.30 ± 0.01 | 17.82 ± 0.22 | 671.64 ± 4.79 | / | 90 | / | 5.0 | 77.4 |
M2 | E172G/R190G | 0.27 ± 0.02 | 0.42 ± 0.04 | 15.47 ± 0.43 | 602.76 ± 19.36 | / | 90 | / | 5.5 | 71.7 |
M3 | E172G/D198G | 0.20 ± 0.01 | 0.46 ± 0.05 | 10.09 ± 0.09 | 400.32 ± 6.42 | / | 90 | / | 5.0 | 73.2 |
M4 | E172G/R190G/D198G | 0.14 ± 0.01 | 0.31 ± 0.02 | 14.17 ± 0.15 | 430.70 ± 15.44 | / | 90 | / | 5.5 | 71.9 |
The substrate used in aamylopectin; bpullulan polysaccharide. |
Induction enzyme production and purification of mutants
The positive recombinant strains were inoculated into LB medium with 100 µg/ml of ampicillin, incubated at 37 oC, 220 rpm/min until OD600 reached 0.6 to 0.8. The flask was added with a final concentration of 0.1 mg/ml isopropyl β-1-D-thiogalactopyranoside (IPTG) and cultured at 30 oC, 200 rpm/min. The enzyme solution was centrifuged at 5000 rpm/min for 5 min. The supernatant was discarded and the precipitation was retained. The precipitation was broken by ultrasonic crusher, and centrifuged for 10 min, 4 oC, 8000 rpm/min to obtain the supernatant crude enzyme liquid. Enzyme liquids containing histone labels was purified by nickel column affinity chromatography (Kozlov et al. 2007). Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) was used to analyze the expression of target protein. After the validation of protein bands was successful, protein concentration was measured with BCA Protein Assay Kit. The researcher prepared BSA standard solution with final concentration of 0 µg/ml, 25 µg/ml, 125 µg/ml, 250 µg/ml, 500 µg/ml, 750 µg/ml and 1000 µg/ml, then add 4 µl standard concentration BSA and enzyme protein into 96-well plate respectively, add 200 µl Bradford Dye Reagent for 5 minutes, measure absorbance under OD595 and calculate protein concentration.
Measurement of enzymatic activity of PulA and mutants
The activity of pullulanase was calculated by using 3, 5-dinitrosalicylic acid (DNS) for reducing sugar assay. The researcher prepared 0.25 mg/ml glucose and diluted it to different concentrations in turn. 3 ml DNS was added into 2 ml glucose, boil for 10min, cool for 5 min, measured the absorbance under OD540 and calculated the glucose curve. Amylopectin (0.5%, wt/vol) was selected to detect the enzymatic properties of truncated mutants. When determining the key domain, the higher specificity pullulan polysaccharide (1%, wt/vol) was used as the substrate to detect the enzymatic properties for the site-directed mutants. Substrate was treated at the corresponding temperature and pH, preheated for 5min, then reacted with 100 µl enzyme solution for 10min, added 1.5 ml DNS to terminate the reaction, and then measured enzyme activity at OD540 after cooling in water bath. An enzyme activity was defined as the amount of 1µmol glucose produced by catalysis per minute under corresponding conditions.
Differential scanning fluorimetry
The apparent melting temperature \(({T}_{m}^{app}\)) was determined by differential scanning fluorimetry (DSF) (Martin et al. 2022). 5000×SYPRO Orange dye was diluted with eluent buffer to 100×SYPRO Orange dye. Then 20 µl purified enzyme solution was mixed with 5 µl diluted SYPRO Orange dye, and the \({T}_{m}^{app}\)value of the sample was determined by fluorescence PCR system at 30 oC to 99 oC.
Measurement of optimum temperature and optimum pH
A buffer solution of 3.0 to 10.0 pH was required, 50 mmol/L Na2HPO4-citric acid buffer (pH 3.0 to 7.5), 50mmol/L Tris-HCl (pH 7.5 to 9), 50 mmol/L glycine-NaOH buffer (pH 9.0 to 10.0). At pH 5.5, the enzyme activity was measured at different temperatures (65 oC to 100 oC). The highest point of enzyme activity was the optimal temperature, the maximum enzyme activity was 100%, and then the relative enzyme activity was calculated at different temperatures. At optimum temperature, the enzyme activity was measured at different pH substrates (pH 3.0 to 10.0). The highest point of enzyme activity was the optimal pH, the maximum enzyme activity was 100%, and then the relative enzyme activity was calculated at different pH.
Measurement of thermal stability and pH stability
The enzyme was put into 40 oC to 100 oC for 1hour, and the control group was not treated. The enzyme activity was measured at the optimum temperature and optimum pH. The relative residual enzyme activity was the thermal stability of the enzyme. The enzyme was diluted at different pH (pH 3.0 to 10.0), and the diluted enzyme was treated for 1hour at \({T}_{m}^{app}\)value. The enzyme activity was also measured at the optimum temperature and optimum pH. The relative residual enzyme activity obtained was the pH stability of the enzyme.
Measurement of Km of PulA and mutants
0.1 to 0.8% substrate was configured and the dilution mode was the optimal pH buffer. The enzyme activity of different concentrations of substrate was measured at optimum temperature, and then the Km of the enzyme was measured by using a double-reciprocal plot.