Antibodies and reagents
The following antibodies were used for western blot analysis; anti-GDF15 antibody (cat.no. ab223539; Abcam), anti-snail antibody (cat.no. ab53519; Abcam), anti-slug antibody (cat.no. ab106077; Abcam), anti-β-actin antibody (cat.no. ab8224; Abcam), anti-E-cadherin antibody (cat.no. ab40772; Abcam), anti-Vimentin antibody (cat.no. ab92547; Abcam), anti-SCAP antibody (cat.no. ab125186; Abcam), anti-SREBF2 antibody (cat.no. ab30682; Abcam), and anti-HMGCR antibody (cat.no. ab174830; Abcam). Antibodies used for immunohistochemistry analysis were as follows; anti-GDF15 antibody (cat.no. ab223539; Abcam), anti-E-cadherin antibody (cat.no. ab40772; Abcam), anti-Vimentin antibody (cat.no. ab92547; Abcam), anti-SCAP antibody (cat.no. ab125186; Abcam), anti-SREBF2 antibody (cat.no. ab30682; Abcam), and anti-HMGCR antibody (cat.no. ab174830; Abcam). β-cyclodextrin (β-CD)and Cholesterol-Water Soluble powder was purchased from Sigma‐Aldrich (St. Louis, MO). Recombinant human GDF15 (rhGDF15) was purchased from R&D Systems (Minneapolis, MN). Matrigel was purchased from Advanced BioMatrix (San Diego, CA). High-cholesterol diet was purchased from Trophic Animal Feed High-Tech Co., Ltd (Nantong, China).
Tumor Samples
This study was approved by the Ethics Committee of Zhongshan Hospital of Fudan University, Shanghai, China (B2016-100). EC tumor and matched para-cancer tissues were obtained from twenty patients undergoing treatment at the Zhongshan Hospital of Fudan University, from 2018 to 2019. Follow-up and clinical pathology data were collected from these twenty patients. All tissues were stored at -80°C until required.
Cell culture
ESCCs KYSE 150 and EC 9706 (Chinese Academy of Science cell bank, Shanghai, China) were cultured using Roswell Park Memorial Institute-1640 media (RPMI-1640; Invitrogen; Thermo Fisher Scientific, Inc., USA) supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin. Cells were cultured in a humidified atmosphere of 5% CO2 at 37°C.
Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)
Total cellular RNA was extracted using TRIzol (Invitrogen; Thermo Fisher Scientific, Inc.). The All-in-One™ miRNA qRT-PCR reagent kit (GeneCopoeia Inc. Maryland) was used to reverse-transcribe total cellular RNA into cDNA and then amplified using miRNA specific primers. Target gene expression was quantified using the 2-∆∆Cq method and normalization to U6 levels.
Western blot analysis
RIPA buffer containing PMSF (Beyotime Institute of Biotechnology) was used to lyse cells on ice. The BCA protein assay (Pierce; Thermo Fisher Scientific, Inc.) was then used to measure the protein concentration of the samples. SDS-PAGE was used to separate total protein (20 μg/well). Proteins were then transferred onto a PVDF membrane (EMD Millipore), blocked using 5% low-fat milk for one hour, and then incubated with the relevant primary antibodies at 4˚C overnight. The next day, membranes were incubated with secondary antibodies (Beyotime Institute of Biotechnology) for 1 hour at 37˚C. Protein bands were visualized using ECL (Pierce; Thermo Fisher Scientific, Inc.). Target protein levels were normalized to β-actin levels .
Migration and invasion assays
Cellular migration and invasion were determined using Transwell Chambers (Corning Inc., USA). Briefly, 5 × 104 cells were added to the upper chamber (Matrigel (Corning Inc., USA), (diluted 1:9) pre-coated for invasion) with 200 μl of serum-free media. The bottom chamber contained 600ul of complete media. After 24 h, cells on the upper surface of the membrane were removed, and cells that had migrated to the lower membrane were fixed and stained. Cell numbers were analyzed using a microscope (Leica Microsystems, Germany).
Transfection
siRNA against human GDF15 (hU6-MCS-CBh-gcGFP-IRES-puromycin) and the appropriate scramble control siRNA were purchased from Genechem Co. Ltd (Shanghai, China). ESCC cells at 30-50% confluence were transfected with lentivirus vector in the presence of 5 μg/mL of polybrene for 24 hours. Lentivirus-mediated overexpression of SCAP (Ubi-MCS-3FLAG-CBh-gcGFP-IRES-puromycin) and the appropriate negative control was purchased from Genechem Co. Ltd (Shanghai, China). ESCC cells at 30-50% confluence were infected with lentivirus in the presence of 5 μg/mL of polybrene for 24 hours. MiR-1324 mimics (5ʹCCAGACAGAAUUCUAUGCACUUUC3ʹ, 5ʹAAGUGCAUAGAAUUCUGUCUGGUU3ʹ) and the negative control were obtained from (GeneCopoeia Inc. Maryland). ESCC cells at 50-80% confluence were transfected with the mimics in the presence Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions for 48 hours. Lentivirus-mediated overexpression of miR-1324 (hU6-MCS-Ubiquitin-EGFP-IRES-puromycin) and negative control was obtained from Genechem Co. Ltd (Shanghai, China). ESCC cells at 30-50% confluence were infected with lentivirus in the presence of 5 μg/mL of polybrene for 24 hours.
Immunohistochemistry
Lung tissues from nude mice and clinical samples were fixed at room temperature with 4% paraformaldehyde for approximately10 hour before paraffin embedding. Tissues were then sectioned into 4-μm thick slices. Deparaffinization and rehydration were performed using xylene and a graded series of ethanol respectively. Hematoxylin and Eosin (H&E) (Beyotime Institute of Biotechnology) was used to stain lung tissues. Clinical samples were incubated with specific primary antibodies against GDF15 (cat.no. ab223539; Abcam), E-cadherin (cat.no. ab40772; Abcam), Vimentin (cat.no. ab92547; Abcam), SCAP (cat.no. ab125186; Abcam), SREBF2 (cat.no. ab30682; Abcam), or HMGCR (cat.no. ab174830; Abcam) at 4˚C overnight followed by incubation with the appropriate secondary antibody (cat. no. A0208, Beyotime Institute of Biotechnology) for 30 minutes at room temperature. DAB was used as the chromogen. Images were captured using a microscope (Leica Microsystems, Germany).
Co-immunoprecipitation (CoIP) assays
Total proteins were extracted using the Thermo Scientific IP Lysis Buffer (Cat. No. 87787) containing PMSF. Cell lysates were incubated with antibodies against GDF15 (cat.no. ab223539; Abcam) or SCAP (cat.no. ab125186; Abcam) at 4 °C on a shaker overnight, followed by incubation with 50 µl Protein A/G PLUS-Agarose beads (Cat. No.sc-2003; Santa Cruz Biotechnology, Inc.) for an additional 10 h. Beads were then washed 4 times with 1 mL Lysis Buffer before denaturation using 2 × SDS sample buffer at 100 °C for 20 min for subsequent western blot assays.
Dual-Luciferase Reporter Assay
Target genes of miR-1324 were identified using Targetscan. Wild-type and mutant 3ʹUTR sequence of GDF15 were synthesized and inserted into the pGL3 promoter vector (WT:PGL3-CMV-LUC-H_GDF15; MT:PGL3-CMV-LUC-H_GDF15) (Genomeditech Co. Ltd.). Cells were co-transfected with the 3ʹ-UTR WT or MT plasmid with miR-1324 or negative control using Lipofectamine 2000 (Invitrogen, Thermo Fisher Scientific, Inc.). 48 hours post-transfection, relative luciferase activity was measured using the Dual-Luciferase® Reporter Assay System (Promega, Madison, WI, USA) according to the manufacturer’s instructions. Firefly luciferase activity was normalized to Renilla luciferase activity.
RNA fluorescence in situ hybridization (FISH)
miR-1324 and GDF15 expression in EC specimens were determined using FISH. Specific probes were purchased from RiboBio (Guangzhou, China). After tissues were deparaffinized and dehydrated as described above, sections were hybridized with the specific probes in hybridization buffer overnight at 37 °C in a dark moist chamber. The next day, slides were washed and counterstained with DAPI. Images were captured using a fluorescence microscope (Leica Microsystems, Germany).
Animal experiments
All animal experiments were approved by the ethics committee of Zhongshan Hospital of Fudan University, Shanghai, China. This study was performed according to the guidelines of the Shanghai Medical Experimental Animal Care Commission. Tumor implantation was performed using KYSE150 cells, which included cells transfected with NC-siRNA+NC-OE, GDF15-siRNA+NC-OE, and GDF15-siRNA+SCAP-OE. 1 × 106 cells were injected into the tail veins of BALB/c nude mice (18–20 g, 4–6 weeks). Two weeks later, mice injected with GDF15-siRNA+ NC-OE and GDF15-siRNA+ SCAP-OE were randomly divided into two groups, resulting in five groups of n=5 for each group. Mice in the GDF15-siRNA+ NC-OE group were fed a modified cholesterol-rich diet containing 2% cholesterol (cat.no.TP 06106; Trophic Animal Feed High-tech Co., Ltd. Nantong, China), while the remaining groups were fed a control diet for 8 weeks. One group of GDF15-siRNA+ SCAP-OE mice were intraperitoneally injected with β-CD, while the other groups were administered a vehicle control twice a week. Two months later, mice were euthanized and the lungs harvested for H&E staining.
Statistical analysis
Data analysis was performed using the SPSS 24.0 software (SPSS, Inc.). Mean ± standard deviation was used to represent all values. One-way analysis of variance or student’s unpaired t-test was used to compare three or two groups, respectively. p<0.05 was considered statistically significant.