Materials
All reagents used were of the highest grade and purchased from Sigma-Aldrich unless stated otherwise.
DNA constructs
Two protein sequences from Absynth Biologics Ltd’s portfolio of antigens from C.Difficile, Ant2 (YdiE/ TsaD) and Ant3 (DivIB/FtsQ) were cloned into the pET21d(+) expression vector (Novagen) using NcoI (5’) and XhoI (3’) restriction sites. In addition, both protein sequences were joined in different orientations to form fusion proteins, fusion 1 (Ant2-Ant3, Ant2-3) and fusion 2 (Ant3-Ant2, Ant3-2) and cloned separately into the pET21d(+) vector. All constructs contained a C-terminal 6×His tag for detection and purification.
The coding sequence for fusion 2 (Ant3-2) was cloned into three different pET16 parental expression vectors (provided by EA McKenzie) with a cleavable N-terminal 6×His tag alone and in combination with a thioredoxin (Trx) or N utilisation substance protein A (NusA) solubility tag (termed pHis, pHisTrx and pHisNusA respectively). Ant3-2 coding sequences were amplified by polymerase chain reaction (PCR, Table I) and cloned into the three parental expression vectors using BamHI (5’) and EcoRI (3’) restriction sites. BamHI and EcoRI restriction sites were introduced into PCR product via the forward and reverse primer respectively (Table I). Sequences for Ant2, Ant3 and fusion 1 (Ant2-3) were amplified by PCR using primers designed using the In-Fusion® primer design tool (Table I) and cloned into pHisNusA using the In-Fusion® HD cloning method (Clontech, cat no. 638916) as per the manufacturers instructions.
Table I: Summary of primers used for PCR amplification of antigen coding sequences.
Primer
|
Sequence (5’-3’)
|
Ant2
|
Forward
|
GTACTTCCAGGGATCCAATCACATCGAAGGCCATCTGT
|
Reverse
|
CCGGATCTTAGAATTCTTATTATCCCTCCGGAGAGTATACCGC
|
Ant3
|
Forward
|
GTACTTCCAGGGATCCATGGCAAATCATATAGAAGG
|
Reverse
|
CCGGATCTTAGAATTCTTATTACTGATTTATCTTTAAATTTGG
|
Fusion 1
(Ant2-3)
|
Forward
|
GTACTTCCAGGGATCCATGGCAGTAAAGAAAATAGA
|
Reverse
|
CCGGATCTTAGAATTCTTATTATCCTTCTGGACTATACACTG
|
Fusion 2
(Ant3-2)
|
Forward
|
CACGGATCCGTCAAAAAGATTGATGTGATTG
|
Reverse
|
CACGAATTCTTATTACTGATTAATTTTCAGGTTTG
|
This table summarises the forward and reverse primers for PCR amplification of each antigen coding sequence. Restriction sites introduced in the forward (BamHI) and reverse (EcoRI) primer restriction sites (bold) and overhangs generated for In-Fusion® HD cloning (underlined) are highlighted.
Small-scale bacterial expression
DNA constructs for the single antigens (Ant2 and Ant3) and fusions (Ant2-3 and Ant3-2) were transformed into BL21-CodonPlus (DE3) E.coli cells. A single colony was used to inoculate 5ml overnight culture (LB broth with 100μg/ml Ampicillin). The next day, bacterial cultures were seeded from the overnight culture (1:100 dilution) in a total volume of 100ml LB broth containing Ampicillin (100μg/ml final concentration). The cells were grown at 37°C with shaking at 220rpm. The optical density at 600nm (OD600) for each culture was monitored until an OD600 of 0.5-0.7 was reached. The expression of the recombinant antigens was induced with Isopropyl β-D-1-thiogalactopyranoside (IPTG, 0.2mM final concentration), followed by incubation at 37°C, 30°C or 18°C for 20 h at 220rpm. For growth at lower temperatures (30°C and 18°C) cultures were cooled to the appropriate temperature prior to induction. Cultures were harvested by centrifugation (4000rpm, 4°C for 20mins). Cell pellets were re-suspended in 4ml ice-cold lysis buffer (25mM Tris-HCl pH 7.9, 0.3M NaCl, 1% (v/v) Triton-X100, 0.2% (v/v) protease inhibitor cocktail) and sonicated on ice (7 cycles, 30sec on/off pulses at 35% amplitude, QSonica sonicator ultrasonic processor, Q125). After lysis, an aliquot (40μl) of the bacterial lysate (total fraction) was isolated for SDS-PAGE and western blot analysis. The insoluble and soluble fractions were isolated by centrifugation (15,000rpm, 4°C for 15mins). Aliquots (40μl) of the soluble fraction (supernatant) and insoluble fraction (pellet) were isolated for SDS-PAGE and western blot analysis.
Large-scale bacterial expression
DNA constructs were transformed into BL21-CodonPlus (DE3) E.coli cells. A single colony was used to inoculate a 5ml starter culture (LB broth with 100μg/ml Ampicillin) and incubated at 37°C, 220rpm for ~6h. The overnight culture was inoculated with 50μl of the starter culture in 50ml selective LB broth (1:1000 dilution) and incubated overnight at 37°C with shaking at 220rpm. The next day, bacterial cultures were seeded from the overnight culture (1:100 dilution) in a total volume of 1L LB broth containing Ampicillin (100μg/ml final concentration). The cells were grown at 37°C with shaking at 220rpm. At the correct OD600 (0.5-0.7), cultures were cooled (4°C for 30mins) and induced with IPTG (0.2mM final concentration) for 20 h at 18°C, 220rpm. Cultures were harvested by centrifugation (5000rpm, 4°C for 10mins). The dry pellet weight was recorded and cell pellets were re-suspended in 30ml ice-cold lysis buffer and sonicated on ice (7 cycles, 30sec on/off pulses at 25% amplitude, Bandelin Sonoplus sonicator, HD3200). After lysis, an aliquot (40μl) of the bacterial lysate (total fraction) was isolated for SDS-PAGE and western blot analysis. The insoluble and soluble fractions were isolated by centrifugation (17,000rpm, 4°C for 30mins). Aliquots (40μl) of the soluble fraction (supernatant) and insoluble fraction (pellet) were isolated for SDS-PAGE and western blot analysis.
Protein re-folding
After high-speed centrifugation of the total fraction, the isolated inclusion body enriched pellet (insoluble fraction) was used for protein re-folding purposes. The pellet was re-suspended in either 4ml (small-scale) or 30ml (large-scale) urea buffer (5mM imidazole, 1M NaCl, 40mM Tris-HCL pH 7.9, 8M urea and 0.14% (v/v) β-mercaptoethanol) and sonicated (5 cycles, 30 secs on/off pulses at 25% amplitude). The suspension was centrifuged at 17,000rpm, 18°C for 30mins to remove cell debris. The supernatant was isolated for purification.
His-tag purification
For small-scale purification (100ml bacterial culture) from the soluble fraction, 1ml Ni-NTA agarose (50% suspension, Qiagen) was washed twice with 14ml ice-cold phosphate buffered saline (PBS) buffer in a 15ml falcon tube. For large-scale purifications (1L bacterial culture), 5ml Ni-NTA agarose was washed twice with 45ml ice-cold PBS in a 50ml falcon tube.
Purification from the soluble fraction
All incubation steps were carried out at 4°C and spin steps completed at 4000rpm, 4°C for 5 mins (small-scale) or 10 mins (large-scale).
For small-scale purification, the Ni-NTA resin was equilibrated with 2ml ice-cold lysis buffer and then spun down and supernatant was discarded. 4ml suspension (soluble fraction) was added to the resin and incubated on a roller for 2 h at 4°C. After incubation, the suspension was spun down and the flow through collected. The resin was washed three times with increasing imidazole concentrations, first with 10ml buffer 1 (25mM Tris-HCl pH 7.9, 0.3M NaCl, 5mM imidazole, 0.2% (v/v) protease inhibitor cocktail), then 10ml buffer 2 (25mM Tris-HCl pH 7.9, 0.3M NaCl, 10mM imidazole) and a third time with 10ml buffer 3 (25mM Tris-HCl pH 7.9, 0.3M NaCl, 15mM imidazole) for 1 min each. After each wash the suspension was spun down and supernatant (washes 1-3) isolated. Soluble proteins were eluted with elution buffer (25mM Tris-HCl pH 7.9, 0.3M NaCl, 250mM imidazole) in 3 x 1ml steps (E1-E3) at 4°C. All eluates were stored at 4°C.
For large-scale purification, the Ni-NTA resin was equilibrated with 10ml ice-cold lysis buffer and then spun down and supernatant was discarded. 30ml suspension (soluble fraction) was added to the resin and incubated on a roller for 2 h at 4°C. After incubation, the suspension was spun down and the flow through collected. The resin was washed three times consecutively with 50ml each of buffer 1, buffer 2 and buffer 3 for 20 min at 4°C. After each wash the suspension was spun down and supernatant isolated. Soluble proteins were eluted with elution buffer in 9 x 1ml steps (E1-E3) at 4°C.
At each stage, 100μl aliquots of each fraction (flow through, washes and eluates) were collected for protein concentration determination, SDS-PAGE and western blot analysis.
Purification from the insoluble fraction
For small-scale purifications (100ml bacterial culture), all spin steps were carried out at 4000rpm, 4°C or room temperature for 5 mins. The resin was equilibrated with 2ml urea buffer and then spun down. The supernatant was discarded. 4ml suspension (pellet/insoluble fraction) was added to the resin and incubated on a roller overnight at room temperature. The next day, the suspension was spun down and the flow through collected. The resin was washed with 10ml buffer A (5mM imidazole, 1M sodium chloride, 20mM Tris-HCL pH 7.9, 8M urea) for 1 min at room temperature. The suspension was spun down and supernatant (wash 1) isolated. The resin was washed with 10ml buffer B (5mM imidazole, 1M sodium chloride, 20mM Tris-HCL pH 7.9 and 0.14% (v/v) β-mercaptoethanol) for 1 min at room temperature. The suspension was spun down and supernatant (wash 2) isolated. The resin was washed a third time with 10ml buffer C (60mM imidazole, 0.5M sodium chloride, 20mM Tris-HCL pH 7.9 and 0.14% (v/v) β-mercaptoethanol) for 1 min at 4°C. The suspension was spun down at 4°C and supernatant (wash 3) isolated. Re-folded proteins were eluted with buffer D (1M, 0.5M sodium chloride, 20mM Tris-HCL pH 7.9 and 0.14% (v/v) β-mercaptoethanol) in 3 x 1ml steps (E1-E3) at 4°C. Insoluble proteins bound to the resin (after re-folding) were eluted with a denaturing elution buffer, buffer E (5mM imidazole, 1M sodium chloride, 20mM Tris-HCL pH 7.9, 8M urea, EDTA) in 3 x 1ml steps (DE1- DE3) at room temperature. All eluates were stored at 4°C.
For large-scale purifications (1L bacterial culture), all spin steps were carried out at 4000rpm, 4°C or room temperature for 10mins. Following the washes the resin was equilibrated with 10ml urea buffer and then spun down. The supernatant was discarded. 30ml suspension (pellet/insoluble fraction) was added to the resin and incubated on a roller overnight at room temperature. The next day, the suspension was spun down and the flow through collected. The resin was washed consecutively with 50ml buffer A then buffer B for 20 min at room temperature on a roller. After each wash the suspension was spun down and supernatant isolated. The resin was washed a third time with 50ml buffer C for 20 min at 4°C on a roller. The suspension was spun down at 4°C and supernatant isolated. The resin was transferred to an empty single gravity flow chromatography column and re-folded proteins were eluted with buffer D in 5 x 1ml steps (E1-E5) at 4°C. Insoluble proteins (after-re-folding) were eluted with buffer E in 4 x 1ml steps (DE1- DE4) at room temperature. All eluates were stored at 4°C.
At each stage, an aliquot (100μl) of each fraction was collected for protein concentration determination and characterization by SDS-PAGE and western blot.
Determination of protein concentration
An estimate of the protein concentration was determined for purified samples using the Bio-Rad DC™ Protein Assay kit as per the manufacturers instructions.
SDS-PAGE and western blotting
SDS-PAGE (12.5% (w/v)) gels were prepared and run using the Bio-Rad mini PROTEAN Tetra system. Protein samples were mixed in equal volume with 2× loading buffer (125mM Tris-HCl, 4% (w/v) SDS, 20% (v/v) glycerol, 0.01% (v/v) bromophenol blue). Under reducing SDS-PAGE conditions, 2×-sample buffer was supplemented with 1.8% (v/v) β-mercaptoethanol. Samples were heated to 100°C for 5 mins and cooled before loading. The following total volume of sample was loaded, 5μl of the total induced (T), pellet/insoluble (P) and soluble (S) fraction and Bovine serum albumin (BSA) protein standard. For purified protein samples, 15μl total volume was loaded. SDS-PAGE was performed in electrode buffer (25mM Tris base, 190mM glycine, 0.1% w/v SDS, pH 8.3). The marker and samples were electrophoresed at 60V through the stacking gel and then 200V until the dye front reached the bottom of the gel.
For western blot analysis, proteins separated by SDS-PAGE were transferred onto nitrocellulose membrane using the TE 22 wet transfer unit at 300mA for 2 h. Blots were blocked for 1 h at room temperature in 5% (w/v) non-fat milk in phosphate buffered saline (PBS, 137mM NaCl, 2.7mM KCl, 10mM Na2HPO4, 2mM KH2PO4, pH 7.4) with 0.1% (v/v) Tween-20 (5% mPBS-T). A mouse monoclonal anti-6×His tag primary antibody (1:4000 dilution, Abcam, ab18184) and donkey anti-mouse secondary antibody (1:15000, LI-COR Biosciences, 926-32212) were prepared in 5% mPBS-T and incubated with blots for 1 h at room temperature. Blots were imaged using the LI-COR Odyssey® Classic imager according to the manufacturer’s instructions. Analysis and quantification of bands was completed using the LI-COR Image Studio™ Lite software.
Protein identification
Protein samples were separated by SDS-PAGE and submitted to the protein identification service (Manchester Institute of Biotechnology, University of Manchester). Protein samples were gel extracted, trypsin-digested and analysed by Dr. Martin Read using mass spectroscopy.
Protein solubility screen
The solubility of purified protein samples was profiled in different formulations using the Optisol™ III protein soluble screening kit (Soluble Bioscience) as per the manufacturers instructions. Ant2 and Ant3 were expressed in the BL21-CodonPlus (DE3) E.coli strain (1L total volume) and proteins were re-solubilised in urea buffer from the insoluble fraction and purified via the 6×His-tag. Proteins were eluted and the protein concentration was determined (Table AI). The top three concentrated samples were pooled for screening. A blank absorbance reading (280nm) was taken of the plate with reagent alone. 15μl of the pooled protein sample was mixed with 150μl of reagent per well and incubated at 37°C for 24 h (stressed conditions). Following incubation the soluble protein was collected by centrifugation (3000rpm, 30min). The absorbance was measured after isolation of the soluble protein and the blank subtracted from these values. The data was subsequently analysed using the Protein Dashboard™ (supplied by Soluble Bioscience).
Use of predictive tools for sequence- and structural-based analysis of antigens
Amino acid sequences for all antigens were analysed using Jpred 4 (protein secondary structure prediction server) [41] and ProteinSol (predictive protein solubility tool) [25].
Three-dimensional structural models for Ant2 and Ant3 sequences were generated in SWISS-MODEL [42, 43]. Models were based on sequence homology of both C.difficile Ant2 and Ant3 sequences from this study with published structures, in the protein data bank (PDB), of their corresponding E.coli homologs, YdiE (PDB ID: 4wq4) and FtsQ (PDB ID: 2vh1) respectively. Structural models for fusion proteins (Ant2-3 and Ant3-2) could not be generated. The structural models for Ant2 and Ant3 were analysed using the ProteinSol algorithm (in collaboration with Dr. J Warwicker, University of Manchester). The algorithm was used for a sequence-based solubility prediction and a structural-based prediction where surface mapping of model structures were analysed in terms of electrostatic potential (positive vs. negative charge) and hydrophobicity (polar vs. non-polar).
Data analysis
All results are presented as the mean ± standard error of the mean (SEM) for at least three biological replicates. All graphs were plotted in Graphpad Prism® (Version 6.02).