Cell culture
The primary cultures of cardiomyocytes were obtained from age-matched adult mouse (6–10 weeks old). Then, maintained in Dulbecco’s modified Eagle’s medium supplemented with 10 % FBS and seeded 1 × 10 5 cells per well into six-well plates at 37 °C. The miR-187 mimic, miR-187 inhibitor, shDYRK2 and each negative control oligonucleotides were transfected into cardiomyocytes to overexpression or inhibition the miR-187 or DYRK2 expression levels by using Lipofectamine 2000 (Invitrogen, USA). After the transfection, the cells were cultured in 3 h of reoxygenation after hypoxia for 4 h (H/R).
Animals in myocardial ischemia-reperfusion model
Adult male C57BL/6 J mice (weighing 25 ± 3 g) were supplied by Shanghai Experimental Animal Center (Shanghai, China). All animals were housed under a temperature-controlled room with a 12-hour dark-light cycle. All animal experimental procedures were approved by the Ethics Committee of Wuhan Third Hospital & Tongren Hospital of Wuhan University and followed the US National Institutes of Health Guidelines for the Care and Use of Laboratory Animals[16]. To mimic acute myocardial infarction and determine the potential role of miR-187 in I/R-induced cardiac injury, the animals were randomly divided into four groups (n = 10): Sham, I/R, I/R + NC agomir, and I/R + miR-187 agomir. The mice in agomir groups were injected through tail vein with NC agomir or miR-187 agomir (1 nmol/g/day) for 3 consecutive days. After the three days, the mice were anesthetized with intraperitoneally 2 % of the urethane, the I/R model was performed via treated with ischemia for 30 min and reperfusion for 24 hours as described[17]. After sacrificed, the heart samples were promptly removed and the blood were collected. The heart tissues were cut into 5 transverse slices of equal thickness (2 mm). The sections were counterstained with 2,3,5-triphenyltetrazolium chloride (TTC) solution for 15 min and fix with 4 % neutral paraformaldehyde. Viable myocardium was red, whereas the infarct area was white. The percentage of infarcted scar length/LV circumferential length analyzed with Image-Pro 6.0 for each section.
Western blot analysis
The protein expression of DYRK2 and β-actin was detected by Western blot analysis as previously studies[18]. The antibodies against DYRK2 and β-actin were purchased from Cell Signaling Technology (1:5000 dilution; MA, USA). The chemiluminescence system was used for visualized and quantify the protein bands by Image J software.
Dual luciferase reporter gene assay
To investigated whether DYRK2 is a downstream of miR-187, the binding sites of miR-187 and DYRK2 were forecasted by DianaTools. pGL3 luciferase reporter gene vector (Promega, Madison, WI, USA) loaded with wild type (WT)- DYRK2 or Mutant (mut)- DYRK2 were co-transfected with miR-187 mimic, miR-187 inhibitor or negative control (NC) into HEK293T cells. The luciferase activity was assayed with the dual luciferase reporter assay system (Promega, WI, USA) according to the manufacturer’s instructions.
Quantitative real-time PCR
Total RNA from cardiomyocytes after different treatments or heart tissue was extracted using TRIZOL reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s protocols. A total RNA was reversed by using universal cDNA synthesis and SYBR Green Master Mix kits. The expression of miR-187 was normalized to U6 with the following primers:
miR-187:
Forward (5′-3′): TCGTGTCTTGTGTTGCAGC;
Reverse (5′-3′): GTGCAGGGTCCGAGGT;
U6:
Forward (5′-3′): TCCTCCACGACAACCAAAACC;
Reverse (5′-3′): TCTTTTCCCAAAATCCCAGACTC.
ROS measurement
Cardiomyocytes were seeded in 12-well culture plates at a density of 1 × 105 cells/ mL and then exposured under H/R condition. The cellular ROS generation was detected by Dichlorofluorescein dye (DCFH-DA) then measured the ROS expression according to the previously reported[19]. The samples were measured by fluorescence microscopy (Olympus, Tokyo, Japan).
Flow
Cardiomyocytes were detached with trypsin and 1 × 106/ml cells were harvested in binding buffer. The apoptosis ratio of cardiomyocytes were analyzed using the Annexin V-FITC Apoptosis Detection Kit (Thermo, USA) following the manufacturer’s instructions. Then the flow cytometry (FACScan, BD Biosciences, USA) was used to measuring the apoptotic ratio of cardiomyocytes.
MTT
Cardiomyocytes were plated in a 96-well culture plate. According to the manufacturer’s instructions, 3-(4,5-Dimethylthiazol2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay (Abcam, Cambridge, UK) were used to detect cardiomyocytes viability in the different treatment groups.
Measurement the level of LDH, SOD and MDA
The levels of LDH (Thermo, USA), SOD (Thermo, USA) and MDA (ab118970, Abcam, USA) from culture medium, serum and heart tissue were analyzed by the commercial kits according to the manufacturer’s instructions.
Statistical analysis
All data were expressed as the mean ± SD and analyzed using Statistical Product and Service Solutions(SPSS) 19.0 (SPSS Inc., Chicago, IL, USA) software package. The differences between groups were performed with one-way ANOVA. Statistical significance was considered to be p -value < 0.05.