Investigation, identification and introgression of a novel stripe rust resistant genes using marker-assisted selection in breeding wheat genotype

doi:10.21203/rs.3.rs-2978966/v1

Stripe rust is the most harmful and prevalent disease among global wheat genotypes worldwide. It is induced by Puccinia striiformis f. sp. tritici. Its disease can also create new physiological races that attack resistant genotypes and constitute a severe danger to wheat output. The improvement of genetic resistance using Yr's genes through breeding programs that were not previously operated in Egypt in wheat genotypes is an effective strategy for preventing the disease. The marker-assisted selection with PCR-based methods was used to characterize the degree of slow rusting resistance for 38 wheat genotypes to stripe rust. The findings on the slow rusting genes support the resistance in the genotypes and can be used in wheat breeding programs to produce new stripe rust-resistant genotypes. The genotypes were classified into three major categories based on four disease parameters. The first group consisted of resistant genotypes. The second group had the lowest values of disease parameters and slower rusting. The third group showed the highest values for the disease parameters, including fast-rust genotypes, over the course of three seasons. The results revealed that the Super Kauz, Opata/Pastor, PBW 343/KKU, Opata 58, Chuan Nong 19, and IRAG genotypes enclosing Yr5, Yr15, Yr33, Yr37, Yr34, Yr51, Yr57, Yr4BL, and Yrkk genes were so resistant to stripe rust. while the Misr 3, Misr 4, Giza 168, Giza 167, Giza 170, Giza 171, Gemmeiza-9, and Gemmeiza-10 genotypes have the Yr9 gene. Giza 168, Giza 170, Gemmeiza-9, Gemmeiza-10, and Sids-14, containing the Yr18 and Yr29 genes. while the Yr17 and Yr27 genes were present in the Sids 13 and the most virulent genotype, respectively. In the backcrossing program, the genes were integrated into susceptible wheat genotypes, and different BC generations were created. From susceptible genotypes, stripe rust affected Gemmeiza 11, Misr 1, and Sids 14. These genotypes have high importance for farmers; they are cultivated in large areas worldwide, and the quality of their flour is high. Therefore, we intergraded Yr5 and Yr10 genes into these three genotypes using a breeding program. Finally, the characteristic of resistance improved and the high-yield production increased in studied wheat genotypes.

Biological sciences/Biotechnology

Biological sciences/Genetics

Biological sciences/Physiology

Biological sciences/Plant sciences

Wheat

stripe rust

slow rusting resistance

effective Yr genes and breeding programs

Wheat (Triticum aestivum) is one of the most strategically and economically important cereal crops worldwide, and it is one of the world’s leading cereal grains used as a staple food by more than one-third of the world's population and contributes more calories and protein to the world diet than any other cereal crop [1]. Wheat production is suffering from several pathogens that affect yield production in many parts of the world, as well as Egypt. Rust diseases are a major limitation to wheat production, and there is an alarming gap between the ever-increasing demands for wheat production. One of these serious rust diseases is stripe rust, which is caused by Puccinia striiformis f. sp. tritici (Pst). It is a devastating fungal disease of wheat that has emerged as a worldwide threat to wheat production with the evolution of highly virulent races of P. striiformis.

In Egypt, wheat stripe rust (P. striiformis) was recorded for the first time in Lower Egypt in 1920. The occurrence and rapid spread of new virulent races in many countries, such as virulence-Yr27 and the Warrior race of wheat stripe rust with wider distribution, has focused a search for slow rusting resistance on wheat resistance genotypes [2].

Epidemics of stripe rust in wheat often occur in different parts of the world. The first epidemic that occurred on the genotypes in Egypt was wheat stripe rust disease (Giza 144, 1968), while the dramatic epidemic occurred in 1995, when stripe rust attacked most commercial wheat genotypes and the national average yield loss ranged from 14.00–20.50% in the Delta region [3]. Recently, the highest grain yield losses were recorded with wheat genotype Gemmeiza, 11 (64.20%), followed by genotype Misr 1, 62.38%, as well as Misr 2, 57.66%, and Sids 12, 50.89%, in the North Delta region of Egypt [4]. Wheat stripe rust can be effectively controlled by growing resistant genotypes [5]. However, the development of resistant genotypes requires knowledge of the pathogen population, virulence diversity, and race distribution in particular regions and times, as well as which resistance genes are effective against these races. In addition, forecasting the virulence shifts in a population and the rust management strategy to avoid crop losses are also important. In this respect Enhancing resistance to wheat stripe rust is one of the significant studies encountering wheat breeders around the world. The considerable environmentally proper, low cost method of preventing leaf rust is to breed and produce resistant wheat varieties. Over sixty genes that condition leaf rust resistance (Yr genes) have so outlying been recognized and localized on the wheat chromosomes. Moreover, a number of temporarily assigned resistance genes and quantitative loci (QTLs) are capable of supply total or partisan safeguard against diverse rust pathotypes [6]. More resistance genes are essential to diversify the combinations of PST resistance genes deployed as gene pyramids to provide durable resistance. Developing wheat genotypes carrying effective disease resistance genes is a sustainable and environmentally responsible approach to disease management. Numerous sources (genes) of rust resistance have been identified in global wheat genotypes or wheat relative species and are being utilized in the development of rust-resistant wheat genotypes. The significance of resistance genes is based on the configuration of the pathogen inhabitants. As this adjusts dynamically, renewed pathotypes virulent to the provided resistance gene reproduce from duration to duration, so the resistance of a type is not a stable trait. Any variety maintaining a single resistance gene may evolve susceptible within a short time. More durable resistance can be conceived by integrating several Yr genes into a genotype by the standards of gene pyramiding [7]. The postulation of resistance genes is taken using rust isolates with available virulence [8], but this approach is significantly time- and labour-intensive and cannot be utilized if no differential fungal isolate is known. In some cases, resistance genes can only be determined using molecular markers [9]. Genetic resistance is one of the most important methods to control wheat rusts because it's considered the first line of defence, is an economical, practical control procedure, and causes no additional cost to the farmer. However, only major gene-based resistance has been used in the past. Furthermore, most of the released wheat genotypes were based on only a few major genes. This results in a kind of mono-culturing regarding resistance genes [10], which has been broken down, causing severe losses [11]. Due to the emergence of virulence by the stripe rust pathogen, which is capable of rapidly developing new virulence to resistance genes and pathogenic variability caused by mutation, migration, and somatic or sexual recombination [12, 13], such major gene-based resistance is rapidly lost. Under these conditions, resistance common to multiple races of the pathogen is required. Race non-specific resistance that fights against multiple races of the pathogen is known as durable resistance. Race-specific resistance is preferred over race-specific resistance [10]. Over the past fifteen years, numerous efficient markers for stripe rust resistance genes have been defined. The molecular markers that are most closely related to your genes, yr gene markers depend on the PCR procedure, as the prevalence of these can be involved relatively efficiently in wheat breeding in this study programmes. In addition our study sought to determine and characterize the level of slow rust resistance of 38 wheat genotypes under field conditions and detect the presence of ten stripe rust resistance genes (Yr's) using molecular markers in these genotypes.

Plant materials

All experimental research complied with the Ministry of Agriculture and Land Reclamation bulletin with the most important technical recommendations. The experiments were carried out at the Sakha Agriculture Research Station, Plant Pathology Research Institute, Agricultural Research Center (ARC) and Faculty of Agriculture, Cairo University, Giza, Egypt during the three successive seasons ( 2021, 2022, and 2023). Thirty-eight wheat genotypes (Triticum aestivum L.) were supplied by the Wheat Research Department, Field Crops Institute, Egypt, which contained unknown resistant genes (Table 1). These local varieties were taken from the Field Crops Research Institute at the Agricultural Research Centre in Egypt and followed the scientific rules and intellectual property protocols. This would preserve the wheat crop in Egypt and around the world, where these varieties can be taken and cultivated. Wheat genotypes were evaluated for stripe rust response at the Sakha Agriculture Research Station, Egypt, at the adult plant stage under artificial inoculation. In addition, 52 yellow rust differential sets and isogenic lines were received from the International Maize and Wheat Improvement Centre (CIMMYT), Mexico, with known stripe rust resistance genes Yr's, and Morocco (check highly susceptible) and were used in this search (Table 2).

Table 1

Thirty-eight wheat genotypes used in this study with their pedigree.
No.	Genotypes	Pedigree
1	Misr1	OASIS/SKAUZ//4BCN/3/2PASTOR
2	Misr2	SKAUZ/BAV92
3	Misr3	ATTILA2/PBW652/KACHU
4	Misr4	NS-732/HER/3/PRL/SARA/TSI/VEE#5/4/FRET2/5/Wheat/SOKOLL
5	Sakha8	INDUS/NORTENO"S"-PK348
6	Sakha61	INIA–RL4220//7c/Yr "S" CM15430-25-55-0S-OS
7	Sakha69	INIA/RL 4220//7c/Yr "S" CM 15430-25-65-0S-0S
8	Sakha62	INIA–RL4220//7c/Yr "S"
9	Sakha92	NAPO 63/ INIA 66 // WERN "S"
10	Sakha93	Sakha 92/TR 810328 S 8871-1S-2S-1S-0S
11	Sakha94	OPATA/RAYON//KAUZ CMBW9043180-OTOPM-3Y-010M…
12	Sakha95	PASTOR//SITE/MO/3/CHEN/AEGILOPS/SQUARROSA(TAUS)// …
13	Gemmeiza1	Maya74 / On-1//1160 − 147/3/Bb/Gallo/4/chat "S"
14	Gemmeiza3	BB/7C//Y50/KAL3× Sakha 8/4/ PRV/WW/5/BJI "S"//ON*3/BON
15	Gemmeiza5	VEE”S”/SMW6525 Gm.4017-1Gm.7Gm.-3Gm.-0Gm
16	Gemmeiza9	Ald "S"/Huas//CMH74A.630/Sx CG4583-5G-1G-0G
17	Gemmeiza10	MAYA 74 "S"/ON//1160 − 147/3/BB/GLL/4/CHAT"S"/5/CROW "S"
18	Gemmeiza11	BOW''S''/KVZ''S''//7C/SERI82/3/GIZA168/SKHA61
19	Giza150	MIDA-CADET/2* GIZA139
20	Giza155	REGENT/2GIZA139// MIDA-CADET/2 HINDI62
21	Giza157	(Regent 975 − 11 × Giza 1392) × Mida Cadet × Hindi 62
22	Giza160	CHENAB/GIZA155
23	Giza162	VCM//CN 067/7C/3/Kal/Bb. CM8399-D-4M-3Y-1M-1Y-1M-0Y
24	Giza 163	T. aestivum/ Bon // CNO / 7C.
25	Giza164	KVZ / Buha "S" // Kal / Bb.
26	Giza165	CNO/MFD//MON "S".
27	Giza167	AU/UP301//GLL/SX/B/Pew”S”/4/Mai”S”/Maya”S”//Pew”S”.
28	Giza168	MRL/BUC//SERI. CM93046-8M-0Y-0M-2Y-0B-0SH
29	Giza170	MIL/BUC//Seri CM93046-8M-0Y-0M-2Y-0B
30	Giza171	Sakha93/Gemmeiza9 S 6-1GZ-2GZ-2GZ-0S
31	Sids1	HD2172/Pavon‘‘S’’//1158.57/Maya74"S". SD46-4Sd-2SD-1SD-0SD
32	Sids4	Maya"S"/MON"S"// CMH74A.2/3/*2 Giza157.
33	Sids6	Maya "S"/Mon‘‘S’’//CMH174A.592/3/Sakha8*2
34	Sids8	Maya "S"/Mon‘‘S’’//CMH74A.592/3/Sakha8*2
35	Sids12	Buc//7c/ald/5/maya74/on//1160 − 147/3/bb/gll/4/chat''s'"
36	Sids13	AMAZ19 = KAUZ"S"//TSI/SNB"S"
37	Sids14	Bow''s''/Vee''s''//Bow's'/Tsi/3/BANI SUEF 1 SD293-1SD-2SD-4SD-0SD
38	Shandweel1	SITE/MO/4/NAC/TH.AC//3*PVN/3/MIRLO/BUC

Table 2

Fifty-two yellow rust differential sets and isogenic lines (from CIMMYT) were used in this study.
No	Name	No	Name
1	Morocco	27	AOC-YR3//LALBMONO14/PVN
2	Avocet-YRA	28	AOC-YR*3/PASTOR
3	Avocet + YRA	29	POLLMER
4	YR1/6*AOC	30	PASTOR
5	SIETE CERROS T66	31	REBECA F2000
6	TATARA	32	FRANCOLIN#1
7	YR5/6*AOC	33	AOC-YR/QUAIU#3
8	YR6/6*AOC	34	OPATA/PASTOR
9	YR7/6*AOC	35	OPATA/PASTOR
10	YR8/6*AOC	36	AOC-YR/QUAIU#3
11	YR9/6*AOC	37	M10(MUTATED C-306)/AOC-YR
12	YR10/6*AOC	38	CHUAN NONG 19
13	YR15/6*AOC	39	IRAGI
14	YR17/6*AOC	40	KOELZ W 11192:AE
15	YR18/3*AOC	41	PBW343/KKU
16	YR24/3*AOC	42	AOC-YR3//LALBMONO14/PVN
17	YR26/3*AOC	43	YR33
18	YR27/6*AOC	44	YR34
19	YRSP/6*AOC	45	YR35 98M71
20	PAVON F 76	46	YR37
21	SERI M82	47	YR4PL
22	OPATA M85	48	YR51
23	SUPER KAUZ	49	YR54
24	YRCV/6*AOC	50	YR57
25	PBW343	51	YRKK
26	AOCYR*3/3ALTAR84/AE.SQ//OPATA	52	YRALd

Field experiments:

Twenty seeds of each genotype were sown in two rows (1m length with 30 cm row spacing) in a randomized complete block design (RCBD), with three replications. One row of the highly susceptible wheat genotype; Morocco was planted also as a spreader border of disease. The recommended agricultural practices were applied. The field stripe rust resistance of the plants (38 in all) depends on near-isogenic lines, three susceptible varieties parents, donor parents, back crosses (BC) plants, and control plants assessed in an artificially inoculated nursery. Rows of a spreader variety, cultivated around the studied genotypes, were injected in the development stage using the uredospore mixture also utilized in the greenhouse experiments. The spore suspension was injected into the spreader plants by a hyperdermic syringe. The pathogen then extends naturally from these primary sources of infection. The extent of the disease at the development stage was estimated in terms of severity, host response, resistance, and susceptibility. The average coefficient of infection (ACI) was estimated from these three data by reproducing severity by a designated constant value for the host response, for use in the statistical evaluation [14] On the basis of their resistance, the lines were categorized as resistant, susceptible, or segregating.

Experimental research on plant samples, containing the supply of plant material, complies with institutional, national, and international guidelines and legislation.

Dihaploid programme

The early civilizations were started from greenhouse-cultivated materials. Anthers in the mid-uninucleate phase were cultivated on a liquid MN6 induction medium [15]. The cultures were saved in the dark at 29°C for 30 days, after which the embryogenic stage was transmitted to a 190–2 regeneration culture including 0.09 M sucrose [16]. Plant regeneration took place at 26°C with a photoperiod of 16 hours of light and 8 hours of darkness. Green plantlets were transmitted to particular test tubes, including hormone-free 190-2 regeneration cultures with 0.03 M sucrose, and were vernalized for six weeks. The colchicine treatment took place after the vernalization treatment in the test tubes, after which the wheat plants were cultivated in soil and raised till maturity.

Disease assessment:

The responses of all the tested wheat genotypes to the P. striiformis pathotypes, were recorded at the adult plant stage using a Modified Cobb’s scale methods [17, 18]. The spreader rows were inoculated at the adult stage in the field with urediniospores of old races, Yr27 race and warrior races which multiplied on Morocco genotype in the yellow rust greenhouse. The used inoculum races are virulent for Yr6, Yr7, Yr8, Yrr9, Yr17, Yr27, and avirulent for Yr5, and Yr15 genes.

Disease severity was assessed using the modified Cobb Scale [17], where 0 = no visible infection; R = Resistant (necrotic areas with or without small pustules); MR = Moderately Resistant (small pustules surrounded by necrotic areas); MS = Moderately Susceptible (medium-sized pustules, no necrosis, but some chlorosis possible); and S = Susceptible (large pustules, no necrosis or chlorosis).

The coefficient of infection (CI) was calculated by multiplying the response value with the intensity of infection in percent. Average coefficient of infection (ACI) was derived from the sum of CI values of each entry (Table 3).

Table 3

The observation on the response of wheat stripe rust
Reaction	Observation	Response value
No Disease	O	0.0
Resistant	R	0.2
Resistant to Moderately Resistant	R-MR	0.3
Moderately Resistant	MR	0.4
Moderately Resistant to Moderately Susceptible	MR-MS	0.6
Moderately Susceptible	MS	0.8
Moderately Susceptible to Susceptible	MS-S	0.9
Susceptible	S	1.0

Area under the disease progress curve (AUDPC), which is a better indicator of disease expression over time was calculated in this respect. Estimation of AUDPC and rAUDPC was performed according to the following equation [19], as follows:

AUDPC = D [½ (Y₁ + Y_k) + Y₂ + Y₃ + …. + Y_k−1]

Where, D = Time interval (days between reading), (Y₁ + Y_k) = Sum of first and last disease scores. (Y₂ + Y₃ + …+ Y_k−1) = Sum of all in-between disease scores.

The relative area under disease progress curve (rAUDPC) for each entry was calculated by using the equation of Akello et al., [20], as follows:

rAUDPC = genotype AUDPC / susceptible genptype AUDPC × 100

The Relative Resistance Index (RRI) was calculated by using Country Average Relative Percentage Attack (CARPA) which calculated according to Aslam [21] on a 0 to 9 scale, where 0 represents the most susceptible and 9 shows highly resistant variety. The standard for desirable index was maintained ≤ 7 whereas value for acceptable index was fixed as 5. The following formula was used for calculation of RRI [21, 22].

RRI = (100 – CARPA) / 100 × 9.

The desirable index was seven and acceptable index number for Stripe rusts was six [21]

Seed index (1000 grains weight, g)

Seed index (1000 grain weight, g) The seed quality index is a quality parameter to estimate the grain quality in wheat, and this trait is generally affected by the genetic makeup of genotypes and the application of inputs to the crop. The seed index value of wheat genotypes as affected by seed size. The analysis of variance revealed that genotypes and seed size had a significant (P 0.05) influence on the seed index, while their interactive effect was statistically non-significant (P > 0.05). The seed index value of a wheat genotype's cereal yield (kg ha-1) Wheat grain yield is the outcome of heads, collected by grain head-1, grain weight per unit area. By operating these parameters, cereal yield potential can be estimated.

Statistical analysis

The obtained data was analyzed using analysis of variance (ANOVA) of the tested genotypes over the three seasons according to software SPSS version 22.

Using molecular markers for detecting the presence of resistance genes ( Yr's) in selected wheat genotypes.

Marker-assisted selection and detection of selected leaf rust resistance genes.

The Sakha Agriculture Research Station launched a backcross (BC) programme with the goal of transferring influential Yr's genes. Wheat genotypes with appropriate agronomic and technological quality parameters but that were susceptible or moderately resistant to stripe rust were crossed with near-isogenic lines of "variety," each carrying a different Yr gene. The first-generation plants were backcrossed to the recurrent parents. BC1 plants were chosen by means of MAS from different backcross generations, and these were again backcrossed with the recurrent parent.

The selection of Yr genes for incorporation was established not only on their efficacy, but also on whether dedicated, closely linked PCR markers were available. These were used for molecular marker-assisted choice in BC generations segregating for the Yr genes.

Twenty resistant wheat genotypes were selected to detect 10 resistance gene (Yr's); Yr5, Yr9, Yr10, Yr15, Yr17, Yr18, Yr26, Yr29, Yr30, and Yr36, using ten specific primers for these genes as shown in Table (4).

The CTAB (cetyl-trimethyl-ammonium bromide) method (Rogers and Bendich 1985) and the DNeasy® Plant Mini Kit (Qiagen®) were used to isolate DNA. The PCR protocol were conducted in EPCRS Excellence Center, Plant Pathology and Biotechnology Lab. (Accredited with ISO/17025, ISO/9001, ISO/14001 and OHSAS/18001), Botany Department, Faculty of Agriculture, University of Kafrelsheik, Egypt. DNA was extracted from green leaves of five to seven-day-old seedlings, following the method of Rogers and Bendich [23].

Ten PCR-based primers were used for the detection of the Yr genes (Table 4). The PCR reaction mixture (15µL) contained 5 ng DNA template, 10 pmol of forward primer, 10 pmol of reverse primer, 0.1 U of Taq DNA polymerase (Bioline GmbH, Germany), 25 mM of MgCl2, 2 mM dNTPs and 10× PCR buffer in 96 well thermal cyclers (Applied Biosystem Thermal Cycler, Singapore). The reaction conditions were as follows: initial denaturation was for 5 min at 94◦C, followed by initial 37 cycles of denaturation for 1 min at 94◦C, annealing for 1 min and extension at 72 for 2 min. Subsequently, 10 min final extension at 72◦C was done. PCR products of SSR markers were checked for amplification on 2% agarose gel.

Table 4

Sequences (F/R) of SSR marker used for 10 yellow rust resistance genes.
Gene	Marker	Sequence (5'-3')	Size (bp)	Reference
Yr5	STS7*	F: GTACAATTCACCTAGAGT	478bp	[24]
	STS8	R:GCAAGTTTTCTCCCTAT
Yr9	iag95*	F: CTCTGTGGATAGTTACTTGATCGA	1100bp	[25]
		R: CCTAGAACATGCATGGCTGTTACA
Yr10	PSP3000	F: GCAGACCTGTGTCATTGGTC	240bp	[26]
	PSP3000	R: GATATAGTGGCAGCAGGATAC
Yr15	gwm11	F: GGATAGTCAGACAATTCTTGTG	215bp	[27]
		R: GTGAATTGTGTCTTGTATGCTTCC
Yr17	VENTRIUP	F: AGG GGC TAC TGA CCA AGG CT	252bp	[28]
	LN2	R: TGCAGCTACAGCAGTATGTACACAAAA
Yr18	csLV34	F: GTTGGTTAAGACTGGTGATGG	150bp	[29]
		R: TGCTTGCTATTGCTGAATAGT
Yr26	we173*	F:GGGACAAGGGGAGTTGAAGC	259bp	[30]
		R:GAGAGTTCCAAGCAGAACAC
Yr29	Xgwm-295	F: AGGGAAAAGACATCTTTTTT	250bp	[31]
		R: CGACCGACTTCGGGTTC
Yr30	Xgwm533	AAGGCGAATCAAACGGAATA	120bp	[32]
		GTTGCTTTAGGGGAAAAGCC
Yr36	Barc101	F: GCTCCTCTCCACGATCACGCAAAG	175bp	[33]
		R: GCGAGTCGATCACACTATGAGCCAATG
*Marker types: STS marker

Effectiveness of stripe rust resistance genes in Egypt

The field resistance of wheat genotypes with selected Yr genes has been studied for several decades in order to detect the efficiency of stripe rust resistance genes. Each year, ‘based on near-isogenic lines, a different resistance gene or allele is planted in this investigation. The mean ACI values estimated from the stripe rust infection data registered in the artificially inoculated greenhouse in Egypt over the previous three years. The results reveal that twenty of the near-isogenic lines (NIL) wheat genotypes having a single Yr gene or allele are always not infected with the pathogen, or exclusively to a negligible extent. Wheat genotypes containing the genes Yr5, Yr9, Yr10, Yr15, Yr17, Yr18, Yr26, Yr29, Yr30, and Yr36 had excellent stripe rust resistance in Egypt, averaged over the last three years, The line displaying the greatest degree of infection was the NIL carrying the Yr1 and Yr5 genes .

Evaluation of the wheat genotypes for stripe rust resistance

Thirty-eight wheat genotypes and the check variety, Morocco, were estimated for stripe rust using four disease parameters, i.e., the mean coefficient of infection (ACI), the area under the disease progress curve (AUDPC), the relative area under the disease progress curve (rAUDPC), and relative resistance index (RRI), during the 2020, 2021, and 2022 seasons.

The obtained data indicated that the tested genotypes varied in disease severity, ranging from 1 to 80% among the three seasons, as affected by the slight changes in environmental conditions and virulence races of the wheat stripe rust pathogen.

Based on the infection responses, the tested wheat was classified into three groups in each of the three seasons. The first group contained 3 and 2 wheat genotypes immune to all tested isolates, displaying no visible symptoms (0) in the (2020 and 2021) and 2022 seasons, respectively. The wheat genotypes were Misr 3, Misr 4, and Giza 170. The second group contained wheat genotypes (R-MR) and (MS-S). In the third group, the remaining genotypes were susceptible to (S) responses.

Estimation of ACI values:

Disease severity (%) and infection type (IT) were combined to calculate an average coefficient of infection (ACI). Wheat genotypes with up to 3 ACI values were slightly resistant, while wheat genotypes falling between 4 and 10 were moderately susceptible. While, ACI values above 10, had low levels of adult plant resistance (Tables 5, 6 and 7). All of the tested wheat genotypes ranged from moderately resistant to susceptible. Except for Misr 3, Misr 4, and Giza 170 genotypes showed a completely resistant reaction to stripe rust in the first and second seasons, while Misr 3 and Misr 4 were completely resistant only in the third season. This group of genotypes was classified as the highly resistant group of genotypes and was considered to have race-specific resistance.

Table 5

The six disease parameters for wheat genotypes of stripe rust in 2020 season.
Genotypes	IT ^a	ACI	AUDPC	rAUDPC	CARPA	RRI
Race-specific ^b
Misr3	NIR	0	0	0	0	9.00
Misr4	NIR	0	0	0	0	9.00
Giza 170	NIR	0	0	0	0	9.00
Slow rusting I
Giza 171	RMR	1.5	07.5	0.44	1.67	8.85
Sakha 69	RMR	2.0	10.0	0.59	2.22	8.80
Gemmeiza 10	RMR	2.0	10.0	0.59	2.22	8.80
Sids 13	RMR	3.0	15.0	0.88	3.33	8.70
Sakha 93	MR	6.0	30.0	1.76	6.67	8.40
Sakha 94	MRMS	6.0	80.0	5.16	7.50	8.33
Giza 168	MRMS	8.0	60.0	3.87	10.00	8.10
Gemmeiza 9	MRMS	8.0	100.0	6.45	10.00	8.10
Slow rusting II
Giza 162	MS	10	130	8.39	12.50	7.88
Giza 167	MS	10	150	9.68	12.50	7.88
Sakha 62	MSS	20	200	12.90	25.00	6.75
Sakha 95	MSS	24	200	11.76	26.67	6.60
Giza 164	MSS	27	215	12.65	30.00	6.30
Gemmeiza 5	MSS	20	225	13.24	22.22	7.00
Sids 1	MSS	36	340	20.00	40.00	5.40
Susceptible
Sakha 61	S	20	255	15.00	22.22	7.00
Sakha 8	S	30	475	30.65	37.50	5.63
Sids 14	S	30	475	27.94	33.33	6.00
Sids 4	S	40	425	25.00	44.44	5.00
Sids12	S	40	500	30.00	44.44	5.00
Sids 8	S	40	500	30.00	44.44	5.00
Gemmeiza3	S	40	525	30.88	44.44	5.00
Sakha 92	S	50	575	33.82	55.56	4.00
Giza 163	S	50	675	39.70	55.56	4.00
Misr2	S	50	775	45.59	55.56	4.00
Sids 6	S	50	625	36.76	55.56	4.00
Shandweel 1	S	60	725	42.65	66.67	3.00
Misr1	S	60	825	48.53	66.67	3.00
Gemmeiza 11	S	60	850	50.00	66.67	3.00
Giza 155	S	70	975	57.35	77.78	1.00
Gemmeiza 1	S	70	975	57.35	77.78	2.00
Giza 150	S	70	1075	63.23	77.78	2.00
Giza 165	S	80	825	48.53	88.89	1.00
Giza 157	S	80	1125	66.18	88.89	1.00
Giza 160	S	80	1200	77.42	88.89	1.00
Check	S	90	1700	100.00	100.00	0.00
LSD 5%	-	0.258	64.687	0.016	-	-
1%	-	0.339	48.792	0.014	-	-
^a ITs based on Roelfs et al., (1992)., 0 = Immune. R = resistant (necrosis with few uredinia); MR = moderately resistant (necrosis with small to moderate number of uredinia); MS = moderately susceptible (moderate number of uredinia with chlorotic areas); and S = susceptible (large number of uredinia, no necrosis but chlorosis may be evident); ^b Showing near immune reaction in all seasons at two growing seasons to Pst;

Table 6

The six disease parameters for wheat genotypes of stripe rust in 2021 season.
Genotypes	FIT	ACI	AUDPC	rAUDPC	CARPA	RRI
Race-specific
Misr3	NIR	0	0	0	0	9.00
Misr4	NIR	0	0	0	0	9.00
Giza 170	NIR	0	0	0	0	9.00
Slow rusting I
Giza 171	RMR	0.6	03.0	0.19	0.75	8.93
Sakha 69	RMR	1.5	7.50	0.48	1.88	8.83
Gemmeiza 10	RMR	3.0	15.0	0.88	3.75	8.66
Sids 13	RMR	2.0	10.0	0.59	2.50	8.78
Sakha 93	RMR	1.0	05.0	0.32	1.25	8.89
Sakha 94	RMR	0.6	03.0	0.19	0.75	8.93
Giza 168	MR	4.0	20.0	1.29	5.00	8.55
Slow rusting II
Giza 162	MS	8	60	3.87	10.00	8.10
Giza 167	MS	8	80	5.16	10.00	8.10
Sakha 62	MSS	16	160	9.41	17.78	7.40
Sakha 95	MSS	18	240	15.48	22.50	6.98
Sids 1	MSS	36	280	18.06	45.00	4.95
Sids 8	MSS	10	225	14.52	12.50	7.88
Sids 12	MSS	40	400	25.81	50.00	4.50
Gemmeiza 9	MSS	16	160	10.32	20.00	7.20
Susceptible
Sakha 61	S	20	320	20.65	25.00	6.75
Sakha 8	S	20	425	27.42	25.00	6.75
Sids 14	S	40	450	29.03	50.00	4.50
Sids 4	S	30	400	25.81	37.50	5.63
Gemmeiza3	S	60	750	48.39	75.00	2.25
Sakha 92	S	40	525	33.87	50.00	4.50
Giza 163	S	40	600	38.71	50.00	4.50
Misr2	S	50	650	41.94	62.50	3.38
Sids 6	S	50	550	35.48	62.50	3.38
Shandweel 1	S	60	800	51.62	75.00	2.25
Misr1	S	60	900	58.06	75.00	2.25
Gemmeiza 11	S	60	925	59.68	75.00	2.25
Giza 155	S	60	700	45.16	75.00	2.25
Gemmeiza 1	S	70	950	61.29	87.50	1.13
Giza 150	S	70	850	54.84	87.50	1.13
Giza 165	S	70	800	51.62	87.50	1.13
Giza 157	S	80	900	58.06	100.00	0.00
Giza 160	S	40	600	38.71	50.00	4.50
Giza 164	S	70	900	58.06	87.50	1.13
Gemmeiza 5	S	20	200	12.90	25.00	6.75
Check	S	80	1550	100.00	100.00	0.00
LSD 5%	-	0.273	21.052	0.192	-	-
1%	-	0.206	15.882	0.147	-	-
^b ITs based on Roelfs et al., (1992)., 0 = Immune. R = resistant (necrosis with few uredinia); MR = moderately resistant (necrosis with small to moderate number of uredinia); MS = moderately susceptible (moderate number of uredinia with chlorotic areas); and S = susceptible (large number of uredinia, no necrosis but chlorosis may be evident).

Table 7

The six disease parameters for wheat genotypes of stripe rust in 2022 season.
Genotypes	FIT	ACI	AUDPC	rAUDPC	CARPA	RRI
Race-specific
Misr3	NIR	0	0	0	0	9.00
Misr4	NIR	0	0	0	0	9.00
Slow rusting I
Giza 171	RMR	1.5	19.5	1.03	1.76	8.84
Sakha 69	RMR	1.5	23.5	1.24	1.76	8.84
Gemmeiza 10	MR	8.0	112	5.89	8.89	8.20
Sids 13	RMR	3.0	40.5	2.13	3.33	8.70
Sakha 93	MR	4.0	58	3.05	4.44	8.60
Sakha 94	RMR	1.5	13.5	0.71	1.76	8.84
Giza 168	MR	8.0	125	6.58	8.89	8.20
Giza 170	MR	4.0	67	3.53	4.44	8.60
Slow rusting II
Sakha 95	MSS	18	222	11.7	20.00	7.20
Susceptible
Sakha 61	S	30	425	22.4	33.33	6.00
Sakha 8	S	30	415	21.8	33.33	6.00
Sids 14	S	60	1150	60.5	66.67	3.00
Sids 4	S	30	465	24.5	33.33	6.00
Sids 12	S	70	1400	73.7	77.78	2.00
Sids 8	S	50	950	50	55.55	4.00
Gemmeiza3	S	60	1225	64.5	66.67	3.00
Sakha 92	S	40	675	35.5	44.44	5.00
Giza 163	S	40	690	36.3	44.44	5.00
Misr2	S	60	1175	61.8	66.67	3.00
Sids 6	S	50	925	48.7	55.55	4.00
Shandweel 1	S	60	1240	65.3	66.67	3.00
Misr1	S	60	1200	63.2	66.67	3.00
Gemmeiza 11	S	80	1690	88.9	88.89	1.00
Giza 155	S	60	1150	60.5	66.67	3.00
Gemmeiza 1	S	70	1390	73.2	77.78	2.00
Giza 150	S	70	1500	78.9	77.78	2.00
Giza 165	S	70	1425	75	77.78	2.00
Giza 157	S	80	1700	89.5	88.89	1.00
Giza 160	S	40	675	35.5	44.44	5.00
Gemmeiza 5	S	30	465	24.5	33.33	6.00
Gemmeiza 9	S	30	475	25	33.33	6.00
Giza 162	S	80	1600	84.2	88.89	1.00
Giza 164	S	70	1350	71.1	77.78	2.00
Giza 167	S	70	1350	71.1	77.78	2.00
Sids 1	S	30	465	24.5	33.33	6.00
Sakha 62	S	30	462	24.3	33.33	6.00
Check	S	90	1900	100	100.00	0.00
LSD 5%	-	3.45	15.52	6.43	-	-
1%	-	2.21	10.23	4.23	-	-
^b ITs based on Roelfs et al., (1992)., 0 = Immune. R = resistant (necrosis with few uredinia); MR = moderately resistant (necrosis with small to moderate number of uredinia); MS = moderately susceptible (moderate number of uredinia with chlorotic areas); and S = susceptible (large number of uredinia, no necrosis but chlorosis may be evident).

The slow rusting group was divided into two categories of genotypes based on infection types. The first one, included 7 genotypes; Giza 171, Sakha 69, Gemmeiza 10, Sids 13, Sakha 93, Sakha 94, and Giza 168, Gemmeiza 9, and showed ACI values ranging from 0.6 to 8.0 in the three seasons (Tables 5, 6 and 7). The second category, including one genotype, Sakha-94, showed average coefficient of infection (ACI) values ranging from 18 to 24 in the three seasons. The last group includes the susceptible genotypes that have ACI values of up to 18 with the rest of the genotypes, compared to the check genotype (80–90%) in the three seasons.

Estimated AUDPC, rAUDPC and relative resistance index (RRI) values

Based on AUDPC values, wheat genotypes under study could be categorized into three main groups. The first group included wheat genotypes Misr 3 and Misr 4, which showed zero AUDPC and rAUDPC values, as well as RRI equal 9. Thus, they were classified as a completely resistant group of genotypes, which had race-specific resistance against the P. striiformis population during the three seasons. The second group, including the genotypes, recorded the lowest values of AUDPC and rAUDPC of less than 240 and 15.48%, respectively, as well as RRI value ≥ 7 ≤ 9 in the three seasons. The third group had the fast rusting genotypes, which contained wheat genotypes displayed high AUDPC values and the rAUDPC ratio reached 1700 and 89.5 percent, respectively, compared to the check genotype, Morocco, which displayed the highest AUDPC values (1900) and the highest rAUDPC ratio (100%) during the three seasons (Tables 5, 6 and 7).

Response of wheat genotypes carrying stripe rust:

A diverse adult plant reaction under field conditions was observed in the tested wheat genotypes with known stripe rust resistance genes. The final stripe rust severity (%) for most of these genotypes varied from one year to another, as affected by the slight changes in environmental conditions between the three seasons under study. The differential sets (Yr^,s) and wheat genotypes carrying stripe rust resistance genes showed a wide range of rust response during the 2020, 2021, and 2022 seasons under field conditions (Table 8).

Table 8

Stripe rust responses of wheat genotypes (Yr^,s) at adult stage over three cropping seasons (2020, 2021 and 2022).
No.	Genotypes/gene	Season / Stripe rust responses
No.	Genotypes/gene	2020	2021	2022
1	Morocco	100S	100S	100S
2	Avocet S - YrA	100S	30S	80S
3	Avocet A + YrA	90S	50S	70S
4	Yr1/6* AOC	30S	20S	70S
5	SIETE CERROS T66	10S	20S	60S
6	TATARA	0	TrS	0
7	Yr5/6* Avocet S	0	0	0
8	Yr6/6 Avocet S*	100S	60S	70S
9	Yr7/6 Avocet S*	100S	70S	80S
10	Yr8/6 Avocet S*	5MR	0	0
11	Yr9/6 Avocet S*	100S	60S	80S
12	Yr10/6 Avocet S*	0	0	10MS
13	Yr15/6 Avocet S*	0	0	0
14	Yr17/ 6 Avocet S*	10MS	30MSS	50MSS
15	Yr18/6 Avocet S*	50MS	60MS	30MS
16	Yr24/6 Avocet S*	30S	30S	30MSS
17	Yr26/6 Avocet S*	50MS	30MS	60MRMS
18	Yr27/6 Avocet S*	20MSS	10S	20MRMS
19	YrSp/6 Avocet S*	0	0	5MS
20	PAVON F 76	40S	20S	30S
21	SERI M82	50S	30S	60S
22	OPATA M 85	5MR	10MR	10MR
23	SUPER KAUZ	0	0	0
24	YrCv/6* Avocet S (Yr32)	50S	30S	60S
25	PBW343	30S	10S	30S
26	AOC-YR*3/3/ALTAR 84/AE.SQ//OPATA	50S	30S	30S
27	AOC-YR3//LALBMONO 14/PVN	70S	40S	60S
28	AOC-YR*3 / PASTOR	90S	70S	100S
29	POLLMER	90S	30S	30S
30	PASTOR	20S	40S	60S
31	REBECA F2000	60S	30S	50S
32	FRANCOLIN #1	80S	40S	80S
33	AOC-YR/QUAIU/#3	80S	30S	80S
34	OPATA/PASTOR CO5607 A020	0	0	0
35	OPATA/PASTOR CO5607 A047	0	0	0
36	AOC-YR/QUAIU # 3	80S	30S	80S
37	M10 (MUTATED C-306) / AOC-YR	50S	10S	80S
38	CHUAN NONG 19	10R	10R	20MR
39	IRAGI	10MR	10MR	10MR
40	KOELZ W 11192:AE	30MS	30MS	60MSS
41	PBW343/KKU	0	0	5S
42	AOC-YR3 //LALBMONO14/PVN	70S	30S	80S
43	Yr33	0	0	10S
44	Yr34	10MR	20MR	20MR
45	Yr35 98M71	60S	30S	70S
46	Yr37	0	0	0
47	Yr4BL	10MR	20MR	20MR
48	Yr51	0	TrMR	5R
49	Yr54	50S	50S	80S
50	Yr57	0	5MR	5R
51	YrKK	0	0	0
52	YrAId	5MR	5MR	0
% rust severity based on the modified Cobb Scale's (Peterson et al., 1948) and response to infection as described by (Roelfs et al., 1992).

Resistance genes, such as Yr5, Yr15, Yr33, Yr37, and Yrkk and the genotypes carrying stripe rust like Super Kauz, Opata/Pastor, and PBW 343/KKU, were completely resistant to stripe rust (no disease symptoms) during the three seasons. In addition to that, some of the genotypes, namely; Yr34, Yr51, Yr57, Yr4BL, Opata 58, Chuan Nong 19, and IRAGI, had R-type or MR-type reactions, which so far are resistant (Table 8). In addition, the most important resistance genes, i.e., Yr1, Yr10, Yr32, and YrSp, known as resistant to the previously characterized races of stripe rust in Egypt (2020 and 2021), became susceptible in this study, which indicated continual changes in virulence in the P. striiformis population in the 2022 season compared to races in the two previous seasons.

Changes of races in P. striiformis, the wheat stripe rust pathogen:

Wheat stripe rust was a disease of maritime climate zones and occurring in most wheat areas with cool and moist weather conditions during the growing season, which are the suitable factors to the wide distribution of the disease. Based on virulence of strip rust pathogen to the Yr genes on different genotypes, the races varied from year to year. New races were appeared and became virulence to resistant gens and wheat genotypes such as Yr10, YrSp and Giza 170 during the 2022 growing season. In Egypt, old races (e.g. 0E0, 2E16, 6E4, 6E16 and 70E32) were a virulence on most wheat genotypes. When the new races, Yr27- and the warrior race which arrived from Europe in 2011 were most virulence. The wheat stripe rust disease patterns in the fields totally changed (Fig. 1).

The new races had a considerable change in the resistance level of many genotypes (Fig. 1). Some genotypes, e.g., Mir 3 and Misr 4 remained resistant; however, several formerly resistant genotypes, e.g., Misr 1 and Misr 2, became susceptible with ratings between 50S and 60S. Already susceptible genotypes, e.g., Sids 12 and Gemmeiza 11 became even more susceptible due to the higher aggressiveness of the new races.

Molecular Characterization of wheat genotype:

The proposed study was based on the hypothesis that identifying sources of resistance against P. striiformis populations in Egypt from 2020 to 2022 and molecular detection of known effective resistance genes Yr's will provide wheat breeders with enough indication of stripe rust resistance genes to begin future breeding programs.Accordingly, ten specific markers were used for the detection of the yellow rust resistance genes: Yr5, Yr9, Yr10, Yr15, Yr17, Yr18, Yr26, Yr29, Yr30, and Yr36 in selected 20 wheat genotypes. Accordingly, Yr5, Yr10, and Yr15 were not detected in any wheat genotypes, while Yr26, Yr30, and Yr36 were detected in all genotypes under study (Fig. 3A, B and Table 9). The Yr9 gene was found in eight genotypes: Misr 3, Misr 4, Giza 168, Giza 167, Giza 170, Giza 171, Gemmeiza-9, and Gemmeiza-10, but not in the other genotypes (Fig. 2A and Table 9). The Yr17 gene was detected in only one genotype, Sids 13, (Fig. 2B and Table 9). Yr18 and Yr29 genes were detected in Giza 168, Giza 170, Gemmeiza-9, Gemmeiza-10, and Sids-14 (Fig. 2C and Table 9).

Table 9

Stripe rust resistance genes (*Yr's*) detected by molecular marker analysis in twenty wheat genotypes.
No.	Genotypes	Yr5	Yr9	Yr10	Yr15	Yr17	Yr18	Yr26	Yr29	Yr30	Yr36
1	Misr3	-	+	-	-	-	-	+	-	+	+
2	Misr4	-	+	-	-	-	-	+	-	+	+
3	Giza 168	-	+	-	-	-	+	+	+	+	+
4	Giza 162	-	-	-	-	-	-	+	-	+	+
5	Giza 167	-	+	-	-	-	-	+	-	+	+
6	Giza 170	-	+	-	-	-	+	+	+	+	+
7	Giza 171	-	+	-	-	-	-	+	-	+	+
8	Gemmeiza 9	-	+	-	-	-	+	+	+	+	+
9	Gemmeiza 10	-	+	-	-	-	+	+	+	+	+
10	Gemmeiza 11	-	-	-	-	-	-	+	-	+	+
11	Sakha 62	-	-	-	-	-	-	+	-	+	+
12	Sakha 69	-	-	-	-	-	-	+	-	+	+
13	Sakha 93	-	-	-	-	-	-	+	-	+	+
14	Sakha 94	-	-	-	-	-	+	+	-	+	+
15	Sakha 95	-	-	-	-	-	+	+	-	+	+
16	Sids 1	-	-	-	-	-	-	+	-	+	+
17	Sids 12	-	-	-	-	-	-	+	-	+	+
18	Sids 13	-	-	-	-	+	-	+	-	+	+
19	Sids 14	-	-	-	-	-	+	+	+	+	+
20	Shandweel 1	-	-	-	-	-	-	+	-	+	+
+= Fragment is amplified and the gene is present; - = No specific fragment is amplified and the gene is absent.

Diversity among wheat genotypes

Using rooted trees and the dendrogram, wheat genotypes were divided into groups/clusters based on slow rusting and molecular markers. Based on slow rusting using rooted trees, the dendrogram (Fig. 4A) constructed with banding patterns data included two groups for the tested lines along with the Morocco genotype as a separate line. The first group is divided into two subgroups. The Morocco genotype was presented in one subgroup, while the other subgroup comprised Shandweel 1, Misr 2, Misr 1, and Gemmeiza 11 genotypes. High similarity was found between Misr 1, Misr 2 (susceptible) and Giza 165 (susceptible), as well as between Giza 160. The second group, divided into two subgroups, the first subgroup consisted of Misr 3, Misr 4, and Giza 170 (resistant) at the same similarity. These lines were similar based on the three slow rusting parameters, because these three genotypes were found to be immune, while the other comprised Sids 13, Giza170, and Sakha 93 genotypes (moderately resistant). High similarity was observed between Giza 168 and Gemmeiza 10 genotypes (resistant). The second subgroup consisted of Sakha 62 and Giza 162 genotypes (moderately susceptible).

Based on 10 stripe rust specific markers for 20 wheat genotypes using rooted trees, the dendrogram (Fig. 4B) constructed with banding patterns data included three groups. The first group is divided into two subgroups. Giza 171 and Gemmeiza 10, each of the two-wheat genotypes, were presented in one subgroup independently. while the second subgroup contained Gemmeiza 9 and Giza 168 genotypes at the same similarity.

A marker-assisted backcross programme and gene pyramiding.

A marker-assisted backcross programme was established to integrate stripe rust resistance genes into three wheat genotypes Misr 1, Gemmeiza11 and Sids 14). Combinations between susceptibility wheat genotypes and resistance sources carrying single yr genes were first constructed for genes Yr5 and Yr10, after which the programme was developed to include two genes granting adult resistance. All the selected yr genes supply an exceptional level of resistance to the Egypt stripe rust population, while the recurrent parents selected have useful agronomic and quality traits, but their stripe rust resistance could be enhanced. Misr 1, Gemmeiza11 and Sids 14 are susceptible to the pathogen as shown in Figs. 5 and 6.

The marker-assisted selection could be created in the segregating generations. Up till now lines in the BC2 generation have been created for different crosses (Figs. 5 and 6.). As the connection of the markers to the resistance genes is not concluded, the marker-assisted selection of the yr genes was completed in each issue by phenotypic analysis. Only plants that were resistant to stripe rust and were discovered to include the suitable resistance gene were operated to construct the next BC generation.

Detection of selected stripe rust resistance genes by using molecular markers

The second field in which molecular markers are utilized in wheat genotype resistance breeding is the detection of selected resistance genes in genotypes where the genetic background has not yet been described. The existence of a number of genes is presently being investigated in wheat genotypes and breeding lines produced in Martonvásár or used as parents in the breeding programme. Tests have been assumed out for the existence of a total of ten yr genes (Yr5, Yr9, Yr10, Yr15, Yr17, Yr18, Yr26, Yr29, Yr30, and Yr36) in selected 20 wheat genotypes in the breeding material.

The analysis also revealed the presence of the yr genes in the Egypt breeding material. Among the recorded varieties, ‘Misr 1, Gemmeiza11 and Sids 14 assumes this stripe rust resistance gene, and it has also been noticed in several breeding lines.

Wheat yield production

In this investigation, the results of Table 10 revealed that the seed index value of wheat variety Misr 4 was significantly (P 0.05) higher (46.9 g) than variety Giza-150 (24.04 g), which indicated the grains of Misr 4 are bolder and heavier than those of variety Giza-150. Similarly, the plots implanted with bolder seeds (large size) resulted in heavier grains with an average seed index value of 40.80 g as compared to small-size seeds, where the average seed index value was 25.24 g. The interactive effect revealed that the interaction of Misr4 with large-size seeds resulted in a maximum seed index of 46.9 g, while the interaction between Giza-150 and small-size seeds resulted in a minimum seed index of 25.24 g. The results argue that the increase in seed index value is proportional to the quality of the seed, and in case the farmers are conscious enough to consider this factor and use quality seed, the potential grain weight can be acquired.

Table (10) The seed index value of wheat varieties (1000 kernels weight).

No.	Genotypes	2020	2021	2022
1	Misr1	34.3	32.1	30.2
2	Misr2	35.1	34.4	32.2
3	Misr3	45.3	44.2	45.4
4	Misr4	46.3	46.9	46.4
5	Sakha8	35.4	33.2	31.2
6	Sakha61	39.2	37.3	35.2
7	Sakha69	33.4	31.2	29.4
8	Sakha62	38.7	36.3	35.2
9	Sakha92	40.3	39.8	37.2
10	Sakha93	42.3	43.5	42.4
11	Sakha94	43.4	44.9	44.3
12	Sakha95	45.7	46.8	46.1
13	Gemmeiza1	29.8	27.3	26.5
14	Gemmeiza3	36.3	34.1	32.5
15	Gemmeiza5	39.8	37.3	35.4
16	Gemmeiza9	40.6	42.2	43.4
17	Gemmeiza10	41.3	42.4	43.2
18	Gemmeiza11	29.5	27.2	25.6
19	Giza150	27.6	26.2	24.4
20	Giza155	27.4	25.2	23.5
21	Giza157	27.7	25.9	24.3
22	Giza160	26.3	25.1	22.2
23	Giza162	40.2	42.5	43.8
24	Giza 163	29.3	28.6	26.2
25	Giza164	40.3	42.5	43.3
26	Giza165	27.6	26.4	24.2
27	Giza167	40.7	41.8	42.2
28	Giza168	41.3	42.4	43.2
29	Giza170	43.2	45.1	44.2
30	Giza171	46.5	46.9	45.4
31	Sids1	39.3	38.6	37.2
32	Sids4	40.3	41.7	40.0
33	Sids6	39.3	38.8	36.2
34	Sids8	38.6	37.2	36.4
35	Sids12	27.4	26.3	24.1
36	Sids13	42.2	44.2	43.4
37	Sids14	43.3	45.1	44.3
38	Shandweel1	41.3	42.2	40.6

Stripe rust, often known as yellow rust caused by Puccinia striiformis f. sp. tritici, is a devastating disease that affects wheat (Triticum aestivum L) in the major wheat-growing regions of the world [34, 35]. The most cost-effective way to control the disease is to develop resistant wheat genotypes. This comes at no extra expense to the farmer and is regarded as the first line of protection. The primary goal of the majority of breeding projects for wheat in all areas of the world where wheat is grown is partial resistance to wheat rusts, particularly stripe rust [36–39]. This kind of resistance has also been referred to as polygenic resistance, adult plant resistance, and slow rusting [40, 41]. It has been widely cultivated for many years in a variety of environmental situations and is considered to be durable [42]. For gene deployment, gene pyramiding, and the creation of slow-rusting wheat genotypes, it is crucial to identify slow stripe rust resistance genes [43]. The appearance of yellow rust this season on most of the genotypes and the occurrence of large losses made it necessary to search for sources of partial resistance [2]. Accordingly, field assessment of slow rusting resistance for 38 wheat genotypes was carried out through four disease parameters: average coefficient of infection (ACI), area under the disease progress curve (AUDPC), relative area under the disease progress curve (rAUDPC), and relative resistance index (RRI). The results of the data analysis suggested that the tested wheat genotypes had a variety of genetic histories based on the varying disease reactions to stripe rust that were detected among them. In wheat genotypes during the three growing seasons, 3 genotypes demonstrated an adequate level of near-immune resistance (NIR), 20 genotypes were susceptible (S), 5 genotypes demonstrated a moderately resistant (R to MR), 3 genotypes demonstrated a moderately resistant to moderately susceptible (MR to MS), 2 genotypes demonstrated moderately susceptible, and 5 genotypes demonstrated MS to S infection types.

The two genotypes, Misr 3, and Misr 4, it may be extrapolated, only exhibited a high level of disease resistance with no obvious stripe rust infections or pustules. This sort of resistance may be conferred by a single main gene that is effective, with race-specific responses offering a near-immune reaction to stripe rust.

The wheat genotypes under research could be divided into three major groups (complete resistance, slow rusting and fast rusting) based on AUDPC and rAUDPC values. Throughout the study, it must depend on the second group that is called slow rusting, which had the lowest AUDPC and rAUDPC values, less than 240 and 15.48% in the three seasons, respectively. The genotypes that continued with the disease and gave a good crop were: Sakha-94, Giza 171, Sakha 69, Gemmeiza 10, Sids 13, Sakha 93, Giza 168, and Gemmeiza 9, where these genotypes [35].

In current years, developments in molecular marker methods and marker detection have enabled the spread of marker-assisted selection. This is especially accurate in breeding wheat genotypes for stripe rust resistance, where PCR-based markers are already known for almost half of the sixty or more selected resistance genes and alleles. Likewise, all the influential resistance genes designated so far can be traced in segregating offspring populations using marker-assisted selection.The purpose of the breeding programme cannot be to use lines including a single resistance gene as varieties. Corresponding virulence has now been recognized for practically all the Yr genes in all the wheat-growing areas of the world [6], so if any line carrying a resistance gene that is still sufficient today were to be cultivated on a more extensive area, virulent pathotypes would soon reproduce in the pathogen population. In the 1970s, varieties carrying the 1B/1R translocation, which contained the resistance genes Pm8 for powdery mildew, Lr26 for leaf rust, Sr31 for stem rust, and Yr9 for yellow rust, were presented on extensive areas due to their excellent adaptability and yield potential. In this investigation, the evaluated wheat genotypes with known stripe rust resistance genes showed a variety of adult plant reactions. During the three seasons, genotypes harboring Yr genes like Super Kauz, Opata/Pastor, Opata 58, Chuan Nong 19, and PBW 343/KKU, as well as Yr5, Yr15, Yr33, Yr37, Yrkk, Yr34, Yr51, Yr57, and Yr4BL were resistant to stripe rust [39]. The most crucial resistance genes, Yr1, Yr10, Yr32, and YrSp, which had been resistant to the previously identified races of stripe rust in Egypt (2020 and 2021), turned susceptible in this study, indicating ongoing changes in virulence in the P. striiformis population in the 2022 season compared to races in the three previous seasons. The races changed from year to year depending on how virulent the strip rust infection was to various genotypes and Yr genes. During the 2022 growing season, new races emerged and acquired virulence against resistant genes and wheat genotypes like Yr1, Yr10, Yr32, YrSp, Giza 170 and Giza-171. When the Yr27 race and the warrior race that migrated from Europe in 2011 [45] were at their most virulent. Consequently, the patterns of the wheat stripe rust in the fields have completely changed. The resistance level of several genotypes significantly changed with the introduction of the new races. Several formerly resistant genotypes, such as Mir 3 and Misr 4, but not all genotypes, are no longer resistant such as Misr 1 and Misr 2, Sids12 and Gemmeiza 11.

In order to clarify this, ten specific primers, Yr5, Yr9, Yr10, Yr15, Yr17, Yr18, Yr26, Yr29, Yr30, and Yr36, were employed to identify the yellow rust resistance genes in 20 selected wheat genotypes [46, 47]. As a result, whereas Yr26, Yr30, and Yr36 were found in all of the wheat genotypes under study. Eight genotypes, Misr 3, Misr 4, Giza 168, Giza 167, Giza 170, Giza 171, Gemmeiza-9, and Gemmeiza-10 were found to have the Yr9 gene but not the other genotypes. Recent studies at CIMMYT have shown that the gene Yr46 is closely linked to gene Yr9 [48]. Gene Yr46 is also closely linked to Lr67 [49]. These genes confer slow rusting to yellow and leaf rust. Another minor gene, Yr30, involved in the adult plant resistance of several CIMMYT wheat was found to be in the chromosomal region carrying durable stem rust resistance gene Sr2 [50]. On chromosome 7DS, the Lr34/Yr18/Sr57/Pm38 complex, a resistance gene, confers adult-plant resistance (APR), slow rusting resistance, or partial resistance (PR) to leaf rust, yellow rust, and a number of other diseases of wheat [50]. Additionally, the 1BL Lr46/Yr29 complex demonstrated resistance to both yellow and leaf rusts. As a result, the genes Yr18 and Yr29 were found in the Giza 168, Giza 170, Gemmeiza-9, Gemmeiza-10, and Sids 14 genotypes. It was noticed that these resistance genes such as Yr5, Yr10, and Yr15 were not known in any genotypes under study, which explains why some genotypes do not persist for a long time.

Despite the fact that resistance genotypes containing Yr genes decrease when faced with disease pressure. This is because the plants' physiological responses to the inoculation likely involve defensive measures that utilize host energy that would otherwise be used for growth and seed generation. In addition, hypersensitive flecking can reduce yield by reducing the amount of phytosynthetic leaf area [51]. More than 76 Yr genes that confer either race-specific resistance or non-race-specific mature plant resistance have been identified in wheat studies globally so far (APR). According to the gene-to-gene theory, a single dominant R gene is thought to be responsible for the race-specific resistance, which shares the trait of hypersensitive response (HR). Also, PstS1 and PstS2, two isolates of yellow rust with high temperature adaption, were discovered for the first time in 2000. Both strains originated in East Africa, PstS1 as early as the 1980s, and migrated to the Americas in 2000 and to Australia in 2002, according to molecular analyses [52]. The abrupt emergency as well as the quick and widespread proliferation of new hostile races. The Pst population in Egypt has recently been found to be infected with PstS1 and PstS2, which are continuously changing in virulence. Its pathogenicity to Yr1, Yr10, Yr27, Yr32, and YrSP has sparked a hunt for novel sources of resistance to these aggressive races of wheat stripe rust [2].

Furthermore, DNA characterization for genotypes using 10 specific primers were performed to determine the presence of the effective Yr resistance genes. Using a rooted tree dendrogram, the stowing of diversity and cluster analysis of wheat genotypes were carried out. The tested wheat genotypes exhibit substantial genetic diversity. wheat genotypes with reasonably accurate predictions of their resistance to wheat stripe rust disease. A circumstance where "Misr 3, Attila and PBW65" were closely associated with the wheat genotype in the pedigree (ATTILA*2/PBW65*2/KACHU) as a potential donor of Yr stripe rust resistance genes can be seen. Both parents contain genes for resistance to yellow rust. Also, wheat genotype Sakha 94 with ‘OPATA’ in the pedigree is a possible donor of the Yr18 stripe rust resistance gene.

Such research is important because it provides wheat breeders with information on stripe rust resistant genes as well as ineffective genes that can be used to produce stripe rust resistant wheat genotypes. The current work also suggests that molecular markers can be used quickly and thoroughly to analyze genetic diversity and investigate the genetic basis of phenotypic variation in wheat for a large number of accessions from a germplasm collection. Thus, genetic variety, in which individuals within a population differ in their alleles, frequently results in the transmission of these advantageous genetic features from one generation to the next.

In the present study, we found considerable variation in the final rust severities of the wheat genotypes that may be due to differences in the number of resistance genes present and the mode of gene action, where Misr 3 and Misr 4 were marked as near-immune resistance. Also, genotypes with a low FRS under high disease pressure may possess more additive genes or genes with larger effects. For durable resistance in wheat, breeding programmers in Egypt and around the world would take into consideration the use of genes like Yr5, Yr10, and Yr15 for adult-plant resistance. In this respect, the molecular markers can confirm the presence of the requested resistance gene in the genetic background, and in the case of plants carrying adult plant resistance genes—like Yr5, Yr10, and Yr15—this is the best way to select suitable parents for the crossing program. through the use of marker-assisted choosing, whereby breeders establish molecular markers correlated to Yr genes, allows the pyramiding of more than one effective resistance gene. With the assistance of molecular markers, resistance genes are effortless to notice in wheat varieties of unrecognized parentage. This information can then be used to create crossing programs.

Acknowledgement

The authors are thankful to Wheat Research Department, Field Crops Institute, ARC and International Maize and Wheat Improvement Center (CIMMYT), Mexico for supplying valuable germplasm lines used in the study.

Authors’ contributions

Conceptualization, A. A. S., R. .I O., and H.S.O., methodology,A. A. S., R. .I O., H. A. O., H. S., M.S., T. E. , M.A.Z.; and H.S.O software A. A. S., R. .I O. and H.S.O.; validation, . A. S., R. .I O. and H.S.O; formal analysis, A. A. S., R. .I O.., H. A. O., H. S., M.S., T. E. and H.S.O., H.S.O. , M.A.Z and.; investigation, A. A. S., R. O. and H.S.O. ; resources A. A. A. S., R. .I O.., H. A. O., H. S., M.S., T. E., H.S.O.,A. A. S., R. O., H. A. O., H. S., M.S., T. E and H.S.O ; writing original draft preparation, A. A. S., R. .I O., and H.S.O..; writing, review and editing, A. A. S., R. O., H. A. O., H. S., M.S., T. E. and H.S.O.;visualization, A. A. S., R. .I O, H. A. O., H. S., M.S., T. E. and H.S.O..; supervision, A. A. S., R. .I O, and H.S.O.; project administration, A. A. S., R. .I O and H.S.O. Allauthors have read and agreed to the published version of the manuscript.

Funding

Open access funding provided by The Science, Technology & InnovationFunding Authority (STDF) in cooperation with The Egyptian Knowledge Bank|)EKB). The study was supported by the science, technology & development

fund Authority (STDF) and Cairo University.

Availability of data and materials

The datasets analyzed during the current study are available from the corresponding author on reasonable request.All data used in this manuscript have been presented within the manuscript. No data are hidden or restricted.Declarations

Informed Consent Statement:

Not applicable

Competing interests

The authors declare no competing interests.

Authors and Affiliations

Plant Pathology Research Institute, Agricultural Research Center (ARC)

Atef A. Shahin, Reda I. Omara, Hend A. Omar, Heba Saad El-Din, Mohamed SehsahandTarek Essa1

Deparment of Plant Pathology, Faculty Of Agriculture., Cairo University

Marwa A.Zayton

Deparment of Genetics, , Faculty Of Agriculture., Cairo University

Hanaa S. Omar

B.C. Curtis, Wheat in the world. In: B.C. Curtis, S. Rajaram, H.G. Macpherson, Bread wheat improvement and production, FAO Plant Production and Protection Series Rome: FAO, (2002) 1–19.
A.A. Shahin, Occurrence of new races and virulence changes of the wheat stripe rust pathogen (Puccinia striiformis f. sp. tritici) in Egypt, Archives Phytopathol. Plant Protection, 53 (11–12) (2020a) 552–569.
Y.H. El-Daoudi, I. Shafik, E.H. Ghamem, S.A. Abu El-Naga, S.O. Sherif, M.M. Khalifa, R.A. Mitkees, A.A. Bassiouni, Stripe rust occurrence in Egypt and assessment of grain yield loss in 1995, Proc. Du Symposium Regional Sur les Maladies des Cerales et des Legumineuses Alimentaries 11–14 November Rabat Morocco, (1996) 341–351.
A.A. Shahin, M.A. Shmawy, W. El-Orabey, S. Esmail, Yield losses in wheat caused by stripe rust (Puccinia striiformis) in Egypt, American J. Life Sci., 8 (5) (2020b) 127–134.
A.A. Shahin, Kh.E. Ragab, Genetic of adult plant resistance to stripe rust in the two Egyptian bread wheat genotypes Giza168 and Giza160, J. Plant Prot. Path. Mansoura Univ., 6 (4) (2015) 587–596.
R.A. McIntosh, Y. Yamazaki, J. Dubcovsky, W.J. Rogers, C. Morris, R. Appels, X.C. Xia, Catalogue of Gene Symbols for Wheat. In: 12th International Wheat Genetics Symposium, (2013) pp. 8–13.
R.R. Nelson, Genetics of horizontal resistance to plant diseases. Annu Rev Phytopathol 16: (1978) 359–378. doi:10.1146/annurev.py.16.090178.002043 Return to ref 1978 in article.
D.R. Knott, The Wheat Rust Breeding for Resistance. In: Monographs on Theoretical and Applied Genetics, Springer-Verlag, Berlin, (1989) pp. 201.
A.E. Melchinger, Use of molecular markers in breeding for oligogenic disease resistance. Plant Breed 104 (1990) 1–19. doi:10.1111/j.1439-0523.1990.tb00396.
R.P. Singh, H.M. William, J. Huerta-Espino, G. Rosewarne, Wheat Rust in Asia: Meeting the Challenges with Old and New Technologies, In “Proceedings of the 4th International Crop Science Congress”, Brisbane (2004).
S.N. Kisana, Y.M. Mujahid, Z.S. Mustafa, Wheat Production and Productivity 2002–2003. A Technical Report to Apprise the Issues and Future Strategies, National Agric. Res. Center, Pakistan Agric. Research Council Islamabad, (2003) 19 pp.
X.M. Chen, Epidemiology and control of stripe rust [Puccinia striiformis f. sp. tritici] on wheat, Can. J. Plant Pathol., 273 (2005) 314–337.
Y. Jin, L.J. Szabo, M. Carson, Century-old mystery of Puccinia striiformis life history solved with the identification of Berberis as an alternate host, Phytopathology, 100 (2010) 432–435.
R.W. Stubbs, E.E. Prescott, E.E. Saari, H.J. Dubin, Cereal disease methodology manual. CIMMYT, Mexico, (1986).
C.C. Chu R.D. Hill, A.L. Brule-Babel, High frequency of pollen embryoid formation and plant regeneration in Triticum aestivum L. on monosaccharide containing media. Plant Sci., 66 (1990) 255–262. doi:10.1016/0168-9452(90)90211-6 Return to ref 1990 in article.
J.J. Zhuang, X. Jia, Increasing differentiation frequencies in wheat pollen callus. In: Hu H, Vega MR (eds) Cell and tissue culture techniques for cereal crop improvement. Science Press, Beijing, (1983) pp 431–448.
R.F. Peterson, A.B. Compbell, A.E. Hannah, A diagrammatic scale for estimating rust intensity on leaves and stems of cereal, Can. J. Res., 60 (1948) 496–500.
A.P. Roelfs, R.P. Singh, E.E. Saari, Rust Diseases of Wheat: Concept and Methods of Diseases Management, CIMMYT, (1992) 81.
H.N Pandey, T.C. Menon, MV. Rao A simple formula for calculating area under disease progress curve, Rachis, 8 (1989) 38–39.
M.O. Akello, F. Nzuve, F. Olubayo, G. Macharia, J. Muthomi, Identification of resistance sources to wheat stem rust from introduced genotypes in Kenya, J. Agric. Sci., 9 (2) (2017) 73–87.
M. Aslam, Uniform Procedure for Development and Release of Improved Wheat Varieties, Mimeograph, ARC: Islamabad, Pakistan (1982).
M.A. Akhtar, I. Ahmad, J.I. Mirza, A.R. Rattu, A.A. E-Ul-Haque Hakro A.H. Jaffery, Evaluation of Candidate lines against stripe and leaf rusts under national uniform wheat and barley yield trial 2000–2001, Asian J. Plant Sci., 1 (2002) 450–453.
S.O. Rogers, A.J. Bendich, Extraction of total cellular DNA from plants, algae and fungi. p D1 1–8. IN S.B. Gelvin, R.A. Schilport, (Eds.), Plant Molecular Biology Manual 2nd edition (1994).
G.P. Yan, X.M. Chen, R.F. Line, C.R. Wellings, Resistance gene-analog polymorphism markers co-segregating with the Yr5 gene for resistance to wheat stripe rust, Theor. Appl. Genet., 106 (2003) 636–643.
R. Mago, W. Spielmeyer, G.J. Lawrence, E.S. Lagudah, J.G. Ellis, A. Pryor, Identification and mapping of molecular markers linked to rust resistance genes located on chromo-some 1RS of rye using wheat-rye translocation lines, Theor. Appl. Genet., 104 (2002) 1317–1324.
L. Wang, J. Ma, R. Zhou, X. Wang, J. Jia, Molecular tagging of the yellow rust resistance gene Yr10 in common wheat, P.I.178383 (Triticum aestivum L.). Euphytica, 124 (2002) 71–73.
H.S. Bariana, G.N. Brown, U.K. Bansal, H. Miah, G.E. Stenden, M. Lu, Breeding triple rust resistant wheat cultivars for Australia using conventional and marker assisted selection technologies, Australian J. Agri.c Res., 58 (2007) 576–587.
M. Helguera, I.A. Khan, J. Kolmer, D. Lijavetzky, L. Zhong-qi, D. Ubcovsky, PCR assays for the Lr37, Yr17 and Sr38 cluster of rust resistance genes and their use develop isogenic Hard Red spring wheat lines, Crop. Sci., 43 (2003) 1839–1847.
E.S. Lagudah, H. McFadden, R.P. Singh, J. Huerta-Espino, H.S. Bariana W. Spielmeyer, Molecular genetic characterization of the Lr34/Yr18 slow rusting resistance gene region in wheat. Theor. Appl. Genet., 114 (2006) 21–30.
C.M. Wang, Y.P. Zhang, D.J. Han, Z.S. Kang, P.D. Chen, SSR and STS markers for wheat stripe rust resistance gene Yr26, Euphytica, 159 (2008) 359–366.
K. Suenaga, R.P. Singh, J. Huerta-Espino, M. William, Micro satellite markers for genes Lr34/Yr18 and other quantitative trait loci for leaf rust and stripe rust resistance in bread wheat, Phytopathol., 93 (2003) 881–890.
W. Spielmeyer, P.J. Sharp, E.S. Lagudah, Identification and validation of markers linked to broad spectrum stem rust resistance gene Sr2 in wheat (Triticum aestivum L.), Crop Sci. 43, (2003) 333–336.
U. Cristobal, J.C. Brevis, X. Chen, I. Khan, L. Jackson, O. Chicaiza, A. Distefeld, T. Fahima, J. Dubcovsky, High temperature adult plant (HTAP) stripe rust resistance gene Yr36 from Triticium turgidum ssp. Dicoiccoides is closely linked to the grain protein content locus Gpc-BI, Theor. Appl. Genet., (112) (2005) 97–105.
R.I. Omara, D.R. El-Naggar, N.I. Abd El-Malik, H.A. Ketta, Losses assessment in some Egyptian wheat cultivars caused by stripe rust pathogen (Puccinia striiformis), Egypt J. Phytopathol., 44 (2016) 199–203.
O.I. Mabrouk, M.A. Fahim, O.E. Abd El Badeea, R.I. Omara, The Impact of Wheat Yellow Rust on Quantitative and Qualitative Grain Yield Losses under Egyptian Field Conditions, Egyptian J. Phytopathol., 50 (2022) 1–19.
S. Ali, S.J.A. Shah, I.H. Khalil, H. Raman, K. Maqbool, W. Ullah, Partial resistance to yellow rust in introduced winter wheat germplasm at the north of Pakistan, Aust. J. Crop Sci., 3 (2009) 37–43.
S.A. Safavi, Evaluation of slow rusting parameters in thirty-seven promising wheat lines to yellow rust, Tech. J. Eng. Appl. Sci., 2 (2012) 324–329.
A.A.M. Abu Aly, R.I. Omara, N.I. Abd El-Malik, Evaluation of new sources of resistance to wheat stripe rust (Puccinia striiformis f.sp. tritici), under Egyptian field conditions, J. Plant Prot. Path. Mansoura Univ., 8 (2017) 181–188.
M. Mitiku, N.B. Hei, M. Abera, Characterization of Slow Rusting Resistance Against Stem Rust (Puccinia graminis f. sp. tritici) in Selected Bread Wheat Genotypes of Ethiopia, Adv. Crop Sci. Tech., 6 (2018) 389.
A.K. Pathan, R.F. Park, Evaluation of seedling and adult plant resistance to leaf rust in European wheat genotypes, Euphytica, 149, (2006) 327–342.
N. Hei, H.A. Shimelis, M. Laing, B. Admassu, Assessment of Ethiopian Wheat Lines for Slow Rusting Resistance to Stem Rust of Wheat Caused by Puccinia graminis f.sp. tritici, (2015) doi: 10.1111/jph.12329.
R.P. Singh, J. Huerta-Espino, S. Bhavani, S.A. Herrera-Foessel, D. Singh, P.K. Singh, G. Velu, R.E. Mason, Y. Jin, P. Njau, J. Crossa, Race non-specific resistance to rust diseases in CIMMYT spring wheats, Euphytica, 179 (2011) 175–186.
R.I. Omara, A.A. Shahin, S.M. Ahmed, Y.S. Mostafa, S.A. Alamri, M. Hashem, M.M. Elsharkawy, Wheat resistance to stripe and leaf rusts conferred by introgression of slow rusting resistance genes, J. Fungi 7 (2021) 1–18.
A.A. Shahin, Effective Genes for Resistance to Wheat Yellow Rust and Virulence of Puccinia striiformis f. sp. tritici in Egypt, Egypt. Acad. J. Biolog. Sci., 8(2) (2017) 1–10.
M.S. Hovmøller, S. Walter, R.A. Bayles, A. Hubbard, K. Flath, Sommerfeldt, M.. Leconte, P Czembor, J. Rodriguez-Algaba, T. Thach, J.G. Hansen, P. Lassen, A.F. Justesen, S. Ali, C. de Vallavieille-Pope, Replacement of the European wheat yellow rust population by new races from the centre of diversity in the Near-Himalayan region, Plant Pathol., 65 (2016) 402–411.
T. Schnurbusch, E. Bossolini, M. Messmer, B. Keller, Tagging and validation of a major quantitative trait locus for leaf rust resistance and leaf tip necrosis in winter wheat cultivar Forno, Phytopathology, 94 (2004) 1036–1041.
A.A. Shahin, A.H. Omar, A.B. El-Sayed, Characterization of Yr18/Lr34 partial resistance gene to yellow rust in some Egyptian wheat genotypes, Egy. J. Plant Pro. Res., 6 (3) (2018) 1–9.
R.P. Singh, J. Huerta Espino, H.M. William, Genetics and breeding for durable resistance to leaf and stripe rusts in wheat, Turkisk J. Agric. Forestry, 29 (2) (2005) 121–127.
S.A. Herrera-Foessel, E.S. Lagudah, J. Huerta-Espino, M.J. Hayden, H.S. Bariana, D. Singh, R.P. Singh. New slow-rusting leaf rust and stripe rust resistance genes Lr67 and Yr46 in wheat are pleiotropic or closely linked. Theor. Appl. Genet., 122 (2011) 239–249.
R.P. Singh, J. Huerta-Espino, S. Rajaram, Achieving near-immunity to leaf and stripe rusts in wheat by combining slow rusting resistance genes. Acta Phytopathol Entomol Hung, 35 (2000) 133–139.
S.A. Herrera-Foessel, R.P. Singh, J. HuertaEspino, J. Crossa, J. Yuen, A. Djurel Effect of leaf rust on grain yield and yield trait of durum wheats with race specific and slow-rusting resistance to leaf rust. Plant Dis., 90 (2006) 1065–1072.
S. Walter, S. Ali, E. Kemen, K. Nazari, B.A. Bahri, J. Enjalbert, J.G. Hansen, J.K. Brown, T. Sicheritz-Pontén, J. Jones, C. de Vallavieille-Pope, M.S. Hovmøller, A.F. Justesen Molecular markers for tracking the origin and worldwide distribution of invasive strains of Puccinia striiformis. Ecol. Evol., 6 (2016) 2790–2804.

No competing interests reported.

Investigation, identification and introgression of a novel stripe rust resistant genes using marker-assisted selection in breeding wheat genotype

Status:

Version 1

Abstract

Figures

Introduction

Materials and Methods