Animals
Mice (8+ weeks old) were housed under controlled light conditions (12 h light/12 h dark) and temperature (22°C) and fed ad libitum on standard mouse chow. Mice were randomized to treatment group based on body weight. Unless noted, all animals were male. All mice in functional studies were singly housed to facilitate accurate food intake measurements, except for one cohort of mice in the lesion study, which were kept group housed. All other mice were kept group housed. Mice used were: B6.Cg-Gt(ROSA)26Sortm14(CAG-tdTomato)Hze/J, with Cre-dependent tdTomato (Ai14; Jax# 007914)46 and C57BL/6J (Jax# 000664). Animal care and experimental procedures were performed with the approval of the Animal Care and Use Committee of Icahn School of Medicine at Mount Sinai under established guidelines.
General surgical procedures
All surgeries were performed under aseptic conditions. Mice were anaesthetized using 2% isoflurane and the top of the head was shaved then cleaned with 70% ethanol. Ophthalmic ointment was applied to the eyes and subcutaneous injections of buprenorphine (0.05mg/kg) were given to each animal prior to surgery. An incision was made in the midline and small craniotomies were made using a dental drill. Thirty-three gauge syringe needles (Hamilton) were used to unilaterally or bilaterally infuse virus into the brain at a rate of 0.1 µl/min. The following volumes and coordinates were used: MeA – 0.3-0.5 µl, 1.4 mm posterior, 2.5 mm lateral (2.55 mm if mouse body weight > 25 g, 2.6 mm if mouse body weight > 30 g), and 5.35 mm ventral from bregma; VMH – 0.3 µl, 1.2 mm posterior, 0.23 mm lateral, and 5.6 mm ventral from bregma; BNST – 0.3 µl, 0.2 mm anterior, 0.85 mm lateral, and 4.3 mm ventral from bregma. Viral expression was confirmed after euthanasia using a fluorescent Zeiss Axio Observer Z.1 microscope to visualize fluorophores and confirm targeting. Animals with misplaced injections or without virus expression were not included in the analysis.
Transneuronal circuit analysis was performed using a modified pseudorabies virus (PRV) expressing enhanced green fluorescent protein (GFP) (PRV152). PRV-GFP was injected into the liver of Ai14 mice via a Hamilton syringe (5 x 100 nl, 3.96*10^9 pfu/mL). Seven days after the PRV-GFP injections, mice were sacrificed via perfusion and brains dissected and sectioned to visualize PRV-GFP expression.
Viral vectors
We used the following viruses: AAV8-hSyn-hM3D(Gq)-mCherry (gift from B. Roth, Addgene viral prep #50474-AAV8; RRID:Addgene_50474); AAV8.2-synapsin-mCherry (Virovek, Hayward, CA); AAV8.2-hEF1a-synaptophysin-mCherry (Massachusetts General Hospital Gene Delivery Technology Core, AAV-RN8, RRID:SCR_012544); AAV/retro-RFP (gift from K. Deisseroth, Addgene viral prep #114472-AAVrg, RRID:Addgene_114472); AAV/retro-GFP (gift from B. Roth, Addgene viral prep #50465-AAVrg, RRID:Addgene_50465); AAV2/retro-CAG-Cre-WPRE (Boston Children’s Hospital Viral Core); AAV8-hSyn-DIO-hM3D(Gq)-mCherry (gift from B. Roth, Addgene viral prep #44361-AAV8; RRID:Addgene_44361)47; AAV8-hSyn-DIO-mCherry (gift from B. Roth, Addgene viral prep #50459-AAV8; RRID:Addgene_50459); AAV8-EF1a-mCherry-flex-dtA (Canadian Neurophotonics Platform Viral Vector Core Facility, RRID:SCR_016477,)48; AAV1-hSyn-Cre (gift from J.M. Wilson, Addgene viral prep #105553-AAV1, RRID:Addgene_105553); AAV.Syn.GCaMP6m.WPRE.SV40 was a gift from Douglas Kim & GENIE Project (Addgene viral prep # 100841-AAV9; http://n2t.net/addgene:100841 ; RRID:Addgene_100841)49; PRV-152 (gift from L. Enquist)50.
Calcium imaging: Stereotaxic injection and fiberoptic cannula implantation
Animals were anesthetized with 2% isoflurane and placed in a stereotaxic head frame (Kopf Instruments). Ophthalmic ointment was applied to the eyes and subcutaneous injections of meloxicam (5 mg/kg) and Enrofloxacin (5mg/kg) were given to each animal prior to surgery. The scalp was shaved and scrubbed with iodine and alcohol and an incision made on the midline. A craniotomy was made using a dental drill (0.5mm) at the following coordinates AP: -1.4mm, ML: +2.5mm, DV: 5.35mm. 300 nl of pAAV9.Syn.GCaMP6m was injected at a rate of 100 nl/min using a 10 µl Hamilton syringe controlled by a micro-injector. The needle remained in the injection site for two minutes following completion of delivery before being raised 0.1 mm for a further two minutes before being completely retracted. A fiberoptic cannula (MFC_400/430-0.66_6mm_MF1.25_FLT) (Doric, Quebec) was implanted 0.2mm dorsal to viral injection during the same surgery and was secured to the skull using dental cement (Pearson Dental, CA) and three screws (Plastics One, TX). Animals were allowed at least 6 weeks for recovery and to facilitate sufficient viral expression prior to any experimental procedures.
Fiber Photometry
Mice were tethered to a patch cable (Doric Lenses, MFP_400/430/1100-0.57_3m_FCM-M1.25). Calcium signals were collected using the Doric® Fluorescence MiniCube and fiber photometry console at a sampling frequency of 12 kHz. GCaMP calcium signal (465nm) and UV isosbestic signal (405nm) were collected through the same fiber and equalized to record an equivalent signal/noise ratio. Custom-generated MATLAB (Mathwork) scripts were used to down-sample and normalize the fluorescence signal. The 405 isobestic fluorescence signal was filtered using a polyfit regression giving a fitted control (F405c). ΔF/F was calculated by subtracting F405c from the GCaMP fluorescence signal (F405) and then dividing by F405c (F465 – F405c)/F405). A Z-score conversion was used to calculate the deviation of the resulting ΔF/F from the averaged signal of the entire recording session.
Restraint stress (manual)
Once animals were tethered to the patch cord they were placed in a clean novel cage with bedding and recording was started. A 1 minute baseline recording was collected prior to the animal being manually restrained for 20 seconds. The animal was then released and an additional 1 minute of calcium activity was recorded.
Restraint stress (cone)
Prior to being tethered to the patch cable animals were restrained in a plastic DecapiCone (Braintree Scientific, MA) and placed in a clean novel cage with bedding. A small incision was then placed over the fiber and the patch cord was connected. Calcium transients were recorded for 20 minutes while the animal remain secured in the DecapiCone. At this point an incision was made in the cone to release the animal and recording continued for an additional 15 minutes.
Territorialized cage stress
Animals were tethered to a patch cord and were placed in a clean novel cage with bedding and recording started. A 5 minute baseline was collected in the “clean” novel cage before the animal was manually picked up by the base of the tail and placed in a novel territorialized cage that was previously occupied by 5 males for 1 week. The animals remained in this cage while calcium transients were recorded for 2 minutes before the animal was placed back in the previous clean cage for 3 minutes. To examine the effects of repeated stress, this cycle was repeated an additional 4 times with a novel territorialized cage each cycle and the same clean cage.
In vivo behavioral testing
Mice were handled for 5-10 days before experiments. Following stereotaxic surgeries, mice were allowed to recover for 3-6 weeks before the start of testing. Where applicable, clozapine-N-oxide (CNO) (Sigma, NIH) was dissolved in 10% DMSO in saline and delivered at a dose of 3 mg/kg, ip. Investigators were blinded to treatment groups.
Restraint stress
Mice were fasted for 6h and then either briefly handled and returned to home cage (controls) or restrained in a 50-mL falcon tube with a hole cut for air at the conical end for 30 minutes. Blood glucose was measured before and after the 30 minutes period. When noted, blood glucose was measured every minute for the first 5 minutes of the stressor to assess the time course of stress-induced hyperglycemia. To measure the hormonal and gene expression responses to stress, mice were rapidly anesthetized with 3% isoflurane and blood collected before being euthanized for tissue collection (e.g. liver) at the end of the restraint period. To measure cfos in the MeA after restraint stress, mice were anesthetized with 3% isoflurane and perfused transcardially with 0.9% saline followed by 10% formalin, and the brain was removed 2h after the start of the restraint. For DREADD modulation studies, CNO was administered 30 minutes before restraint.
Territorialized cage stress
Mice were placed in an empty, dirty cage previously occupied by 5 male mice. Blood glucose or food intake was measured before and after the 30 minutes period. For blood glucose measurement, mice were fasted for 6h. When noted, blood glucose was measured every minute for the first 5 minutes of the stressor to assess the time course of stress-induced hyperglycemia. To measure food intake, mice were food deprived overnight before placing in the territorialized cage. For DREADD modulation studies, CNO was administered immediately before the test.
Repeated territorialized cage stress
To determine the effects of repeated stress on blood glucose, blood glucose was measured before being placed in an empty, dirty cage previously occupied by 5 male mice. The animals remained in this cage for 5 minutes before blood glucose was measured that the animal was placed back into its home cage for 25 minutes. This cycle was repeated an additional 4 times with a novel territorialized cage each cycle.
Food intake studies
Mice were food deprived overnight, food deprived for 6 hours in the light phase or allowed to eat ad libitum. Food, either in the form of standard rodent chow or palatable food (peanut butter) was then provided in excess, and consumption of food was measured every hour. For DREADD modulation studies, CNO was administered immediately before food was provided.
Metabolic studies
For baseline glucose measurements after DREADD modulation, mice were fasted for 6h, and tail vein samples for blood glucose were taken at 0, 30, 60, 90 minutes after i.p. injection of CNO. Later time points were measured in MeAVMH activation studies (120, 150, and 180 minutes after i.p. injection of CNO). To measure tolerance to a glucose challenge, mice were fasted for 6h and tail vein samples for blood glucose were taken at 0, 10, 20, 30, 45, 60, 90, and 120 minutes after injection of glucose (2g/kg body weight). When noted, additional blood was collected at 0, 10, 30, 60, and 90 minutes after glucose injection to measure plasma insulin and glucagon. To measure insulin sensitivity and tolerance to an insulin challenge, mice were fasted for 4h and tail vein samples for blood glucose were taken at 0, 30, 60, 90, and 105 minutes after injection of insulin (0.4-0.6 U/kg body weight, Humulin R HI-210). To measure gluconeogenic capacity, mice were fasted for 4h and tail vein samples for blood glucose were taken at 0, 30, 45, 60, 90, and 105 minutes after i.p. injection of pyruvate (2g/kg body weight, Sigma #P5280). For all metabolic challenges, CNO was injected 30 minutes before the challenge/timepoint 0.
Open field activity
Locomotion and anxiety-like behavior were measured in either a clear plexiglass 40 × 40 × 30-cm open field arena using Fusion Software (v5.0) (Omnitech Electronics) or a white acrylic 18 x 18 x 18 in arena using Ethovision XT (Noldus Information Technology Inc., Leesburg, VA) to quantify behavior. Distance traveled and time spent in the center of the open field arena were measured. The test lasted 10 minutes. For DREADD modulation studies, CNO was administered 60 minutes before the start of the test.
Elevated plus maze and light-dark box
The light-dark box test was performed on the same 40 × 40 × 30-cm arena as the open field, except a black box was placed on the half the arena to shield it from light. The mice were placed in the light portion and tracked using Fusion Software. For the elevated plus maze, the mice were placed on an open arm of an elevated four-arm maze in which two arms are open and two are enclosed. They were tracked using Ethovision software and total time spent in the open arm was measured. Both tests lasted 10 minutes and CNO was administered 60 minutes before the start of the test.
High fat diet
Mice with MeAVMH expression of dtA or GFP were fed a high fat diet (Research Diets, D12492, 60% fat). Food intake, body weight and blood glucose were measured every 3-7 days for 20 days.
Tissue processing
Blood glucose was determined using a Contour or Contour Next EZ glucometer (Bayer; Leverkusen, Germany). Blood was collected in an EDTA-coated tube (Sarstedt Microvette CB 300 K2E 16.444.100), spun for 10 minutes at 2,000 rpm, 4oC then plasma was separated and stored at -80oC until assay. Liver was flash frozen in liquid nitrogen for gene expression analysis, glycogen and protein analyses, aliquoted and stored at -80°C until processing. Plasma levels of insulin (Mercodia #10-1247-01), glucagon (Crystal Chem #81518), corticosterone (Crystal Chem #80556), epinephrine and norepinephrine (Abnova #KA1877) were determined by ELISA. Liver glycogen was determined by colorimetric assay (Abcam #ab169558). Circulating glycerol and triglyceride levels were measured by enzymatic assay (Sigma-Aldrich # TR0100).
Western blot
Liver tissue (~20mg) was lysed in 600µl buffer (20 mM Tris, pH 7.4, 150 mM NaCl, 2% Nonidet P-40, 1 mM EDTA, pH 8.0, 10% glycerol, 0.5% sodium deoxycholate, 0.2% semi-dehydroascorbate) supplemented with halt protease and phosphatase inhibitor (Cell Signaling). Livers were first homogenized using Beadbug (Benchmark) and lysates were further sonicated in ice-cold water for 5 min. After centrifuge at 14,000 rpm at 4°C for 10min, the protein supernatants were transferred to a new tube and protein concentration was determined by BCA protein assay kit (Pierce). 30 μg protein was mixed with 6x SDS sample buffer (#BP-11R, Boston BioProducts) and boiled for 5min before loading on SDS-PAGE. Biorad wet transfer system was used. PVDF membranes were blocked with 5% dry milk in TBST (TBS + 0.05% Tween 20) further incubated with primary antibodies (dilute in TBST with 3% BSA+0.05% NaN3) at 4°C overnight. PCK1 (#ab70358), PGC1a (#ab54481), FoxO1 (#ab39670), GAPDH (#ab9485) antibodies were from Abcam. G6PC(#NBP1-80533) was from Novus Biologicals. The membrane was washed 4x in TBST with shaking for 10 minutes prior to incubation with secondary antibodies (dilution 1:10,000 in TBST) for additional 2 hr at room temperature (RT). Immune complexes were washed 4x in TBST with shaking for 10 minutes at RT. Membranes were further reacted with PierceTM ECL western blotting substrate and imaged with iBright CL1500 (Thermofisher). Western blot was quantified by Image J.
Quantitative PCR
Total RNA was extracted from tissue by homogenization in Trizol (Invitrogen) followed by chloroform (Sigma) extraction and isolation using the RNeasy Plus Mini (Qiagen) kit according to manufacturer's instructions. Complimentary DNA was prepared by reverse transcription of 500 ng total RNA using qScript cDNA SuperMix (Quantabio). The resulting cDNAs were diluted 1: 10 then amplified by real-time PCR using the SYBR green system (Applied Biosystems) according to the manufacturer’s protocols. All mRNA expression data were normalized to rpl23 expression in the corresponding sample. Fold change in mRNA expression was calculated using the delta-delta Ct method51. The follow primers were used: PCK1 forward – GCGAGTCTGTCAGTTCAATACC, reverse – GGATGTCGGAAGAGGACTTTG; G6Pc forward – GGAGGCTGGCATTGTAGATG, reverse – TCTACCTTGCTGCTCACTTTC; Rpl23 forward – ACTTCCTTTCTGACCCTTTCC, reverse – TTAGCTCCTGTGTTGTCTGC; PGC1a forward – TGAGGACCGCTAGCAAGTTT, reverse – TGTAGCGACCAATCGGAAAT; FoxO1 forward – GCGTGCCCTACTTCAAGGATAA, reverse – TCCAGTTCCTTCATTCTGCACT; Glut2 forward – GTTGGAAGAGGAAGTCAGGGCA, reverse – ATCACGGAGACCTTCTGCTCAG; IRS2 forward – CCAGTAAACGGAGGTGGCTACA, reverse – CCATAGACAGCTTGGAGCCACA; IGFBP1 forward – GCCCAACAGAAAGCAGGAGATG, reverse – GTAGACACACCAGCAGAGTCCA.
Immunohistochemistry
Brains
The brains of perfused mice were post-fixed in 4% paraformaldehyde at 4°C overnight. 50 mm coronal slices were cut by vibratome (Leica VT1000). For cfos staining, slices were incubated in blocking solution overnight at 4°C (3% normal donkey serum [NDS, Sigma] in 0.01% Triton-X in 0.01M PBS [PBT]) and then in primary antibody in blocking solution at 4°C. The following primary antibodies, concentrations, and incubation periods were used: Cell Signaling rabbit monoclonal anti-cfos (#2250) – 1:500 for 72h; abcam chicken polyclonal anti-mCherry (#ab205402) – 1:1000 overnight or with abcam chicken polyclonal to tyrosine hydroxylase [#ab76442] – 1:500 for 72 hrs. The slices were then washed in 0.01M PBS (3 x 1h), incubated in secondary antibody in blocking solution for 2h at RT, and washed in PBS (2 x 1h), with a final wash overnight at 4°C. The following secondary antibodies and concentrations were used: Jackson Alexa Fluor 647 AffiniPure donkey anti-rabbit (#711-605-152) – 1:250; Jackson Alexa Fluor® 594 AffiniPure donkey anti-chicken (#703-585-155) – 1:2000.
For RFP/mCherry staining to enhance endogenous fluorescence of AAV/retro-RFP, AAV8-hSyn-DIO-hM3D(Gq)-mCherry, and AAV8.2-hEF1a-synaptophysin-mCherry, slices were washed in 0.01M PBS (3 x 10 minutes), incubated in blocking solution (3% NDS in 0.01% PBT) for 1h at RT, incubated in primary antibody (Rockland rabbit polyclonal anti-RFP [#600-401-379] –1:1000) overnight at 4°C, washed in 0.01% PBT (3 x 10 minutes), incubated in secondary antibody (Invitrogen donkey anti-rabbit Alexa Fluor 594 [#A-21207] – 1:500), and washed in PBS (3 x 10 minutes). For GFP staining to enhance endogenous fluorescence of AAV/retro-GFP or PRV-GFP, slices were washed in 0.01M PBS (3 x 10 minutes), incubated in blocking solution (3% NDS in 0.01% PBT) for 1h at RT, incubated in primary antibody (Abcam goat polyclonal anti-GFP (#ab5450) –1:1000) overnight at 4°C, washed in 0.01% PBT (3 x 10 minutes), incubated in secondary antibody (Invitrogen donkey anti-goat Alexa Fluor 488 #A-11055 – 1:500), and washed in PBS (3 x 10 minutes).
Celiac ganglia
The celiac ganglia were dissected from MeAàVMHhM3Dq or mCherry control mice euthanized 2h after CNO administration. The tissue was post-fixed in 4% paraformaldehyde at 4°C overnight, cryo-protected in 30% sucrose (Sigma-Aldrich, 50389) in PBS, embedded in O.C.T Compound (Thermofisher Scientific, Watham, MA; 23-730-572), frozen at -80°C, and sectioned at 10µm thickness. Slides were washed in 0.03% PBT (3 x 5 minutes), incubated in blocking solution overnight at 4°C (2% normal donkey serum, 3% bovine serum albumin in 0.03% PBT), incubated in primary antibodies for 48h at 4°C (Cell Signaling anti-cfos – 1:100; abcam chicken polyclonal to tyrosine hydroxylase [#ab76442] – 1:500), washed in 0.03% PBT (3 x 5 minutes), incubated in secondary antibodies for 2h at RT (Jackson AF-647 donkey anti-rabbit – 1:250; Jackson AF-594 donkey anti-chicken – 1:500), and washed in 0.03% PBT (3 x 5 minutes). After staining, tissue sections were mounted with DAPI counterstain (Fluoromount).
Image quantification
All confocal images were taken at 20X and tiled. All image analyses were performed using FIJI. Investigators were blinded to treatment groups for cfos analyses.
Synaptophysin-mCherry
Four weeks after stereotactic surgery, mice were perfused and brains were sliced and stained to enhance mCherry staining. Confocal images were then taken using a Zeiss LSM 780 confocal microscope. Regions of interest (ROI) were drawn based on DAPI staining and the Franklin and Paxinos mouse brain atlas52. The same selection was used for each brain region to normalize for area analyzed and fluorescence intensity was measured within the ROI. Values are reported as median pixel intensity ± standard error of the median.
Cfos in the brain
Z-stack confocal images were taken using an upright Zeiss LSM 900 (restraint vs. control). To measure cfos expression after stress, an ROI was drawn around the MeA complex, including the dorsal, ventral, and basomedial subregions. Images were made binary and cell quantification was performed using the ‘analyze particle’ function. The JaCOP plugin53 was used to measure total expression of cfos after restraint stress or control, overlap of cfos with AAV/retro-RFP (BNST-projecting neurons) and AAV/retro-GFP (VMH-projecting neurons) and overlap of cfos with tyrosine hydroxylase in the locus coeruleus.
Cfos in the celiac ganglia
Z-stack confocal images were taken using a Zeiss LSM 900. Tyrosine hydroxylase (TH) expression was used as a mask to select an ROI of only neurons. Then overlap of cfos and DAPI was measured using the JaCOP plugin. Data is reported as number of cfos-positive DAPI particles.
Quantification and statistical analysis
All data are presented as mean ± SEM unless otherwise indicated. No statistical methods were used to pre-determine sample sizes but our sample sizes are similar to those reported in previous publications.
Injection sites were visualized and verified following behavioral experiments. Animals were excluded for virus expression outside of the MeA or for insufficient virus expression within the MeA. All mice in the Cre-independent DREADD activation experiment (Fig. 2C-I) showed viral spread into the LH; data shown is from DREADD animals with > 60% virus expression in the MeA.
Analyses were performed in RStudio or with Prism (Graphpad, version 9.4.1). Analyses in R were performed with R 3.6 using the lme4, lmerTest, emmeans, and car packages54,55. If the total number of data points for an experiment was less than 30, the data was tested for normality using the Shapiro-Wilk test. If the data was normally distributed or n > 30, data were analyzed with statistics were performed using Student’s unpaired two-tailed t-test for comparison between 2 groups, and One-Way Analysis of Variance (ANOVA) with Tukey’s post-hoc HSD for comparison between multiple groups. Repeated studies were examined using a generalized linear mixed model with mouse identity as a random effect to account for repeated sampling across time or two-way repeated measures ANOVA. Cohort was included as a fixed variable where applicable. P values were adjusted using post-hoc testing (e.g. Tukey or Sidak’s testing) for multiple comparisons. If the data was not normally distributed, it was analyzed with the Mann-Whitney U test or Kruskall-Wallis rank sum test with Dunn's post hoc tests. Outliers were defined as values 2 standard deviation above or below the mean per group per time point (where applicable) and removed from analyses. P-values <0.05 were considered to be significant.