Animal and Diets
All experimental procedures were conducted in conformity with the Chinese Guidelines for Animal Welfare, and were approved by the Animal Care Advisory Committee of Nanjing Agricultural University, China (NJAU-CAST-2015-095). Twenty-four C57BL/6J male mice (5 weeks of age) were from Yangzhou Institute of Experimental Animals (SCXK (Su) 2012-0004). After three weeks of acclimation, mice were randomly distributed into four groups of 6 mice each as follows: 10% low-fat diet (LFD), 10% low-fat diet and dietary supplemented with 276 mg/kg of resveratrol (LFDR), 60% high-fat diet (HFD), 60% high-fat diet and dietary supplemented with 400 mg/kg of resveratrol (HFDR) [14, 32, 33]. There are 400 mg of resveratrol per kilogram of high-fat diet, and the caloric value was about 5.2 kcal/g, while that of low-fat diet was 3.6 kcal/g. In order to balance the amount of resveratrol per unit of energy between LFDR and HFDR diets, the amount of resveratrol per kilogram of low-fat diet was 276 mg. During the entire 12-week experiment, all mice were housed at 22 ± 1 °C under a 12-h light cycle and were allowed to drink and feed ad libitum. In addition, body weight and food consumption were recorded weekly.
Resveratrol (CAS: 501-36-0, purity over 99%) used in the experiment was bought from Sigma-Aldrich. We used HPLC analysis to confirm the concentration of resveratrol. All diets were manufactured by Trophic Animal Feed Co., Ltd. (Nantong, China). Composition and nutritional levels of mice diet based on AIN93 [34]. The LFD group was fed a TP 2330055MC diet consisting of casein, starch, dextrin, sucrose, soybean oil, mineral mixtures, vitamin mixtures, cystine, choline, and TBHQ. The HFD group was fed a TP 2330055M diet consisting of casein, starch, sucrose, lard, mineral mixtures, vitamin mixtures, cystine, choline, and TBHQ. The LFD consist of 10% fat, 14% protein and 76% carbohydrate, and HFD consist of 60% fat, 14% protein and 26% carbohydrate.
Sample Collection
Mice body weight in the HFD group was higher up to 4 g (> 4 g) than in the LFD group at the end of 12 weeks, suggesting that we successfully built a model of obesity [35]. Blood samples were collected by cardiac puncture technique following anesthesia with carbon dioxide, centrifuged at 3500 r/min for 10 min at 4 °C, and then stored at − 80 °C for the further determination. The liver was quickly removed, weighed, and thoroughly washed with PBS. A portion of the liver was stored separately in 10% buffered formalin solution for histopathological examination. The rest of liver was snap frozen using liquid nitrogen for further investigation.
Biochemical Parameters Analysis
The liver sample (0.2 g) from − 80 °C was suspended in ice-cold physiological saline (1.8 mL, 7.5 g/L NaCl diluent) and then homogenized at 13500 g for one minute in ice-bath using homogenizer (Tekmar, Ohio, USA). The homogenate was spun at 3000 g for 15 min at a temperature of 4 °C, and the supernatant was collected and analyzed immediately.
The levels of total cholesterol (TC, CAS: A111-1-1), triacylglycerol (TAG, CAS: A110-1-1), and low density lipoprotein cholesterol (LDL, CAS: A113-1-1) were measured using commercial kits (Nanjing Jiancheng Bioengineering Institute, Jiangsu, China) by a Microplate Reader (Thermo Scientific, Wilmington, DE, USA) with a detection wavelength of 510 nm, 510 nm, and 546 nm, respectively. All experimental procedures were performed according to the manufacturer’s protocols. All hepatic measurements were normalized to concentrations of total protein for inter-sample comparisons.
Hematoxylin-eosin Staining
The liver sections fixed in 10% paraformaldehyde were dehydrated with graded dilutions of ethanol, and embedded in paraffin. Then tissues (5 µm) were deparaffinized with xylene and rehydrated with graded dilutions of ethanol. The slides were stained with hematoxylin and eosin (H & E). A light microscope (Nikon ECLIPSE 80i, Nikon Corporation) was used to photograph and evaluate the pathological changes.
Oil-red Staining
For oil-red staining, fresh livers frozen at -80 °C were sectioned (5 µm thick), fixed in a slide, and dissolved in propylene glycol (2 minute). Slides were transferred to oil-red O solution (Sigma, Steindorf, Germany, CAS: O1516) for 1 hours, then immersed in 85% propylene glycol (1 min), washed two times in water. Finally, slides were counterstained in hematoxylin solution (10 s), and mounted using glycerin.
Rna Extraction And Qrt-pcr
Total RNA of snap-frozen liver was extracted using TRIZol reagent (TaKaRa, Otsu, Shiga, Japan, CAS: 9108). The RNA integrity was examined on one percent of agarose gel using GelRed staining. The RNA contents were quantified by Thermo NanoDrop 2000 Ultra Trace Visible Spectrophotometer (Thermo Fisher, Waltham, MA, USA). After that, 1000 ng total RNA was reverse-transcribed into cDNA in a 20 µl reaction volume using the PrimerScript RT Reagent kit (TaKaRa, Otsu, Shiga, Japan, CAS: RR036A). Real-time PCR was performed on the QuantStudioTM Design & Analysis Software (Thermo Fisher, Waltham, MA, USA). Primers were synthesized by Invitrogen Biotech Co. Ltd. (Shanghai, China) and listed in Table 1. qRT-PCR was performed in a 20 µl reaction mixture using ChamQ Universal SYBR qPCR 1Master Mix (Vazyme Biotech Co.,Ltd, Nanjing, China, CAS: Q311-02). The thermal profile was 3 min at 95 °C, 10 sec at 95 °C for 40 cycles, then 30 sec at 60 °C. The relative gene expression was calculated based on the 2−ΔΔCT method after normalization to housekeeping gene GAPDH. Samples in the LFD group were used as calibrator.
Table 1
Genes | Forward | Reverse |
GAPDH | GGCAAATTCAACGGCACAGT | AGATGGTGATGGGCTTCCC |
ACC | GCCTCCGTCAGCTCAGATAC | ATGTGAAAGGCCAAACCATC |
FABP4 | CTTTGCCACAAGGAAAGTGG | TCCCCATTTACGCTGATGAT |
FATP4 | ACTGTTCTCCAAGCTAGTGCT | GATGAAGACCCGGATGAAACG |
SREBP-1c | GGAGCCATGGATTGCACATT | GGCCCGGGAAGTCACTGT |
PPaRγ | CTGACAGGACTGTGTGAC | TCTGTGTCAACCATGGTAAT |
PPaRα | TGCAAACTTGGACTTGAACG | AGGAGGACAGCATCGTGAAG |
CYP4A10 | AGGTGTGGCCAAATCCAGAG | AATGCAGTTCCTGGCTCCTC |
CYP4A14 | ACCCTCCAGCATTTCCCATG | CTGTAAGCAGGCACTTGGGA |
ACOX1 | CTGGTGGGTGGTATGGTGTC | AATCTGGCTGCACGTAGCTT |
CPT1α | GTGAAAAGCACCAGCACCTG | GAAAGGTGAGTCGACTGCCA |
PPARβ/δ | CCTCCATCGTCAACAAAGACG | TTTAGCCACTGCATCATCTGGGCATGCTC |
METTL3 | AGCAGAGCAAGAGACGAATTATC | GGTGGAAAGAGTCGATCAGCA |
METTL14 | AGAGAAACCTGCAGGGCTTC | TCCTCCTGCTGCATTTCCAG |
FTO | TTCATGCTGGATGACCTCAATG | GCCAACTGACAGCGTTCTAAG |
ALKBH5 | CGCGGTCATCAACGACTACC | ATGGGCTTGAACTGGAACTTG |
YTHDF1 | ATGCCCAACCTACTTCTGCC | GAACACCCGCCCACTCTTAA |
YTHDF2 | GAGCAGAGACCAAAAGGTCAAG | CTGTGGGCTCAAGTAAGGTTC |
YTHDF3 | ATGCCCAACCTACTTCTGCC | GAACACCCGCCCACTCTTAA |
a GAPDH, Glyceraldehyde-3-phosphate dehydrogenase; ACC, Acyl-CoA carboxylase; FABP4, Fatty acid-binding protein 4; FATP4, Fatty acid transporter protein 4; SREBP-1c, Sterol regulatory element binding protein-1c; PPARα, Peroxisome proliferator-activated receptor alpha; PPARγ, Peroxisome proliferator-activated receptor gamma; CYP4A10, Cytochrome P450 family 4 subfamily a polypeptide 10; CYP4A14, Cytochrome P450 family 4 subfamily a polypeptide 14; ACOX1, Acyl-CoA oxidase 1; CPT1α, Carnitine palmitoyltransferase 1 alpha; PPARβ/δ, Peroxisome proliferator-activated receptor beta/delta; METTL3, Methyltransferase like 3; METTL14, Methyltransferase like 14; FTO, Fat mass and obesity associated; ALKBH5, alkB homolog 5; YTHDF1, YTH domain family 1; YTHDF2, YTH domain family 2; YTHDF3, YTH domain family |
Measurement Of Total Ma
A total of 200 ng aliquots of mRNA was extracted from liver. EpiQuikTM m6A RNA Methylation Quantification Kit was used to detect total RNA m6A levels (Epigentek, Wuhan, China, CAT. No. p-9005) according to our previous studies [36–38]. Briefly, m6A on RNA was captured using m6A antibodies after binding to strip wells using binding solution. The signal of m6A was quantified colorimetrically via reading the absorbance on a microplate reader at 450 nm (Thermo Fisher, Waltham, MA, USA). The m6A level was calculated by OD intensity.
Western Blot
Proteins from each 20 mg liver were extracted using tissue lysis buffer (Beyotime Biotechnology, Shanghai, China, CAS: P0013B) at a temperature of 4 °C. Then, the homogenate was centrifuged at 12000 g and 4 °C for 30 min. The protein concentrations were measured using a commercial kit (Beyotime Biotechnology, Shanghai, China, CAS: P0012). Samples (40 µg of protein) were mixed with 5 × sample buffer and boiled at one hundred degrees centigrade for 10 min. Separation of the protein samples were performed on 10% SDS-PAGE gels and electrotransferred onto an immobile membrane (PVDF membrane, Merck Millipore, Darmstadt, Germany, CAS: IPVH00010) with transfer buffer. The PVDF membranes were incubated overnight with primary antibody at a temperature of 4 °C after block of five percent of non-fat dry milk diluted in TBST for 1 hours at RT. After 3 times washing, horseradish peroxidase-conjugated secondary antibodies (1:7500, Abcam, ab205718 or ab205719) were applied to incubation of the membranes for 90 min at RT. The bands were visualized using the ECL detection kit (ECL-plus, Beyotime Biotechnology, Shanghai, China, CAS: P0018S). The images were analyzed by a luminescence image analyzer LAS-4000 system (Fujifilm Co. Ltd., Tokyo, Japan) and were quantified by Gel-Pro Analyzer 4.0 software (Media Cybernetics, Silver Spring MD, USA). Some information about primary antibodies as follows: methyltransferase like 3 (1:2000, METTL3, Abcam, ab240595), YTH domain family 2 (1:2000, YTHDF2, Proteintech, 24744-1-AP), alkB homolog 5 (1:1500, ALKBH5, Proteintech, 16837-1-AP), FTO (1:1500 Proteintech, 27226-1-AP), and β-actin (1:10000, Proteintech, 60008-1-Ig).
Statistical Analysis
Data were analyzed by the two-way ANOVA and were present as means ± SD (standard deviations) after confirming normally distributed patterns. The classification variables were dietary resveratrol supplementation (LFD + HFD × LFDR + HFDR), high-fat diet (LFD + LFDR × HFD + HFDR), and their interaction (LFD × LFDR × HFD × HFDR). The significant difference among groups was examined by Duncan’s multiple range tests when significant difference of resveratrol × high-fat diet interaction was examined. The SPSS 21.0 statistical software (SPSS, Inc., Chicago, IL, USA) was used to analyze the present results. P-values less than 0.05 were considered as statistically significant level. P-values less than 0.01 were regarded as very significant.