Patients and samples collection
Twenty patients with gastric cancer receiving radical surgery were recruited in this study. The patients had not been treated with any therapies to treat the cancer before. the cancer and adjacent normal tissues from patients were collected from December 2012 to May 2015 at The First Affiliated Hospital of Jinzhou Medical University hospital. The samples were immediately frozen in liquid nitrogen and then stored at −80°C before use. The study was approved by the Ethics Committee of The First Affiliated Hospital of Jinzhou Medical University and the written informed consents were provided by the recruited patients before using the samples.
Cell culture and transfection
Human gastric cancer cell lines BGC823 and MGC803 were obtained from Cell Bank of Type Culture Collection (Shanghai, China). The cell lines were cultured using RPMI 1640 medium with 10% fetal bovine serum (FBS; Gibco, NY, USA) at 37°C and 5% CO2. The synthetic mimics of miR-1252 were obtained from GenePharma (Shanghai, China). The sequence of circ_0000190 and PAK3 was obtained by PCR, and then inserted into pcDNA3.0 vectors (Invitrogen, CA, USA) after confirmation. As respective negative controls (NC), the scramble RNA and empty expression vectors were used in this study. The BGC-823 and MGC803 cells were cultured in 6-well plates for 24h, and transfection was conducted according to the manufacturer’s protocol with lipfectamine 2000 (Invitrogen, CA, USA).
Cell proliferation assay
The BGC-823 and MGC-82C cells were cultured in 96-well plates (3×103 cells/well). Afte treatment of 24, 48 and 72h, 10 μL of CCK-8 (Solarbio, Beijing, China) was added into each well and cells were cultured for another 2 h. The absorbance at 450 nm was detected using an ELx808 microplate reader (Bio-Tek, USA). Cell growth was also examined by 5-Ethynyl-20-deoxyuridine (EdU) assay. After culture of indicated time points, EdU solution (Beyotime, Nantong, China) was added into each well and cells were cultured for another 2 h. Then cells were fixed in 4% PFA and nuclei were counter-stained with DAPI (Beyotime).
Transwell assay
The maintained cells were refreshed with FBS-free medium and then cultured for another 12 h. After harvesting, cells were suspended in serum-free culture medium containing 0.2% BSA at a density of 2×105 cells/mL. Then 100 μL of cells were added to the upper chamber pre-coated with Matrigel (BD, CA, USA), while 700 μL complete medium was added to the lower chamber. After 48h incubation at 37°C, cells in the upper chamber were cleaned, and the chambers were fixed in 4% paraformaldehyde and stained in 0.1% crystal violet solution to observe the migrated cells in the lower chamber surface.
Wound-healing assay
The primary or transfected BGC-823 and MGC-803 cells were cells were cultured in 6-well plates (3×105 cells/well). After culturing for 48 h, the cell layers were scratched using 100 μL pipette tips and photographed. Then cells were maintained in serum-free RPMI-1640 for 48 h and photographed under an inverted microscope. The wound width was measured using Image J software.
Terminal Deoxyribonucleotidyl Transferase (TdT)-mediated dUTP Nick End Labeling (TUNEL) assay
TUNEL assay was used to examine apoptosis of cultured gastric cancer cells and gastric cancer tissues. Cells and tissues were fixed in 4% PFA, and tissues were additionally dehydrated with ethanol solution, embedded with paraffin, rehydrated with ethanol solution, and cut into sections of 4 μm thickness. Eventually, apoptosis of the samples were examined using One Step TUNEL Apoptosis Assay Kit (Beyotime) according to the protocol, and the staining activity was detected using a fluorescence microscopy.
Colony formation
Cells were plated into 6-well plates (2000 cells/well) and cultured for 2 weeks at 37°C and 5% CO2. Then the cells were fixed in 4% PFA and stained in 0.1% crystal violet solution. The colonies were photographed and those with more than 50 cells were counted under an inverted microscope.
Flow cytometry
Cells were cells were cultured in 6-well plates (3×105 cells/well). The cultured cells were harvested and washed with PBS. After incubation in 100 μg/mL propidium iodide (PI) for 30min at 4°C, cell cycle was analyzed on cell cycle by flow cytometry. Apoptotic cells were additionally stained with Annexin V-FITC, and examined by flow cytometry. All cell analysis was analyzed using a FACScan instrument (Becton Dickinson, CA, USA) and CellQuest software (Becton Dickinson).
Real time PCR (RT-PCR)
Total RNAs from collected cells and tissues were extracted using Trizol reagent (Invitrogen). After spectrophotometric quantification, cDNAs were synthesized on ABI 7500 Real-Time PCR System (Applied Biosystems, CA, USA) using Primescript RT Reagents (TaKaRa, Dalian, China) according to the manufacturer instruction. With the same PCR system, RT-PCR was conducted in triplicate with the synthesized cDNA and purchased GoTaq® qPCR Master Mix kit (Promega, WI, USA). The primers used in this study are as follows: circ_0000190: 5’- GCCGAGTGGTAACATGGGAG -3’ and 5’- AGCAGAGCAAGTGGAAACCA -3’; GAPDH: 5’-TGTTCGTCATGGGTGTGAAC -3’ and 5’- ATGGCATGGACTGTGGTCAT -3’; miR-1252: 5’- ACACTCCAGCTGGGAGAAGGAAATTGAATTCA -3’ and 5’- CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTAAATGAA -3’; U6: 5’- CTCGCTTCGGCAGCACA -3’ and 5’-AACGCTTCACGAATTTGCGT -3’. The reaction process initiated with a denaturation at 94°C for 30s, and then included 40 cycles of 30 s denaturation at 94°C, 20 s anneal at 60°C, and 20 s elongation at 68°C. GAPHD and U6 were employed as internal control to calculate the relative level of interested genes (2-ΔΔCT).
Western blot
Cells were cells were cultured in 6-well plates (3×105 cells/well). The harvested cultured cells were lysed and the frozen cancer tissues were homogenized using RIPA lysis buffer (Beyotime, Haimen, China). The cell lysates and homogenates were centrifuged for 10 min at 8000 g and 4°C followed by collection of the supernatants. After protein concentration quantification using BCA assay (Bio-Rad, CA, USA) and subsequent denaturation at 95°C for 5 min, the samples were loaded onto 10% sodium dodecyl sulfate-polyacrylamide gels (SDS-PAGE), subjected to electrophoresis and transfer to polyvinylidene difluoride (PVDF) membrane (Bio-Rad). After blocking with 5% bovine serum albumin (BSA) at room termperature for 1 h, the blots were incubated overnight at 4°C with primary antibodies against PAK3, caspase-3, cyclin D, p27 and GAPDH (Santa Cruz, CA, USA), and then incubated with HRP-conjugated secondary antibody for 1 h. The immuno-reactivity was determined by ECL detection reagents (GE healthcare, USA).
Immunohistochemistry (IHC)
The collected xenograft tumor tissues from mice were cut into sections as above mentioned. The sections were incubated with the primary antibody of Ki-67 (Santa Cruz) at room temperature for 1 h, and then incubated with the secondary antibody. Immunoreactivity was visualized using diaminobenzidine (DAB) kit (Beyotime) and photographed under a microscope (Olympus, Japan).
Fluorescence in situ hybridization (FISH)
Cells were cultured on coverslips to exponential phase and then fixed in 4% PFA. The 4 μm sections of gastric cancer tissues fixed in 4% PFA were prepared as above mentioned. The samples received permeabilization with 0.25% Triton X-100 and hybridization in buffer containing biotin-conjugated probes (GenePharma) against circ_0000190. After blocking with 10% normal goat serum in PBS, the samples were incubated with FITC-streptavidin (Invitrogen) overnight at 4°C. After incubation, cells were washed with TBS, and then counter-stained with DAPI.
Dual-luciferase reporter assays
Circular RNA Interactome (https://circinteracto me.nia.nih.gov) and TargetScan (http://www.target scan.org) were employed to predict the interaction between Circ_0000190, miR-1252 and PAK3. Dual-luciferase reporter assays were used to detect the binding interactions. In brief, the wild sequences of circ_0000190 and PAK3 3’UTR and the corresponding mutants (MUT) were inserted into PsiCHECK-2-Report vectors (Promega), which were subsequently transfected into MCG823 cells using Lipofectamine 2000 (Invitrogen). Then co-transfection with either miR-1252 mimics or the NC was conducted. After 48 h transfection, the signals were detected and the luciferase activities were calculated by firefly luciferase intensity against renilla’s.
Athymic nude model experiment
4-6 weeks old of male BALB/c nude mice were obtained from Guangdong Medical Laboratory Animal Center (Guangzhou, China). Mice were housed under constant temperature (20-26°C) and relative humidity (40-75%), with a cycle of 12 h light/12 h dark. After an acclimatization of at least 5 days, the mice were subjected to subcutaneous injection at the left flank of 1×107 of BGC-823 cells, which had been transfected with Lv-circ_0000190 or NC and individually responded. Every 7 days, the tumor volume was measured to calculate the size by the formula: 0.5×length×Width2. After 28 days, the mice were sacrificed and the tumor tissues were collected. A part was stored at -80°C and the other stored in 4% PFA before use. The experiment was approved by the Ethics Committee of The First Affiliated Hospital of Jinzhou Medical University .
Statistical analysis
All experiments were conducted for at least three independent times, and the data were analyzed by SPSS 19.0 (SPSS, IL, USA) and expressed as mean ± SEM. Student’s t-test was used to for comparisons of two groups, while one-way analysis of variance (ANOVA) followed by Duncan’s test was conducted to evaluate the difference among multiple groups. P < 0.05 was considered statistically significan.