Backbone resonance assignments of the C-terminal region of human translation initiation factor eIF4B

doi:10.21203/rs.3.rs-2926413/v1

Download PDF

Research Article

Backbone resonance assignments of the C-terminal region of human translation initiation factor eIF4B

https://doi.org/10.21203/rs.3.rs-2926413/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 27 Jun, 2023

Read the published version in Biomolecular NMR Assignments →

You are reading this latest preprint version

Translation initiation in eukaryotes is an early step in protein synthesis, requiring multiple factors to recruit the ribosomal small subunit to the mRNA 5’ untranslated region. One such protein factor is the eukaryotic translation initiation factor 4B (eIF4B), which increases the activity of the eIF4A RNA helicase, and is linked to cell survival and proliferation. We report here the protein backbone chemical shift assignments corresponding to the C-terminal 279 residues of human eIF4B. Analysis of the chemical shift values identifies one main helical region in the area previously linked to RNA binding, and confirms that the overall C-terminal region is intrinsically disordered.

Translation initiation

eIF4B

intrinsically disordered region

IDP

At its core, translation initiation in eukaryotes involves recruitment of the small ribosomal subunit with associated protein factors (the 43S pre-initiation complex) onto the protein-coding mRNA (Jackson et al. 2010). This process is usually achieved by the help of a mRNA cap-binding complex known as eukaryotic translation initiation factor 4F (eIF4F; comprising the three factors eIF4E, eIF4A and eIF4G), as well as eIF4B (or the homologue eIF4H) (Merrick 2015). In a concerted action, these factors recognize the mRNA 5’-cap and unwind the structured elements at the 5’-end untranslated region (5’-UTR) of the mRNA. This action facilitates the recruitment of the 43S pre-initiation complex, the scanning of the mRNA towards the start-codon recognition, and also ribosome assembly (Jackson et al. 2010). Throughout this process, eIF4B stimulates the helicase activity of eIF4A (Rogers et al. 2001; Jackson et al. 2010; Özeş et al. 2011), and increases the processivity of eIF4A helicase function (García-García et al. 2015). Thus, the function of eIF4B is particularly crucial for translation of mRNAs with structured 5’-UTRs (Shahbazian et al. 2010; Sen et al. 2016). At the molecular level, human eIF4B is a 611 residue RNA-binding protein comprising a structured RNA recognition motif (RRM) domain near the N-terminus, as well as non-canonical RNA-binding region within the C-terminal region (CTR). Early work had identified amino acids 385–423 as the center of this C-terminal RNA-binding region (Méthot et al. 1994)(Naranda et al. 1994), and identified an additional stretch of basic residues from 434–444 that might be involved. The minimal region of eIF4B required for interaction with eIF4A (in complex with RNA and AMP-PNP) is also located within the CTR (Rozovsky et al. 2008). IN addition, several physiologically significant phosphorylation sites were reported within the CTR of eIF4B, among which the Ser406 and Ser422 have been shown to stimulate translation in vivo (Shahbazian et al. 2006; Wang et al. 2016). While the structure of the human eIF4B RRM domain has already been determined (Fleming et al. 2003), the eIF4B CTR is predicted to be intrinsically disordered and currently lacks characterization at the atomic level.

With a future goal to look at residue-level functions of the eIF4B C-terminal region, we report chemical shift resonance assignments of the backbone ¹H, ¹³C and ¹⁵N nuclei for the complete second half of human eIF4B (residue 333 to 611), as well as two shorter constructs that divide this region into two parts. The chemical shift values are consistent with an intrinsically disordered peptide, except for a helical segment in a region with previous links to RNA binding.

Using the protein sequence of human eIF4B (Uniprot entry P23588), the corresponding DNA codon-optimized for E. coli was obtained (Integrated DNA Technologies). The C-terminal region (CTR; residues 333 to 611) was inserted into the SspI site of the modified pET vector (Addgene plasmid #29666) using the ligation-independent cloning protocol. The vector allows for expression of the construct with an N-terminal hexahistidine (His₆) tag followed by a tobacco etch virus (TEV) protease site. Subsequent PCR amplification using forward (GAAGATTGCTAACATTGGAAGTGG) and reverse (CTTCCAATGTTAGCAATCTTCTTCTTTG) primers were used to subclone the CTR-N fragment (residues 333–457), and similarly a second set of primers (CTTCCAAGGCCATAGCCCGACCAGCAAA, CGGGCTATGGCCTTGGAAGTACAGGTTTTC) were used to subclone the CTR-C fragment (residues 458–611).

Freshly transformed E. coli T7 Express lysY (New England Biolabs) were first grown overnight in 10 mL of lysogeny broth (LB) with 50 µg/ml Ampicillin, then transferred to 500 mL cultures at 37°C in M9 minimal medium containing 1 g/L [¹⁵N]NH₄Cl and 2 g/L [¹³C]glucose. At an OD_260nm of 0.6, protein expression was induced with a final concentration of 0.5 mM isopropyl β-D-1-thiogalactopyranoside (IPTG) followed by overnight growth at 20°C and harvesting the cells by centrifugation. For CTR and CTR-N, the bacteria were resuspended in a lysis buffer consisting of 20 mM Tris-HCl (pH 7.8), 250 mM KCl, 20 mM imidazole, 1 mg/mL lysozyme, 1 mM PMSF, 1% of Triton X-100, 2 mM β-mercaptoethanol, and one protease inhibitor cocktail tablet (Roche). Following sonication on ice (10 min at 40% power, alternating 50s of sonication and 60s of pause), the sample was centrifuged at 40000 x g for 40 min at 4°C to remove cellular debris. The supernatant was filtered with a 0.7 µm glass Microfilter GF/F (GE Healthcare Life Sciences Whatman) and added to 1 mL NUVIA Ni²⁺ affinity chromatography resin (Bio-Rad) in a plastic column, washed first with five column volumes of binding buffer (20 mM Tris-HCl (pH 7.8), 250 mM KCl, 20 mM imidazole, 2 mM β-mercaptoethanol), then three column volumes with a higher salt concentration (800 mM of KCl), and finally five column volumes with increased imidazole concentration (30 mM). The protein was eluted with a buffer containing 20 mM Tris-HCl (pH 7.8), 250 mM KCl, 500 mM imidazole, 2 mM β-mercaptoethanol. Removal of the N-terminal His₆ tag was performed by the addition of TEV protease (15 µg/mg protein) during a dialysis step against 20 mM Tris-HCl (pH 7.8), 250 mM KCl, 5 mM β-mercaptoethanol. Dialysis of the CTR-N sample included 0.5 M urea. For CTR-C, the bacteria pellet was resuspended in a buffer containing 20 mM Tris-HCl (pH 7.5), 500 mM NaCl, 5% glycerol, 5 mM imidazole and 1 mg/mL lysozyme prior to a sonication and lysate preparation similar to the other samples. After loading the CTR-C lysate onto the same affinity chromatography resin as above, the wash step this time included 10 column volumes of the resuspension buffer, then five column volumes with an increase to 25 mM imidazole, and finally elution a further increase to 500 mM imidazole. Removal of the N-terminal His₆ tag was performed by overnight digestion with TEV protease (15 µg/mg protein) at 4°C, following a return to the low imidazole buffer with the use of a PD10 column (Cytiva). For all samples, the protease, His-tag and remaining uncleaved protein were removed by a second Ni²⁺affinity chromatography step. All protein variants were also further purified with anion exchange chromatography (EnrichQ, Bio-rad; HiTrap CM FF, Cytiva). The CTR sample was further purified with reverse-phase HPLC on a C18 column (ReproSil Gold 200) followed by lyophilization. Protein concentration was measured using absorbance at 280 nm with protein extinction coefficients obtained using the ProtParam tool (http://web.expasy.org/protparam): 19480 M^− 1 cm^− 1 (CTR), 5500 M^− 1 cm^− 1 (CTR-N), and 13980 M^− 1 cm^− 1 (CTR-C).

The final samples of uniformly ¹³C,¹⁵N-labeled eIF4B constructs were prepared in a buffer of 20 mM sodium phosphate (pH 7.0), 150 mM NaCl, 2 mM dithithreitol (DTT), with 10% (v/v) D₂O added for the lock. NMR samples contained 170 µL in a 3mm NMR tube, and assignment spectra were collected at 293 K on a Bruker Avance 700 MHz spectrometer with a triple-resonance gradient room-temperature probe. NMR data were processed by using NMRPipe/NMRDraw software (Delaglio et al. 1995) and NMR spectra were visualized and analyzed using Sparky (T. D. Goddard & D. G. Kneller, University of California, San Francisco, USA).

The backbone ¹H^N, ¹H^α, ¹³C’, ¹³C^α, ¹³C^β, and ¹⁵N^H resonance assignments for the eIF4B 333–457 and 458–611 constructs were assigned using the data from two-dimensional (2D) ¹H,¹⁵N-HSQC spectra and three-dimensional (3D) HNCO, HN(CA)CO, HNCA, HNCACB, CBCA(CO)NH, HA(CACO)NH, HNHA spectra. Sequential assignment was assisted by the use of 3D H(NCOCA)NNH and 3D (H)N(COCA)NNH spectra. The use of 3D HACAN and 3D HACA(CO)N spectra were essential for validating the connection to residues N-terminal to proline and for sequential proline stretches. Using the above assignments as a guide, the backbone resonance assignments for the eIF4B 333–611 construct was assigned using the data from a two-dimensional (2D) ¹H,¹⁵N-HSQC spectrum and three-dimensional (3D) HNCO, HN(CA)CO, HNCA, HNCACB, CBCA(CO)NH, HA(CACO)NH, HNHA, (H)N(COCA)NNH, HACAN and HACA(CO)N spectra.

Based on an initial ¹H,¹⁵N-HSQC spectrum acquired for the complete C-terminal region of human eIF4B (eIF4B-CTR, residues 333–611), it was evident that the backbone amide ¹H^N chemical shift values were restricted to 8.0-8.5 ppm (Fig. 1A), and thus the construct was predominantly disordered. We therefore decided to simplify the backbone assignment process by splitting this region into two parts: CTR-N (residues 333–457), and CTR-C (residues 458–611). The ¹H,¹⁵N-HSQC spectra of CTR-N (blue spectrum, Fig. 1A) and CTR-C (red spectrum, Fig. 1A) together display an almost perfect overlap with the spectrum of the complete CTR. Using the collected 2D and 3D spectra, we obtained near complete protein backbone ¹H^N, ¹H^α, ¹³C^α, ¹³C^β, ¹³C’ and ¹⁵N assignments for eIF4B-CTR-N and eIF4B-CTR-C. For CTR-N, the first two residues (Gly-Cys-) that remain after removal of the His6-tag are not observed in the NMR spectra, however the remaining nuclei have an assignment completeness of 97% (¹H^N), 99% (¹H^α), 99% (¹³C^α), 97% (¹³C^β), 98% (¹³C’) and 98% (¹⁵N). In CTR-N, it is the first three residues (Gly-His458-Ser459-) that precede Pro460 that are not observed. The remaining nuclei have an assignment completeness of 99% (¹H^N), 99% (¹H^α), 100% (¹³C^α), 96% (¹³C^β), 97% (¹³C’) and 100% (¹⁵N). Panels B to F in Fig. 1 show the annotated ¹H,¹⁵N-HSQC for backbone amides from CTR-N and CTR-C.

Following the protein backbone chemical shift assignment of CTR-N and CTR-C, we were able to mostly complete the assignment of the full CTR. Due to overlap, these assignments correspond only to the ¹H^N, ¹³C^α, ¹³C’, and ¹⁵N nuclei. Except for the region bridging the two smaller constructs, the assignments are essentially the same as for CTR-N and CTR-C. As expected, the largest difference is for Cys457, which is the last residue in CTR-N (Fig. 1E; 7.88 ppm/123.2 ppm), but in CTR is found at 8.36 ppm/119.5 ppm. Other differences for this CTR region in the ¹H,¹⁵N-HSQC include Asn452 (Fig. 1E), Lys453 (Fig. 1F), Glu454 (Fig. 1E), Asp456 (Fig. 1F), Thr461 (Fig. 1C), and Lys463 (Fig. 1D). Assignment completeness for backbone nuclei within the entire CTR construct is 96% (¹H^N), 96% (¹³C^α), 94% (¹³C’), and 96% (¹⁵N). Missing residues correspond to amide peaks that were noticeably broadened already in the smaller constructs, in particular within the segment from Ser430 to Asn436, as well as several residues before prolines or within proline-rich regions.

The ¹H, ¹³C and ¹⁵N NMR chemical shift data have been deposited in the Biological Magnetic Resonance Data Bank (https://bmrb.io/) under accession codes 51952, 51953 and 51957, for human eIF4B CTR-N, CTR-C and CTR, respectively.

The initial ¹H,¹⁵N-HSQC spectrum already suggested that the eIF4B-CTR is mainly disordered. To gain further insight, we looked for the presence of any secondary structure elements based on the chemical shift values. Secondary chemical shifts were first calculated using the observed ¹³C^α values in comparison to values predicted for a random coil (Tamiola et al. 2010). We found a region from Thr369 to Gln390 with a stretch of Δδ ¹³C^α greater than 1 ppm, consistent with an α-helix segment (Fig. 2A). There are additional regions with smaller, but still positive, Δδ ¹³C^α values that could also indicate a degree of helical propensity. In the region corresponding to CTR-C, there are only two residues with Δδ ¹³C^α values above 1 ppm (Fig. 2A). These two residues are the only glycines that precede a proline in the eIF4B-CTR, and thus might be either related to a local favored conformation, or possibly an error in the predicted random coil ¹³C^α value. In a second approach, we used TALOS-N (Shen and Bax 2013) to analyze the full list of assigned chemical shifts (Fig. 2B). Once again we identified a single helical segment with high confidence, located in the same position indicated by the Δδ ¹³C^α values. There is also high confidence that the majority of eIF4B-CTR corresponds to a disordered coil. In contrast, the two smaller regions of secondary structure predicted by TALOS-N have very low confidence scores.

The primary helical segment that we have identified from Thr369 to Gln390 is of interest, since it is fully located within the 367–423 amino acid region found to bind RNA in vitro (Méthot et al. 1994). The stretch of basic residues from 434–444, also proposed to interact with RNA (Méthot et al. 1994)(Naranda et al. 1994), furthermore displays some helical character in the Δδ ¹³C^α analysis (Fig. 2A). In future experiments, the chemical shift assignments will allow for a precise characterization of the interaction of RNA to specific residues in the eIF4B CTR. It will also be possible to look into residues involved in binding other translation initiation factors, and the residue-specific consequence of post-translational modifications such as phosphorylation on Ser406 and Ser422.

Ethics approval and consent to participate

Not applicable.

Consent for publication

All authors have approved the submission of the manuscript.

Availability of data and material

The assignments have been deposited to the BMRB under accession codes 51952, 51953 and 51957.

Competing interests

The authors declare that they have no competing conflict of interest.

Funding

This work was supported by grants from the Fondation pour la Recherche Médicale (AJE20171239128 to MA), Junior Chair IdEx Univ. Bordeaux (OPE-2018-0405 to MA), ANR JCJC (DISTINCT: ANR-20-CE11-0007 to MA), and recurrent funds from the French National Institute of Medical Research (Inserm; MA, CDM).

Authors’ contributions

SR created the plasmids. SR, VT and CABT expressed and purified the protein samples. CDM collected and processed the NMR data. SM, CABT and CDM analyzed the NMR data. MA and CDM directed the project and wrote the manuscript.

Acknowledgements

The authors would like to thank Estelle Morvan, Axelle Grélard, and the IECB biophysical and structural chemistry facility (CNRS UAR3033, Inserm US001, Univ. Bordeaux), for NMR support and access to the 700 MHz spectrometer. We thank Jean-Michel Blanc and the IECB biochemistry facility for assisting the preparation of the initial eIF4B CTR plasmid.

Delaglio F, Grzesiek S, Vuister GW, et al (1995) NMRPipe: a multidimensional spectral processing system based on UNIX pipes. J Biomol NMR 6:277–293
Fleming K, Ghuman J, Yuan X, et al (2003) Solution structure and RNA interactions of the RNA recognition motif from eukaryotic translation initiation factor 4B. Biochemistry 42:8966–8975
García-García C, Frieda KL, Feoktistova K, et al (2015) Factor-dependent processivity in human eIF4A DEAD-box helicase. Science 348:1486–1488
Jackson RJ, Hellen CUT, Pestova TV (2010) The mechanism of eukaryotic translation initiation and principles of its regulation. Nat Rev Mol Cell Biol 11:113–127
Merrick WC (2015) eIF4F: a retrospective. J Biol Chem 290:24091–24099
Méthot N, Pause A, Hershey JW, Sonenberg N (1994) The translation initiation factor eIF-4B contains an RNA-binding region that is distinct and independent from its ribonucleoprotein consensus sequence. Mol Cell Biol 14:2307–2316
Naranda T, Strong WB, Menaya J, et al (1994) Two structural domains of initiation factor eIF-4B are involved in binding to RNA. J Biol Chem 269:14465–14472
Özeş AR, Feoktistova K, Avanzino BC, Fraser CS (2011) Duplex unwinding and ATPase activities of the DEAD-box helicase eIF4A are coupled by eIF4G and eIF4B. J Mol Biol 412:674–687
Rogers GW Jr, Richter NJ, Lima WF, Merrick WC (2001) Modulation of the helicase activity of eIF4A by eIF4B, eIF4H, and eIF4F. J Biol Chem 276:30914–30922
Rozovsky N, Butterworth AC, Moore MJ (2008) Interactions between eIF4AI and its accessory factors eIF4B and eIF4H. RNA 14:2136–2148
Sen ND, Zhou F, Harris MS, et al (2016) eIF4B stimulates translation of long mRNAs with structured 5’ UTRs and low closed-loop potential but weak dependence on eIF4G. Proc Natl Acad Sci U S A 113:10464–10472
Shahbazian D, Parsyan A, Petroulakis E, et al (2010) eIF4B controls survival and proliferation and is regulated by proto-oncogenic signaling pathways. Cell Cycle 9:4106–4109
Shahbazian D, Roux PP, Mieulet V, et al (2006) The mTOR/PI3K and MAPK pathways converge on eIF4B to control its phosphorylation and activity. EMBO J 25:2781–2791
Shen Y, Bax A (2013) Protein backbone and sidechain torsion angles predicted from NMR chemical shifts using artificial neural networks. J Biomol NMR 56:227–241
Tamiola K, Acar B, Mulder FAA (2010) Sequence-specific random coil chemical shifts of intrinsically disordered proteins. J Am Chem Soc 132:18000–18003
Wang Y, Begley M, Li Q, et al (2016) Mitotic MELK-eIF4B signaling controls protein synthesis and tumor cell survival. Proc Natl Acad Sci U S A 113:9810–9815

No competing interests reported.

Download PDF

Journal Publication

published 27 Jun, 2023

Read the published version in Biomolecular NMR Assignments →

Editorial decision: Accepted
21 Jun, 2023
Reviews received at journal
21 Jun, 2023
Reviewers agreed at journal
24 May, 2023
Reviewers invited by journal
24 May, 2023
Submission checks completed at journal
14 May, 2023
Editor assigned by journal
14 May, 2023
First submitted to journal
12 May, 2023

You are reading this latest preprint version

Backbone resonance assignments of the C-terminal region of human translation initiation factor eIF4B

Status:

Journal Publication

Version 1

Abstract

Figures

Biological context

Methods and Experiments

Extent of assignment and data deposition

Chemical shift analysis

Declarations

References

Additional Declarations

Status:

Journal Publication

Version 1