Protection of LP-cs on acute alcohol-induced liver and intestine injury

doi:10.21203/rs.3.rs-2931371/v1

Download PDF

Research Article

Protection of LP-cs on acute alcohol-induced liver and intestine injury

https://doi.org/10.21203/rs.3.rs-2931371/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

The beneficial effects of probiotics have been studied extensively in inflammatory bowel disease, nonalcoholic steatohepatitis (NASH), and alcoholic liver disease (ALD). Probiotic supplements are considered safer and more effective, but the potential mechanisms behind their benefits are unclear. An objective of the current study was to examine the effects of extracellular products of Lactobacillus plantarum on acute alcoholic liver injury. Mice on standard chow diet were supplemented with Lactobacillus plantarum ST-III culture supernatant (LP-cs) for 2 weeks and administered a dose of alcohol at 6 g/kg body weight by gavage. Alcohol-induced liver injury was assessed by measuring plasma alanine aminotransferase (ALT) activity levels, and liver steatosis was determined by triglyceride content. Intestine was measured by H&E staining and tight junction proteins were examined. LP-cs significantly inhibited the alcohol-induced fat accumulation, inflammatory reaction, and apoptosis by inhibiting oxidative stress and ER stress. In addition, LP-cs significantly inhibited the alcohol-induced intestinal injury and endotoxemia. According to these findings, LP-cs alleviates the acute alcohol-induced liver damage by inhibiting oxidative stress and ER stress in one way and suppressing alcohol-induced increased intestinal permeability and endotoxemia in another way. Our findings indicated that LP-cs supplements provided a novel strategy for ALD preventions and treatments.

<em>Lactobacillus plantarum</em> ST-III

Alcoholic liver disease

Oxidative stress

ER stress

inflammatory

Alcohol-related liver disease (ALD) causes approximately 25% of deaths associated with alcohol consumption [1, 2]. ALD has a wide range of diseases, including liver parenchymal injury, fibrosis, inflammation, cirrhosis and finally hepatocellular carcinoma [3]. In terms of mechanism, ethanol directly damages the liver through increasing liver oxidative stress, endoplasmic reticulum (ER) stress, inflammatory responses and apoptosis [4]. More specifically, oxidative stress is activated during the metabolism of alcohol, which products excessive reactive oxygen species (ROS) in liver cells [5]. ROS activates lipid synthesis genes to protect liver cells from the toxicity of alcohol and causes the accumulation of lipids in liver cells, finally develops into other alcoholic liver diseases [6, 7]. In addition, several documents have demonstrated that alcohol damages the function of intestinal epithelial barrier and promotes intestinal permeability, endotoxin leakage and serum endotoxin levels, thereby leading to alcoholic liver damage [1]. The liver-gut theory of alcoholic fatty liver disease states that alcohol exposure can increase intestinal permeability, release Gram-negative bacterial lipopolysaccharide (LPS), and activate the body's immune response [2]. LPS can enter the liver through the enterohepatic axis, and activate Kupffer cells inside the liver and release inflammatory cytokines such as interleukins (IL-1β, IL-6, etc.) and tumor necrosis factor alpha (TNF-α) and finally lead to ALD [8]

Despite the immensity of study on the pathophysiology of ALD, targeted therapies available has not been found so far. The treatment approach for ALD remains: corticosteroids (or pentoxifylline as an alternative if steroids are contraindicated), abstinence and nutritional support [9]. In recent years, researchers have turned their attention to probiotics, which has a variety of advantageous effects on intestinal function, including promoting intestinal development and mucosal immunity, reducing intestinal oxidative stress, alleviating diarrhea, and improving or maintaining gut barrier function [10]. They positively regulate intestinal flora, temporarily colonize the gastrointestinal tract, correct gut dysbiosis, and inhibit the growth and virulence of several enteric pathogens [8]. The therapeutic potential of probiotics was reported in animal models of ALD and clinical studies [11–13]. Human studies highlighted that administration of probiotics improved liver function by decreasing oxidative damage/stress [14]. A clinical study showed that supplementation with Lactobacillus plantarum 8PA3 and Bifidobacterium bifidum restored the intestinal flora and improved liver enzyme levels in patients with ALD [15]. Lactobacillus rhamnosus CCFM1107 protected against alcoholic liver injury (ALI) by restoring bowel flora and reducing oxidative stress [16].

Multiple studies have shown that probiotics could protect liver from alcohol injury, but there is no unified intervention. In addition, other research pointed out that Lactobacillus rhamnoses supernatant can maintain the integrity of the intestinal barrier and attenuate endotoxemia-centered liver injury [17]. Some evidence showed that heat-killed lactic acid bacteria cells could also reduce inflammation and oxidative stress in ALI [18].These studies above reported Lactobacillus, supernatant of Lactobacillus, and heat-killed Lactobacillus might mediate its beneficial effects. However, some reports noted adverse cases with probiotic utilization include fungemia [19], bacteremia[20], and worsened severe pancreatitis, with an high incidence of intestine ischemia and mortality [21]. In the meantime, the research about heat-killed bacteria is insufficient. These studies suggested that the supernatant might have a safer and more effective application prospect.

Lactobacillus plantarum ST-III, originally isolated from kimchi, Japan, underwent complete genome sequencing with analysis of the oligosaccharide metabolic pathway in 2011 [22]. Other studies had shown that Lactobacillus plantarum ST-III was potential probiotics for the treatment of hyperlipidemia [23]. However, the studies of Lactobacillus plantarum ST-III in alcoholic diseases haven’t been reported yet. Herein, this research investigated the effects of LP-cs on acute ALI and provided a novel and potential strategy for ALD preventions and treatments.

Preparation of Lactobacillus plantarum ST-III culture supernatant (LP-cs)

Lactobacillus plantarum ST-III AB161(CGMCC 22782) was provided by the Biological Experimental Center of Wenzhou Medical University. According to the instructions, LP was activated and passaged three times in MRS medium, inoculated in 100 mL liquid medium according to 3% inoculation amount of culture medium, cultured at 37 ℃, 5% CO₂ for 24 hours, centrifuged 10min at 4 ℃ and 5000 r/min, and the supernatant was filtered through 0.22-µm filter to obtain extracellular fluid. This procedure was performed as described previously[17, 24].

Animal studies

Male ICR mice (about 20g) were obtained from Vital River Laboratory Animal Technology Co., Ltd, Shanghai. All mice were maintained and fed as described previously[17, 24]. The LP-cs was added into the drinking water at a ratio (1:20), which was consumed about 8 ~ 9 ml/mouse per day. During the 2 weeks of experiment, the mice were maintained on the LP-cs treatment. Animals were given a 6 g/kg dose of ethanol via gavage and kept fasting overnight with free access to drinking water containing LP-cs. After 6h of the experiment, all animals were anesthetized and blood and tissue samples were collected for assays according to the protocols reviewed[17]. All mice experiments were approved by the Institutional Animal Care and Use Committee of Wenzhou Medical University.

Biochemical analysis

Plasma was collected by centrifuging the blood samples at 2,000 g for 30 min at 4°C. Plasma alanine aminotransferase (ALT) was tested by analytical reagent kits (Nanjing Jiancheng Bioengineering Institute, China). Plasma LPS level was determined using ELISA kits (RD, USA). Liver tissues were homogenized and centrifuged according to the manufacturer's protocols. Then the levels of MDA, SOD, and GSH-Px in liver were determined using commercial kit, according to the instructions (Nanjing Jiancheng Bioengineering Institute, China).

Hepatic triglyceride assay

Liver triglyceride (TG) levels were assessed as described previously[25].

Liver TNF-α and IL-6 assay

Liver TNF-α and IL-6 were measured using TNF-α and IL-6 assay Kit (Thermo Scientific, Waltham, MA), which was determined under the manufacturer’s instructions, respectively.

Western Blot Analysis

Liver tissues were homogenized, and western blotting was performed as previously described[26]. Membranes were probed using antibodies against Cleaved-caspase 3 (Abcam) and GAPDH (Cell Signaling Technology). The protein signals were visualized by ChemiDocXRS + Imaging System (Bio-Rad) and analyzed.

Histological Analysis, immunohistochemistry, and immunofluorescence

For Hematoxylin and eosin (H&E) staining, paraformalin-fixed paraffin tissue sections were evaluated the characteristics of liver and intestinal tissues in histological changes and fibrosis. The immunohistochemistry procedure was performed as described previously[27] including the following primary antibodies CHOP, GRP78, PDI and XBP-1 (Santa Cruz Biotech, Santa Cruz, CA, USA). The positive areas of CHOP, GRP78, PDI, XBP-1 were collected. For immunofluorescence, the tissue sections were blocked with 10% normal donkey serum for 1 h at 25℃ in PBS and then incubated overnight with primary antibodies: Caudin-1, Occludin, P-gp, and ZO-1 (Santa Cruz Biotech, Santa Cruz, CA, USA) at 4°C. The nuclei were stained with Hoechst 33258 (0.25 lg/mL) dye. All fluorescence images were captured on Nikon ECLIPSE Ti microscope.

TUNEL assay

4 mm-liver sections of were stained for terminal deoxynucleotidyl transferase deoxyuridine triphosphate nick end labeling (TUNEL) according to the manufacturer's protocols by the ApopTag Peroxidase In Situ Apoptosis Detection Kit. The experiment methods above were performed as described previously [28].

Quantitative real time RT-PCR

The mRNA levels were determined by real-time PCR. Total RNA was isolated with Trizol and reverse-transcribed according to manufacturer’s protocol. The procedure was performed as described previously[17].

Statistical analysis

All experiment data were presented as the mean ± SEM and analyzed by one-way ANOVA. Statistical differences were calculated with GraphPad Prism 8 (GraphPad Software, Inc., San Diego, USA) Statistics are significant at p values < 0.05.

LP-cs ameliorates acute alcohol-induced liver steatosis

To investigate the effects of LP-cs on acute alcohol-induced liver steatosis, biochemical and histological measurement were performed. As expected, mice exposed in alcohol were observed obvious hepatic lipid accumulation compared with control mice, while LP-cs pretreatment significantly prevented fatty liver induced by acute alcohol treatment (Fig. 1A). As previously reported, the liver triglyceride (TG) levels in alcohol-exposed group were significantly higher than that in control group[17]. LP-cs pretreatment obviously decreased the acute alcohol-induced accumulated liver triglyceride (Fig. 1B). Consistent with enhanced liver steatosis, alcohol-exposed group showed increased expression of hepatic lipogenesis and decreased expression of hepatic fatty acid β-oxidation. As a transcription factor, the expression of SREBP1c gene in alcohol group increased in liver, which plays a pivotal role in lipogenic gene expression control. Accordingly, alcohol exposure enhanced expression of SREBP1c targets and fatty acid synthase (FAS), acetyl-CoA carboxylase (ACC) (Fig. 1C). In addition, binge alcohol decreased genes transcript levels during fatty acid β-oxidation, including PGC-1α and PPAR-α. Pretreatment with LP-cs markedly reversed the changes of these genes induced by alcohol exposure (Fig. 1C&1D). These findings strongly suggested that LP-cs pretreatment played an important role in hepatic protection to alcohol-induced liver steatosis.

LP-cs ameliorates acute alcohol-induced liver injury

Liver plasma was collected 6 h after binge alcohol administration. To investigate the roles of LP-cs on acute ALI, plasma ALT levels were also measured, which were significantly elevated (Fig. 2A). LP-cs pretreatment significantly blocked the elevation of plasma ALT levels (Fig. 2A) at 6h after alcohol treatment. Inflammation is a hallmark of ALD. The hepatic pro-inflammatory cytokines, TNF-α and IL-6 were markedly increased in binge alcohol exposure, an effect that was decreased by LP-cs pretreatment (Fig. 2B-2C). Similarly, the expression level of hepatic p65 gene was enhanced by alcohol exposure, an effect that was inhibited by LP-cs pretreatment (Fig. 2D). The result suggests that alcohol -induced hepatic inflammation can be reduced by pretreatment with LP-cs.

LP-cs ameliorates acute alcohol-induced liver apoptosis

Hepatic apoptosis was determined by TUNEL assay. As shown in Fig. 3A&3C, relative number of TUNEL⁺ Cells, was increased in alcohol-treated mice as compared to the controls, but this phenomenon was reversed by LP-cs pretreatment. In addition, alcohol-treated cells exhibited a greater number of apoptotic cells than control cells. And the amount of Cleaved-caspase 3 was increased more than 4-fold by alcohol treatment. Pretreatment with LP-cs markedly reversed these changes induced by alcohol exposure (Fig. 3B&3D). These findings strongly suggested that LP-cs pretreatment played a role in hepatic defense to alcohol-induced hepatocyte apoptosis.

LP-cs ameliorates acute alcohol-induced ROS

Alcohol exposure induced-oxidative stress is believed to be a major contributor to alcoholic liver disease. To further ascertain the protective role of LP-cs in acute alcohol-induced hepatotoxicity, we next investigated whether LP-cs could rescue the defective antioxidant system in alcohol-treated mice. Compared with the control group, the levels of SOD and GSH-Px were obviously decreased, but the level of MDA was markedly increased in alcohol group, which were all reversed by LP-cs pre-treatment (Fig. 4), suggesting that LP-cs obviously inhibited acute alcohol-induced hepatic oxidative stress in vivo.

LP-cs ameliorates acute alcohol-induced liver ER stress

ER stress causes the cellular toxicity mechanism, including apoptosis and autophagy through several signaling pathways. To assess the role of ER stress in alcohol-induced hepatotoxicity, immunohistochemistry staining was used to show the expression of the ER stress-associated proteins, including CHOP, GRP78, PDI, and XBP-1. All proteins above were up-regulated markedly by alcohol treatment at 6 h, which were all significantly down-regulated by LP-cs pretreatment (Fig. 5A), suggesting that pretreatment with LP-cs prevented acute alcohol-induced hepatotoxicity by inhibiting ER stress.

LP-cs ameliorates acute alcohol-induced intestine injury

Histological staining of intestine sections revealed that alcohol induced structural disruption of the central lacteal and reduction in the number of small intestinal folds. However, the intestine injury induced by alcohol was significantly reversed with LP-cs pretreatment (Fig. 6A). The results indicated that LP-cs pretreatment played a protective role in alcohol-induced intestine injury.

LP-cs protects intestinal barrier integrity

Tight junction proteins are critical to regulating intestinal barrier function. It was showed that alcohol exposure induced a reduction in distribution of Claudin-1, Occludin and ZO-1 between adjacent epithelial cells in several parts of ileum epithelium by immunofluorescent staining, and LP-cs pretreatment restored tight junction protein homogeneous distribution (Fig. 7A). We also examined the expression of the intestinal P-gp protein, which the multidrug resistance 1 (MDR1) gene encoded. P-gp was widely distributed and expressed in intestinal epithelial cells and played the function of preventing harmful substances from the intestine. The immunofluorescence results showed that P-gp reduced by binge alcohol exposure and LP-cs pretreatment reversed this reduction (Fig. 7A). These results indicated that LP-cs pretreatment played a protective role in alcohol-induced intestinal barrier integrity.

Effects of LP-cs pretreatment on plasma endotoxemia

LPS, an endotoxin deriving from Gram-negative bacteria, is a major pathogenic factor in alcoholic liver disease. The elevated plasma LPS levels resulted from intestine injury and defected in intestinal barrier integrity [29]. Alcohol exposure increases LPS production. LPS binds to Toll-like receptor 4 on the surface of hepatic Kupffer cells, and activates of NF-κB-mediated TNF-α signaling pathway, thereby causing hepatic steatosis and inflammation [30]. Plasma LPS levels were measured and analyzed at 6 h after binge alcohol exposure to assess the effects of acute alcohol gavage and LP-cs pretreatment on plasma endotoxemia. Binge alcohol exposure markedly increased plasma LPS level, and LP-cs pretreatment significantly reduced the elevation of LPS level (Fig. 8A).

The present study showed that acute alcohol-treated mice have significant increased hepatic fat accumulation, inflammatory reaction and apoptosis and also showed severe damage in intestinal mucosal, accompanied with destruction of intestinal adhesion protein. LP-cs pretreatment significantly alleviated alcohol-induced liver and intestine damages. Meanwhile, LP-cs significantly reduced oxidative stress and endoplasmic reticulum stress induced by alcohol, and protected hepatocytes from apoptosis. This study indicated that the extracellular products of Lactobacillus plantarum have protective effect on alcohol induced liver and intestinal injuries.

Probiotics are used to modulate intestine microbial homeostasis and to manage diverse liver diseases including nonalcoholic fatty liver disease (NAFLD), cirrhosis with hepatic encephalopathy and ALD [31]. Pre-clinical studies have reported that pre-treatment with probiotics can prevent ALI development through repopulating gut flora and reducing LPS endotoxin induced by alcohol and fat infusion [32]. However, it is generally believed that there are many unstable factors in the large intake of probiotics, which is not only reflected in the biological characteristics instability, but also brings unpredictable side effects [33, 34]. Furthermore, studies have shown that microorganisms produce biologically active metabolites such as short-chain and conjugated fatty acids, extracellular polysaccharides and neuroactive metabolites such as gamma-aminobutyric acid (GABA) and serotonin, which can bring health benefits to the host [35]. Therefore, this study used LP-cs to explore its effect on ALD in order to find safer and more effective therapeutic drugs. In the present study, alcohol exposure significantly increased hepatic lipid accumulation, liver injury and hepatic apoptosis compared with control mice, while LP-cs pretreatment significantly prevented these changes induced by acute alcohol treatment. The protective role of LP-cs in fat accumulation might to be closely associated with metabolism including de novo lipogenesis and catabolism. With the increasement of hepatic steatosis, expression levels of hepatic SREBP-1c were up-regulated in alcohol-treated mice leading to increased gene expression involved in de novo lipogenesis (Fig. 1C). Furthermore, hepatic PGC-1α and PPAR-α gene expression were severely decreased in alcohol-treated mice, subsequently causing fatty acid β-oxidation reduction. Pretreatment with LP-cs markedly reversed the changes of these genes induced by alcohol exposure (Fig. 1D). We also found LP-cs significantly reduced alcohol-induced inflammation. Expression of TNF-α and IL-6, markers of acute inflammatory phase reaction, was significantly up-regulated in response to binge alcohol exposure. LP-cs pretreatment prevented these increases (Fig. 2B&2C). Similarly, acute alcohol exposure increased the expression level of hepatic p65 gene, and the change was prevented by LP-cs pretreatment (Fig. 2D). In addition, we also found LP-cs pretreatment played a role in hepatic defense to alcohol-induced hepatocyte apoptosis as measured by TUNEL assay and Cleaved-caspase 3 levels, an apoptosis-related protein (Fig. 3). These results suggested a role of LP-cs in anti-fat accumulation, inflammatory and apoptosis activity in response to binge alcohol exposure.

A majority of experimental data indicated that oxidative stress plays a vital role in the onset and progression of alcohol-induced liver disease [14]. Some clinical studies have shown that probiotics can ameliorate liver function by decreasing oxidative damage/stress [36]. In the present study, the levels of SOD and GSH-Px were obviously decreased, and the level of MDA was markedly increased in alcohol group, which were all reversed by LP-cs pre-treatment (Fig. 4), suggesting that LP-cs obviously inhibited acute alcohol-induced hepatic oxidative stress. Furthermore, there are conflicting reports in the role of endoplasmic reticulum (ER) stress in the etiology of ALD [37]. ALI has been widely studied using intragastric alcohol-fed mice, serving as a model system, which reproduces the pathology characteristics and progression of early ALI and demonstrated the involvement of ER stress [38, 39]. The expression levels of ER stress–related genes, including GRP78, GRP94, CHOP/GADD153, and caspase 12 were up-regulated, showing that ER stress response action may lead to the pathologic features of ALD [40]. In the current study, immunohistochemistry microscopy found ER stress-associated proteins GRP78, CHOP, XBP-1 and PDI were remarkably up-regulated by alcohol treatment, which were all significantly down-regulated by LP-cs pretreatment (Fig. 5), suggesting LP-cs pretreatment prevented acute alcohol-induced ER stress.

As we all known, alcohol leads to quantitative and qualitative alterations of gut flora, mucosal damage, and gut permeability enhancement, which results in the translocation of bacterial products and endotoxins into portal blood flow [7]. Bacterial products stimulate the production of pro-inflammatory mediators including reactive oxygen species (ROS), chemokines, cytokines and leukotrienes, which causes inflammatory cells infiltration and liver injury such as fibrosis [41]. In the present study, histological staining of intestine sections revealed that acute alcohol induced structural disruption of the central lacteal and reduction in the number of small intestinal folds. However, the intestine injury induced by alcohol was dramatically reversed with LP-cs pretreatment (Fig. 6). Decreased expression levels of several TJ proteins (claudin-1, occludin and ZO-1) in the intestine were reported in the experimental mouse model of ALD [42]. Oxidative stress induced by alcohol exposure is a major trigger to the damage of intestinal barrier via reducing TJ [43]. The present study further demonstrates that binge alcohol exposure down-regulates intestinal TJ expression level, and LP-cs pretreatment normalizes these changes (Fig. 7). In addition, P-gp (a 170-kDa transmembrane protein) is generously expressed on the apical surface of intestinal epithelial cells. More and more evidence suggest that P-gp has a protective effect on the intestinal epithelia via mediating bacterial toxins efflux from the intestinal mucosa into the gut lumen. Dysregulated P-gp expression has been demonstrated to be associated with the pathogenesis of several gut disorders, such as inflammatory bowel disease (IBD), experimental animal models of colitis, and ulcerative colitis and Crohn’s disease. Upregulation of P-gp by two probiotics strains, (Lactobacillus acidophilus and rhamnosus), has been previously demonstrated in the mouse model of DSS-induced colitis [42]. In the present study, our experiment results show that binge alcohol exposure remarkably reduced P-gp expression levels. Importantly, the changes were reversed by LP-cs pretreatment (Fig. 7). Therefore, the protective effect of LP-cs against intestinal barrier dysfunction binge alcohol-induced may be achieved via a combinatorial regulation of intestinal mucin function. Furthermore, previous studies have identified that defects in intestinal barrier integrity can result in elevated plasma LPS levels in ALD models [44]. In current study, acute alcohol exposure significantly increased plasma LPS level, and LP-cs pretreatment significantly attenuated the rise in LPS level (Fig. 8).

In summary, our study demonstrated that binge alcohol exposure has deleterious consequences on mucus protective protein regulation involved in the expression of TJ proteins, blood LPS, and eventually ALI. LP-cs pretreatment exerted protective properties for ALD. Further characterization of the LP-cs active components and different ALD models will improve our understanding of the protective effect of probiotics on ALD and advance the development of novel therapeutic strategy for ALD.

Authors’ Contribution:

Feng Xu: manuscript writing

Zengqiang Chen: manuscript writing

Longteng Xie: manuscript writing

Shizhuo Yang: data analysis

Yuying Li: do experiment

Junnan Wu: do experiment

Yuyu Wu: data analysis

Siyuan Li: data collection

Xie Zhang: data collection

Yanyan Ma: data analysis

Yanlong Liu #: project development

Aibing Zeng #:Project development

Zeping Xu# :Project development

Conflict of interest statement:

All authors declare that they have no conflicts of interest (financial or otherwise) related to the data presented in this manuscript.

Acknowledgments

This work was supported by Natural Science Foundation of China (31770552, 81300311), Natural Science Foundation of Ningbo (2021J285, 2021J286, 202003N4235), Ningbo Leading Academic Discipline Project of Medical and Health Science (2022-X27), Ningbo Medical & Health Leading Academic Discipline Project (2022-F06）

Sussman, N.L. and M.R. Lucey, Alcohol and Alcoholic Liver Disease. Clin Liver Dis, 2019. 23(1): p. xiii-xiv.
Patel, R. and M. Mueller, Alcoholic Liver Disease, in StatPearls. 2022: Treasure Island (FL).
Axley, P.D., C.T. Richardson, and A.K. Singal, Epidemiology of Alcohol Consumption and Societal Burden of Alcoholism and Alcoholic Liver Disease. Clin Liver Dis, 2019. 23(1): p. 39–50.
Smyth, A., et al., Alcohol consumption and cardiovascular disease, cancer, injury, admission to hospital, and mortality: a prospective cohort study. Lancet, 2015. 386(10007): p. 1945–1954.
Lee, Y.J., et al., Upregulation of caveolin-1 by mulberry leaf extract and its major components, chlorogenic acid derivatives, attenuates alcoholic steatohepatitis via inhibition of oxidative stress. Food Funct, 2017. 8(1): p. 397–405.
Ansari, R.A., K. Husain, and S.A. Rizvi, Role of Transcription Factors in Steatohepatitis and Hypertension after Ethanol: The Epicenter of Metabolism. Biomolecules, 2016. 6(3).
Sugimoto, K. and Y. Takei, Pathogenesis of alcoholic liver disease. Hepatol Res, 2017. 47(1): p. 70–79.
Kareb, O. and M. Aider, Whey and Its Derivatives for Probiotics, Prebiotics, Synbiotics, and Functional Foods: a Critical Review. Probiotics Antimicrob Proteins, 2019. 11(2): p. 348–369.
Singh, S., N. Osna, and K. Kharbanda, Treatment options for alcoholic and non-alcoholic fatty liver disease: A review. World journal of gastroenterology, 2017. 23(36): p. 6549–6570.
Engen, P., et al., The Gastrointestinal Microbiome: Alcohol Effects on the Composition of Intestinal Microbiota. Alcohol research: current reviews, 2015. 37(2): p. 223–36.
Bang, C.S., et al., Effects of Korean Red Ginseng (Panax ginseng), urushiol (Rhus vernicifera Stokes), and probiotics (Lactobacillus rhamnosus R0011 and Lactobacillus acidophilus R0052) on the gut-liver axis of alcoholic liver disease. J Ginseng Res, 2014. 38(3): p. 167–72.
Hong, M., et al., Probiotics (Lactobacillus rhamnosus R0011 and acidophilus R0052) reduce the expression of toll-like receptor 4 in mice with alcoholic liver disease. PLoS One, 2015. 10(2): p. e0117451.
Li, F., et al., Probiotics and Alcoholic Liver Disease: Treatment and Potential Mechanisms. Gastroenterol Res Pract, 2016. 2016: p. 5491465.
Seitz, H.K., et al., Alcoholic liver disease. Nat Rev Dis Primers, 2018. 4(1): p. 16.
Kirpich, I.A., et al., Probiotics restore bowel flora and improve liver enzymes in human alcohol-induced liver injury: a pilot study. Alcohol, 2008. 42(8): p. 675–82.
Galicia-Moreno, M. and G. Gutierrez-Reyes, The role of oxidative stress in the development of alcoholic liver disease. Rev Gastroenterol Mex, 2014. 79(2): p. 135–44.
Wang, Y., et al., Lactobacillus rhamnosus GG culture supernatant ameliorates acute alcohol-induced intestinal permeability and liver injury. Am J Physiol Gastrointest Liver Physiol, 2012. 303(1): p. G32-41.
Segawa, S., et al., Oral administration of heat-killed Lactobacillus brevis SBC8803 ameliorates alcoholic liver disease in ethanol-containing diet-fed C57BL/6N mice. Int J Food Microbiol, 2008. 128(2): p. 371–7.
Riquelme, A., et al., Saccharomyces cerevisiae fungemia after Saccharomyces boulardii treatment in immunocompromised patients. Journal of clinical gastroenterology, 2003. 36(1): p. 41–3.
Land, M.H., et al., Lactobacillus sepsis associated with probiotic therapy. Pediatrics, 2005. 115(1): p. 178–81.
Besselink, M., et al., Probiotic prophylaxis in predicted severe acute pancreatitis: a randomised, double-blind, placebo-controlled trial. Lancet (London, England), 2008. 371(9613): p. 651–659.
Wang, Y., et al., Complete genome sequence of the probiotic Lactobacillus plantarum ST-III. J Bacteriol, 2011. 193(1): p. 313–4.
Ren, J., et al., All 4 bile salt hydrolase proteins are responsible for the hydrolysis activity in Lactobacillus plantarum ST-III. J Food Sci, 2011. 76(9): p. M622-8.
Xu, Z., et al., Lactobacillus plantarum ST-III culture supernatant ameliorates alcohol-induced cognitive dysfunction by reducing endoplasmic reticulum stress and oxidative stress. Front Neurosci, 2022. 16: p. 976358.
Liu, Y., et al., Fibroblast growth factor 21 deficiency exacerbates chronic alcohol-induced hepatic steatosis and injury. Sci Rep, 2016. 6: p. 31026.
Wang, X., et al., FGF1 protects against APAP-induced hepatotoxicity via suppression of oxidative and endoplasmic reticulum stress. Clin Res Hepatol Gastroenterol, 2019. 43(6): p. 707–714.
Wu, Y., et al., Exogenous fibroblast growth factor 1 ameliorates diabetes-induced cognitive decline via coordinately regulating PI3K/AKT signaling and PERK signaling. Cell Commun Signal, 2020. 18(1): p. 81.
Xu, Z., et al., Fibroblast Growth Factor 1 Ameliorates Diabetes-Induced Liver Injury by Reducing Cellular Stress and Restoring Autophagy. Front Pharmacol, 2020. 11: p. 52.
He, C., et al., Vitamin A inhibits the action of LPS on the intestinal epithelial barrier function and tight junction proteins. Food & function, 2019. 10(2): p. 1235–1242.
Stephens, M. and P. von der Weid, Lipopolysaccharides modulate intestinal epithelial permeability and inflammation in a species-specific manner. Gut microbes, 2020. 11(3): p. 421–432.
George Kerry, R., et al., Benefaction of probiotics for human health: A review. J Food Drug Anal, 2018. 26(3): p. 927–939.
Hong, M., et al., Are Probiotics Effective in Targeting Alcoholic Liver Diseases? Probiotics Antimicrob Proteins, 2018.
Cohen, P., Probiotic Safety-No Guarantees. JAMA internal medicine, 2018. 178(12): p. 1577–1578.
Hajfarajollah, H., et al., Biosurfactants from probiotic bacteria: A review. Biotechnology and applied biochemistry, 2018. 65(6): p. 768–783.
Ryan, P., et al., Sugar-coated: exopolysaccharide producing lactic acid bacteria for food and human health applications. Food & function, 2015. 6(3): p. 679–93.
Ghorbani, Z., M. Hajizadeh, and A. Hekmatdoost, Dietary supplementation in patients with alcoholic liver disease: a review on current evidence. Hepatobiliary Pancreat Dis Int, 2016. 15(4): p. 348–60.
Garcia-Ruiz, C., N. Kaplowitz, and J.C. Fernandez-Checa, Role of Mitochondria in Alcoholic Liver Disease. Curr Pathobiol Rep, 2013. 1(3): p. 159–168.
Galligan, J.J., et al., Oxidative Stress and the ER Stress Response in a Murine Model for Early-Stage Alcoholic Liver Disease. J Toxicol, 2012. 2012: p. 207594.
Fernandez, A., et al., ASMase is required for chronic alcohol induced hepatic endoplasmic reticulum stress and mitochondrial cholesterol loading. J Hepatol, 2013. 59(4): p. 805–13.
Mari, M., et al., Mitochondrial cholesterol accumulation in alcoholic liver disease: Role of ASMase and endoplasmic reticulum stress. Redox Biol, 2014. 3: p. 100–8.
Malaguarnera, G., et al., Gut microbiota in alcoholic liver disease: pathogenetic role and therapeutic perspectives. World J Gastroenterol, 2014. 20(44): p. 16639–48.
Wang, Y., et al., Lactobacillus rhamnosus GG reduces hepatic TNFalpha production and inflammation in chronic alcohol-induced liver injury. J Nutr Biochem, 2013. 24(9): p. 1609–15.
Shao, T., et al., Intestinal HIF-1alpha deletion exacerbates alcoholic liver disease by inducing intestinal dysbiosis and barrier dysfunction. J Hepatol, 2018.
Miller, A.M., et al., Molecular mechanisms of alcoholic liver disease: innate immunity and cytokines. Alcohol Clin Exp Res, 2011. 35(5): p. 787–93.

Table 1

Primer Sequences for Real-Time RT-PCR analysis
Gene	Source	Sequences (Forward/Reverse 5’-3’)
ACC	Mouse	GGGACTTCATGAATTTGCTGATTCTCAGTT	GTCATTACCATCTTCATTACCTCAATCTC
β-actin	Mouse	GGCTGTATTCCCCTCCATCG	CCAGTTGGTAACAATGCCATGT
FAS	Mouse	TGGGTTCTAGCCAGCAGAGT	ACCACCAGAGACCGTTATGC
NF-KB(P65)	Mouse	CTTGGCAACAGCACAGACC	GAGAAGTCCATGTCCGCAAT
PGC-1α	Mouse	AGACAAATGTGCTTCCAAAAAGAA	GAAGAGATAAAGTTGGTTTGGC
PPAR-α	Mouse	AGAGCCCCATCTGTCCTCTC	ACTGGTAGTCTGCAAAACCAAA
SREBP-1c	Mouse	GCGGAGCCATGGATTGCA	CTCTTCCTTGATACCAGGCCC

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Protection of LP-cs on acute alcohol-induced liver and intestine injury

Status:

Version 1

Abstract

Figures

Introduction

Materials and Methods

Animal studies

Biochemical analysis

Hepatic triglyceride assay

Liver TNF-α and IL-6 assay

Western Blot Analysis

Histological Analysis, immunohistochemistry, and immunofluorescence

TUNEL assay

Quantitative real time RT-PCR

Statistical analysis

Results

LP-cs ameliorates acute alcohol-induced liver steatosis

LP-cs ameliorates acute alcohol-induced liver injury

LP-cs ameliorates acute alcohol-induced liver apoptosis

LP-cs ameliorates acute alcohol-induced ROS

LP-cs ameliorates acute alcohol-induced liver ER stress

LP-cs ameliorates acute alcohol-induced intestine injury

LP-cs protects intestinal barrier integrity

Effects of LP-cs pretreatment on plasma endotoxemia

Discussion

Declarations

References

Tables

Additional Declarations

Status:

Version 1