SARS-CoV-2 induces transcription of human endogenous retrovirus RNA followed by type W envelope protein expression in human lymphoid cells.

doi:10.21203/rs.3.rs-301236/v1

Download PDF

Research Article

SARS-CoV-2 induces transcription of human endogenous retrovirus RNA followed by type W envelope protein expression in human lymphoid cells.

https://doi.org/10.21203/rs.3.rs-301236/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Patients with COVID-19 may develop abnormal inflammatory response and lymphopenia, followed in some cases by delayed-onset syndromes, often long-lasting after resolution of the initial SARS-CoV-2 infection. As viral infections may activate human endogenous retroviral elements (HERV), we studied the effect of SARS-CoV-2 on HERV-W and HERV-K envelope (ENV) expression, known to be involved in immunological and neurological pathogenesis of human diseases. We demonstrate here that an initial exposure to SARS-CoV-2 virus activates early HERV-W and K transcription in peripheral blood mononuclear cell (PBMC) cultures from healthy donors. Within a week of primary PBMC culture, only HERV-W ENV protein expression was detected in lymphoid cells of some donors, although SARS-CoV-2 infection of PBMC was not observed. HERV activation was reproduced with UV-inactivated virus and with a recombinant spike protein. Interestingly, exposure to SARS-CoV-2 protein induced a significant production of interleukin 6 in PBMC, independently from detectable HERV expression. Altogether, these results show that SARS-CoV-2 viral protein could induce HERV-W ENV expression in lymphocytes from some individuals, underlying the importance to further address the implicated molecular pathways, to understand patients‘ genetic susceptibility associated to the activation of HERV-W and its possible relevance for targeting therapeutic intervention in COVID-19 associated syndromes.

Infectious Diseases

Virology

Immunology

COVID-19

SARS-CoV-2

spike trimer

lymphocytes

T-cell

Human Endogenous Retrovirus

HERV-W

HERV-K

transactivation

lymphopenia

cytokine

post-COVID

The present COVID-19 pandemic has raised many questions about the underlying biological mechanisms of the many symptoms or syndromes associated with SARS-CoV-2 infection^1-6. Most of them are debated, while others have been explained by, e.g., immune-mediated inflammation and/or activation of blood clotting pathways^7,8. However, such pathways may themselves be triggered by still unidentified factors linking coronavirus infection to a dysregulation of physiological signaling pathways.

Such an indirect pathological activation of receptors and their signaling pathways are known to take place when infectious agents have the potential to lift the epigenetic control and/or to directly activate endogenous retroviral elements present in the human genome^9,10. The resulting production of an endogenous protein of retroviral origin with pathogenic effects may generate clinical symptoms corresponding to the organ, tissue or cells, in which it is expressed and determined by the tropism of the triggering infectious agent^11-19. Abnormal expression of human endogenous retroviruses (HERV) may become self-sustained, thus creating lifelong chronic expression from host‘s genome copies in affected tissues²⁰, e.g., with cytokine-mediated feedback loops²¹ or possibly mediated by their envelope proteins²². This has been shown to be involved in brain lesions and in their expansion in patients with multiple sclerosis^20,23-25.

Abnormally expressed HERV envelope proteins revealed to display major immunopathogenic^26-32 and/or neuropathogenic^23,28-35 effects in vitro and in vivo, associated with pathognomonic features of human diseases. We therefore studied whether SARS-CoV-2 could activate HERV, considered as ‘dormant enemies within’³⁶, to evaluate their potential pathogenic contribution in COVID-19 associated syndromes. This question became critical after a recent study revealed the significant expression of HERV-W envelope protein (ENV) in lymphoid cells from COVID-19 patients, correlating with disease outcome and markers of lymphocyte exhaustion or senescence³⁷.

The present study shows that (i) HERV RNA and known pathogenic HERV-W envelope protein expression can be triggered in naive human peripheral blood mononuclear cells (PBMC) by SARS-CoV-2 virus itself or by its trimeric bioactive spike protein, with analogies to previously known examples of interactions between exogenous viruses and HERV¹², (ii) only about one-third of healthy blood donors have PBMC responding with HERV activation under SARS-CoV-2 exposure, however, (iii) all donors responded with similar interleukin 6 (IL-6) secretion kinetics after incubation with SARS-CoV-2 protein but without HERV activation in non-responders.

Cells

PBMC from healthy donors were obtained from the “Etablissement Français du Sang” (EFS) of Lyon (France). PBMC were isolated by Ficoll separation (Ficoll-Plaque PLUS) (GE Healthcare, 17-1440-02) from blood samples and cultured in RPMI-1640 medium (Gibco, 61870-010) completed with 5% of decomplemented Human AB serum (Sigma, H4522). Healthy donors signed a written Informed Consent Form, documented at the EFS, allowing the commercial use of their blood and blood components for medical research after definite anonymization.

Astroglioblastoma cell line U87-MG (U87) (U-87 MG ATCC®HTB-14™) and Vero E6 (ATCC® CRL-1586™) cell line were cultured in Dulbecco’s Modified Eagles Medium (DMEM, Gibco^TM), complemented with 10% heat inactivated Fetal Calf Serum (FCS), 1% glutamine and 1% penicillin-streptomycin.

U87 cells expressing both the human Angiotensin-converting enzyme 2 (ACE2)-receptor and the serine protease TMPRSS2 were generated using a second-generation lentiviral system. A lentivirus producer cell line (HEK293T cells: ATCC® CRL-3216™) was transiently transfected with a transfer plasmid encoding the transgene (ACE-2 or TMPRSS2), simultaneously with two other plasmids encoding either the vesicular stomatitis virus (VSV)-G envelope glycoprotein and a lentiviral packaging plasmid to generate the lentiviral particles³⁸. At 48 hours post transduction the cell supernatant was replaced again by fresh medium with Hygromycin at a concentration of 50µg/ml for antibiotic selection. The ACE-2 transduced U87 cells were observed daily and the supernatant replaced every 2-3 days by fresh Hygromycin-containing medium until the generation of the stable U87 ACE-2-expressing cell line. This new cell line was submitted to the same procedure using the TMPRSS-2 encoding lentivirus and then selected with Neomycin G418 at 250µg/ml to generate U87 cell line stably expressing both ACE-2 and TMPRSS2 proteins. The monitoring of ACE2/TMPRSS2 expression by RT-qPCR revealed that both genes were efficiently expressed.

SARS-CoV-2 serology of blood donors

SARS-CoV-2 serology of blood donors was determined on plasma diluted 10 times using Simple Western technology, an automated capillary-based size sorting and immunolabeling system (ProteinSimple^TM). The SARS-CoV-2 Multi-Antigen Serology Module (SA-001) was used with Wes device and all procedures were performed according to manufacturer’s protocol. Wes device was associated with Compass software for device settings and raw data recording (ProteinSimple/Biotechne).

Exposure to wt SARS-CoV-2, inactivated wt SARS-CoV-2 or recombinant active trimer Spike SARS-CoV-2

SARS-CoV-2 strain (BetaCoV/France/IDF0571/2020, GISAID Accession ID = EPI_ISL_411218) was cultured on Vero E6 cell line (ATCC®CRL1586™) for virus production. PBMC, U87 and Vero cells were infected with SARS-CoV-2 at a multiplicity of infection (MOI) 0.1. PBMC infection was performed in RPMI-1640 medium (Gibco, 61870-010) completed with 2% of heat inactivated Human AB serum (Sigma, H4522), U87 and Vero infections were performed in DMEM medium (DMEM, Gibco^TM) completed with 2% of heat inactivated FCS. 2 h later, the concentrations of AB-human serum or FCS were respectively increased to 5 and 10%. Recombinant non-stabilized trimer Spike SARS-CoV-2 (ACROBiosystems, USA; Ref. SPN-C52H8) treatment was performed at 0.5 and 2.5 µg/mL.

Inactivated SARS-CoV-2 virus used to treat U87 and ACE2+/TMPRSS2+U87 was obtained by Ultraviolet light irradiation at 254 nm during 30 minutes and inactivation was confirmed by viral titration.

Immunofluorescence

Cells in suspension were pelleted by centrifugation and deposited on 3 well epoxy microscope slides (Thermo Scientific, 30-12A-BLACK-CE24) while adherent cells were manipulated directly in 48 wells plates. Suspension and adherent cells received the same following steps. Cells were fixed in paraformaldehyde 4% during 15 minutes at RT. Cells were washed tree times in PBS 1X and permeabilized 15 min in 0.2% Tween20, PBS 1X. Saturation was performed using 2.5% horse serum, 0.2% Tween20, PBS 1 X, during 30 minutes at RT before incubation with a mix of primary antibodies during 1 hour or overnight: 3µg/mL of anti-HERV-W ENV (GeNeuro, GN_mAb_Env01, murine antibody) or 10 µg/mL anti-HERV-K ENV (GeNeuro, GN_mAb_Env-K01, murine antibody), together with either anti-N SARS-CoV-2 diluted 1/500 (SinoBiological, 40143-T62, rabbit antibody) or anti-S SARS-CoV-2 diluted 1/500 (SinoBiological, 40590-T62, rabbit antibody). Antibody solutions were prepared in the previously described saturation buffer. After three washes in PBS 1X, cells were incubated during 1 hour with secondary antibodies mix containing 1µg/mL goat anti-mouse Alexa Fluor 488 (ThermoFisher Scientific, A11029), 1µg/mL donkey anti-rabbit Alexa Fluor 647 (ThermoFisher Scientific, A31573) and DAPI 1/2000 (Sigma, D9542) diluted in the previously described saturation buffer. Finally, cells were washed three times in PBS 1X and mounted using the Fluoromount-G mounting medium (Southern Biotech, 0100-01). Pictures were acquired on NIKON Eclipse TS2R microscope and analyzed on ImageJ software.

Cytofluorometry

At 24 or 72 h post infection, cells were pelleted by centrifugation. PBMC were incubated with FcR Blocking Reagent according to manufacturer’s protocol (Miltenyi Biotec, 130-113-199) and stained with 1/10^eCD3-PE (BD Biosciences, 552127) whereas U87 and ACE2+/TMPRSS2+ U87 were stained with 10 µg/mL anti-S SARS-CoV-2 Alexa Fluor 594 (R&D Systems, FAB105403T). Following cell surface staining, cells were fixed and permeabilized using Cytofix/Cytoperm kit (BD Biosciences, 554714) according to manufacturer’s instructions. Then, PBMC were stained with 10 µg/mL of an anti-HERV-W ENV-FITC (GeNeuro, GN_mAb_Env01-FITC) or mouse IgG1 FITC-labeled isotype control (Miltenyi Biotec, 130-113-199). U87 and lentifected U87 cells were stained with 10 µg/mL of anti-HERV-W ENV (GeNeuro, GN_mAb_Env01, murine antibody) followed by incubation with 2 µg/mL of secondary antibody goat anti-mouse Alexa Fluor 488 (ThermoFisher Scientific, A11029). Stained cells were acquired on a BD LSR Fortessa, fluorochrome emissions from the pool of antibodies were compensated using OneComp Beads (Invitrogen, 01-1111-42) and data analyzed with FlowJo software (v.10).

Quantitative RT PCR (RT-qPCR)

At several time points after infection or recombinant Spike exposure, cells were harvested and total RNA extracted. 200 ng of DNase-treated RNA were reverse-transcribed into cDNA using iScript cDNA Synthesis Kit (Bio-Rad, 1708891) according to the manufacturer’s protocol. A control with no-RT was prepared in parallel, to confirm the absence of contaminating DNA in PCR experiments. An amount of 5 ng of initial RNA in RT reaction has been used to quantitatively evaluate the transcriptional levels of HERV-W ENV, HERV-K ENV, N SARS-CoV-2 (Ferren et al. preprint 2021. DOI: 10.21203/rs.3.rs-122126/v1) and ACE2 genes by RT-qPCR (primer sequences are shown in Table 1). The assays were performed in a StepOnePlus instrument (Applied Biosystems) using Platinum SYBR Green (Invitrogen, 11744-500). The housekeeping gene beta-2 microglobulin (B2M) was used to normalize the results in PBMC experiments whereas glyceraldehyde-3-phosphate deshydrogenase (GAPDH) was used in Vero cells experiments. Each experiment was completed with a melting curve analysis to confirm the specificity of amplification and the lack of any non-specific product and primer dimer. Quantification was performed using the threshold cycle (Ct) comparative method: the relative expression was calculated as follow: 2^-[^D^{Ct (sample)-}^D^{Ct (calibrator)]} = 2^-^DD^Ct, where DCt (sample) = [Ct (target gene) – Ct (housekeeping gene)] and the DCt (calibrator) was the mean of DCt of non infected/non treated cells.

Table 1. Primer sequences

	Primer sequence (5’ to 3’)
Gene	forward	reverse
HERV-W ENV	GTATGTCTGATGGGGGTGGAG	CTAGTCCTTTGTAGGGGCTAGAG
HERV-K ENV	CTGAGGCAATTGCAGGAGTT	GCTGTCTCTTCGGAGCTGTT
B2M	TTACTCACGTCATTCAGCAG	GATGGATGAAACCCAGACAC
GAPDH	CACCCACTCCTCCACCTTTGAC	GTCCACCACCCTGTTGCTGTAG
SARS-CoV-2 N	AAACATTCCCACCAACAG	CACTGCTCATGGATTGTT
ACE2	TCCATTGGTCTTCTGTCACCCG	AGACCATCCACCTCCACTTCTC

Quantification of IL-6 secretion

IL-6 secretion was assessed in PBMC culture supernatant 2, 15 and 24 h after recombinant Spike exposure, by ELISA using BD Opt EIA Set Human IL-6 (BD, 555 220) according to supplier‘s recommendations.

Cell viability assay

PBMC viability was analyzed using CellTiter-Glo 2.0 Assay kit (Promega, G9241) according to the manufacturer’s protocol. Viability percentage was calculated using the following equation:

% of viability = (RLU_experimental – RLU_background) / [Mean (RLU_control – RLU_background)] x 100

Background: wells containing medium without cells; Control: untreated cells at 24 h post treatment.

Exposure to SARS-CoV-2 virus triggers HERV-W and -K ENV mRNA early transcription from PBMC of heathy donors

We initially analyzed whether infectious SARS-CoV-2 could modulate the expression of HERV W and HERV-K genes in lymphocytes from healthy individuals. RT-qPCR was performed using specific primers for HERV-W and HERV-K envelope genes, as already validated in patients with HERV-associated diseases^33,39,40, using B2M mRNA as a suitable reporter gene for PBMC⁴¹. PBMC of 11 blood donors were cultured or not with infectious SARS-CoV-2 (MOI = 0.1) and RNA was collected at 2H post-inoculation (Figure 1). In PBMC from 3 (Donors # 28, 29 and 40) out of 11 (27%) donors, HERV-W RNA transcription was increased at 2H after exposure to wild type SARS-CoV-2 virus (MOI=0.1); a low response for HERV-W was seen with one donor (#27), as shown in Figure 1 and supplementary Table S1. The same donors also showed relative transcriptional activation of HERV-K ENV (Figure 1). For further kinetics analysis, RNA from PBMC of 4 representative donors with various RNA results at 2H, was collected at 2H, 19H and 24H and tested in parallel (Supplementary Figure S1) Interestingly, the transcriptional level of both HERV W and HERV-K RNA was decreased at 19H and 24H to a lower level than the baseline of cultures “not inoculated” (NI) with the infectious virus from the same donors at the same time points. A similar decrease of HERV-W and -K ENV transcription, when compared to NI control wells, was observed from the initial time point (2H) in PBMC from of the “non-responding” donors after exposure to SARS-CoV-2 virus (supplementary Figure S1 A, B).

RT-qPCR analysis of the kinetics of SARS-CoV-2 N-RNA only showed abundant RNA load from the inoculum with a significant decrease at 19h post-infection (inoculation), which confirmed the absence of viral replication in PBMC (supplementary Figure S1 C).

Exposure to SARS-CoV-2 triggers HERV-W envelope (ENV) production from PBMC of heathy donors

We next analyzed whether the HERV RNA expression is followed by HERV protein production. PBMC cultures of 8 new blood donors, inoculated or not with SARS-CoV-2 at 0.1 MOI, were collected at either 3 or 7 days post-exposure. Cells were stained with specific monoclonal antibodies raised against envelope proteins of HERV-W, HERV-K and against SARS-CoV-2 N protein, then analyzed by immunofluorescence (Figure 2). Cells were maintained for up to 7 days in culture.

All tested conditions are presented in parallel with an example from donor # 12: HERV-K ENV staining was not detected in the cells after exposure to SARS-CoV-2 (Figure 2D and Supplementary Figure S2 D’), despite specific HERV-K ENV RNA detection and even when HERV-W ENV protein was detected in the same cells (Figure 2B and Supplementary Figure S2 B’).

HERV ENV protein expression was donor-dependent. HERV-W ENV protein was detected in a variable proportion of PBMC from cultures inoculated with SARS-CoV-2, numerous in donor #7 (Figure 2 E’), less in #12 (Figure 2 B), or few in #9 (Figure 2 F’), whereas not detected in non-responders (Figure 2G’, donor #11). However, active production was seen in positive cells as shown with high magnification (Fig. 2 H-L). SARS-CoV-2 antigen was not detected in any of the conditions. In all immunofluorescence analyses, neither HERV-W ENV, nor HERV-K ENV protein expression was detected in control cultures without SARS-CoV-2 (Figure 2 A- C- E, F and G).

The same immunofluorescence conditions showed clear expression of SARS-CoV-2 N protein, in parallel with its spike protein, in positive control cells (Vero) used for productive replication (Supplementary Figure S3). The specificity of the anti HERV-W antibodies was also confirmed with the absence of staining in the same SARS-CoV-2-infected Vero cells, in parallel with negative RT-qPCR for HERV-W and HERV-K but with increased SARS-CoV2-N mRNA transcription (Supplementary Figure S3 A-D and E-G). Positive controls for anti-HERV antibodies sensitivity and specificity on cells transfected with expression plasmids for HERV-W and -K ENV (Supplementary Figure S4) and negative control staining with secondary antibodies (Supplementary Figure S5) were performed in parallel. the specificity of anti-HERV-W ENV antibody used here was also established in different conditions with a previous study (Charvet et al. 2021, Virol. Sin. doi: 10.1007/s12250-021-00372-0 in press). Finally, the SARS-CoV-2 serological status of donors was controlled (Supplementary, Figure S6).

Exposure to SARS-CoV-2 triggers HERV-W envelope production in T-cells of heathy individuals

HERV-W ENV protein expression having been observed in CD3⁺ T-lymphocytes of COVID-19 patients³⁷, we next analyzed whether SARS-CoV-2 could induce HERV-W ENV in T lymphocytes. We analyzed HERV-W ENV expression in PBMC cultures from three healthy donors, with or without exposure to SARS-CoV-2, using cytofluorometry analysis. As illustrated in Figure 3, CD3⁺T lymphocytes were identified with the gating strategy in non infected (NI) cultures, showing an increased detection when inoculated with SARS-CoV-2 at MOI=0.1. However, at 24H post-viral exposure, a CD3-low population originally shown to be characteristic of superantigen activity⁴² and tentatively associated to the spike protein of SARS-CoV-2⁴³ was observed (Figure 3B), whereas only few such cells were seen in NI cultures (Figure 3A). When cells were doubled-labeled with anti-HERV-W ENV specific antibody an important proportion of these CD3-low T-cells was positive for HERV-W ENV (Figure 3B CD3+ top panel), compared to NI cultures (Figure 3A CD3+ top panel). Fewer CD3-high were found to express HERV-W ENV after exposure to the virus at this time-point (Figure 3B, CD3⁺ bottom panel). The percentage of HERV-W ENV positive cells in each condition is represented in Figure 3E. A significant increase in CD3⁺ low/HERV-W+ lymphocytes exposed to SARS-CoV-2, compared to those from NI cultures was confirmed in at 72H post-inoculation (Figure 3F) and the same was observed versus all control cells from cultures without virus (Figure 3 E-F).

Human cell-line expressing ACE2/TMPRSS2 produces HERV-W ENV protein following SARS-CoV-2 infection

U87 astroglioblastoma cells were previously shown to respond to HHV-6A with an activation of HERV-W expression leading to the production and secretion of bioactive ENV protein in cell-free culture medium causing TLR4 activation¹². However, these cells cannot be infected by SARS-CoV-2 and, expression of HERV-W and K was not observed after exposure to this coronavirus (Figure 4 A-F and M-P). To obtain a cell line permissive to SARS-CoV-2 infection, U87 cells were transduced with ACE2 and TMPRSS2 expressing lentivector (supplementary Figure S8). U87-ACE2⁺/TMPRSS2⁺ cells did not spontaneously express HERV-K or HERV-W (Figure 4 G, I, K and Q, S). However, after inoculation with infectious SARS-CoV-2, N and S viral proteins, as well as HERV-W ENV protein were detected in the same cells. This showed SARS-CoV-2 infection and replication, in parallel with HERV-W activation and ENV protein production (Figure 4 H, J, L and J’-L’). Interestingly, no HERV-K ENV protein was detected in any cell from these cultures (Figure 4 R,T and T,T’).

Cytofluorometry analysis confirmed the co-expression of coronavirus S-protein and HERV-W ENV showing HERV-W activation and both protein production in the same cells (Figure 5). Nevertheless, only a minor percentage of cells co-expressed HERV-W ENV and SARS-CoV-2 S proteins in the present conditions. The total number of HERV-W ENV positive and/or of SARS-CoV-2 spike positive cells was significantly elevated compared to mock-infected cells (Figure 5 A; HERV-W⁺, SARS-CoV-2 S⁺, and positive for both: p<0.0001). Not all SARS-CoV-2 infected cells expressed HERV-W ENV and vice-versa (Cf. examples in Figure 5 C-D), thereby indicating that some cells could express HERV-W ENV without being infected by SARS-CoV-2 and/or that some infected cells had not induced HERV-W ENV expression at the moment of analysis. Exposure of ACE2⁺/TMPRSS2⁺ U87 cells to inactivated SARS-CoV-2 virus also induced HERV activation with significant HERV-W ENV production (Figure 5 A, E-F; HERV-W+: p<0.0001) similar to those observed with the infectious virus but, as expected, without infection nor detection of N-protein in the same cells (data not shown).

Exposure to SARS-CoV-2 virus recombinant trimeric spike protein triggers HERV-W ENV protein production in PBMC of heathy individuals.

We previously observed a rapid response to SARS-CoV-2 virus with an early peak of RNA followed by HERV-W ENV protein expression in cells maintained in culture (≤5 days) (Figures 1-3). This immediate RNA response in the absence of detectable infection of PBMC by SARS-CoV-2 prompted us to investigate a possible direct stimulation by SARS-CoV-2 proteins and, most of all, by its surface spike protein. The same question was also raised following the activation of HERV-W ENV expression in U87-ACE2⁺/TMPRSS2⁺ cells by the UV-inactivated coronavirus, in the absence of any replication and without S-protein detection by double labeling of cells, using cytofluorometry.

To further address the activation of HERV-W in the absence of infection, a recombinant trimeric spike protein was added into the culture medium of PBMC from 4 new healthy donors, in parallel to mock-control, corresponding to the buffer only. Cell viability was measured and did not vary significantly within the culture period of experiments (≤5days; Cf. Supplementary Material Figure S7).

PBMC RNA from 4 new donors were collected at 2H, 15H and 24H post-inoculation and analyzed by RT-qPCR for HERV-W and HERV-K envelope gene expression. Donor #31 showed transcriptional increase for both HERV-W and HERV-K ENV at 2H post-inoculation, donor #30 showed a peak of HERV-W and HERV-K ENV RNA at 15h, while both RNA levels remained rather stable or decreased in donors #32 and #33 (Figure 6 A-B). RNA levels for both HERV-W and HERV-K also decreased below the baseline of identical non-exposed cells after having shown a peak of transcription. This was again seen in the absence of significant cell death that would anyhow have been compensated by the differential quantification with B2M RNA. Of interest, donor #30 was the only one tested positive for anti-SARS CoV-2 antibodies (supplementary Figure S6), which did not prevent HERV transcriptional activation by this recombinant spike trimer but coincides with slightly delayed peak of HERV RNA.

IL-6 secretion was significantly increased at 15H and 24H PE (p<0.01 and p<0.05) in PBMC from all donors, including non-responding donors (without HERV activation) after exposure to SARS-CoV-2 S antigen (Figure 6 C).. HERV activation independently from IL-6 production was confirmed by immunofluorescence analysis at 72H, which showed HERV-W ENV positive lymphoid cells in cultured PBMC of 2 out the four donors inoculated with spike trimers (0.5 µg/mL) but not in mock-control cultures (Figure 6 D).

Of note, as seen with the infectious virus, few HERV-W ENV positive cells were detected but an increase in HERV RNA was seen despite this low proportion of activated cells within the cultures. Also, even in the presence of IL-6 within the culture media of all cultures (Figure 6 C), HERV-W ENV was expressed in few cells only within PBMC cultures from responders, but not detected in PBMC from non-responders at both RNA and protein levels.

Unlike physiological effectors, the transcription of which is normally upregulated to produce active molecules when needed, HERV activation by environmental factors does not reflect a physiological response and seldom results in protein expression⁴⁴. Exceptions are known with a few “domesticated” HERV genes, known to encode physiological proteins⁴⁵ or at the transcriptional level only, with the high number of non-coding RNA types involved in major post-genomic regulations⁴⁶. Thus, though representing about 8% of the human genome (whereas physiological genes represent much less), HERV are mostly defective and non-coding remnants of ancestral integrations of retroviral genomes in the germ line of individuals infected by exogenous retroviruses. Non-physiological HERV envelope protein expression has been shown to be detrimental in certain human diseases and cannot be considered as just another response to environmental triggers like, e.g., an immune response with cytokines release, though a parallel modulation mediated by certain HERV RNA is conceivable. The expression of HERV-K or HERV-W envelope proteins may have trophic roles in the placenta⁴⁵ or in stem cells⁴⁷, but envelope proteins from the same HERV families were rather shown to be involved in disease pathogenesis when expressed in adult cells^34,39.

This study shows that SARS-CoV-2 is able to trigger both HERV-W and HERV-K RNA transcription, while only HERV-W ENV protein was detected during these short-term primary cultures of non-stimulated PBMC from about 30% of healthy donors. However, a quite potent expression is made consistent from the observed ENV-protein immunofluorescent labeling in producing cells, which lasted for several days after exposure to SASR-CoV-2, and from the detectable HERV-W ENV RNA increase above the baseline, though expressed in few cells only. but.

Most importantly, after addition of SARS-CoV-2 spike protein trimer in PBMC cultures, the dosage of IL-6 showed that its secretion occurred in the supernatants from all donors, either responding or non-responding with HERV activation. The fact that this IL-6 production was induced by SARS-CoV-2 in the absence of detectable HERV RNA or protein expression provides a supplementary evidence that the presently observed HERV activation is not induced by cytokines, or by inflammation due to viral infection, but rather by SARS-CoV-2 spike protein itself.

Cytofluorometry analysis from these PBMC cultures also confirmed that HERV-W ENV protein expression was effectively induced in T-lymphocytes. A noticeable sub-group of CD3-low T-lymphocytes appeared in which HERV-W ENV protein was predominantly expressed, whereas it remained minimal and HERV-W negative in control cultures not exposed to the virus. These observations may corroborate previous works describing superantigen motifs of SARS-CoV-2 spike protein⁴³, and may involve cellular mechanisms associated to lymphopenia and hyperinflammation already characterized for other emerging viruses (e.g., Ebola or Lassa)^48,49. However, because HERV-W ENV was also shown to display superantigen-like effect²⁸, the origin of this effect on T-lymphocytes or potentially combined effects are questioned. Indeed, this work now calls for further analyses of possible markers of exhaustion and for studying the fate of these cells in kinetics analyses with, e.g., markers of apoptosis versus markers of early activation. The present in vitro observation is consistent with the co-stained HERV-W ENV positive CD3 lymphocytes shown to express either exhaustion or terminal differentiation markers in leukocytes from COVID-19 patients with severe clinical evolution³⁷. Thus, despite an expected parallel stimulation of T-cell antiviral reactivity, the present experimental results consistently raise the question of a possible role of this HERV protein expression in the induction of anergy or in the depletion of lymphocytes. The frequent lymphopenia in COVID-19 patients corroborates a defect of adaptive immunity and an imbalance with innate immune reactivity, compared to usual viral infections⁵⁰. This question may now be addressed under the new angle of HERV expression in lymphocytes, in parallel with a mechanism of induction in T-lymphocytes that remains to be characterized. Moreover, since HERV-W ENV (previously named MSRV-ENV), is already known to be a potent TLR4 agonist and itself induces inflammation via TLR4 signaling pathway^30,51, its superimposed or synergistic role in the hyperactivation of innate immunity should also be considered in parallel with a potential contribution to the impairment of adaptive immunity as seen in COVID-19.

However, the presently observed HERV activation occurs without signs of infection of lymphocytes or monocytes by SARS-CoV-2. Furthermore, UV-inactivated virus and a recombinant trimer of its spike protein appeared sufficient to reproduce similar HERV-W and -K ENV RNA stimulation as well as HERV-W ENV protein production in lymphoid cells. This type of HERV activation mediated by an interaction between a triggering virus and a specific receptor on certain cells has already been described for HHV-6A and U87 cell-line¹². Thus, the question of another cellular receptor bound by SARS-CoV-2 spike trimers that would trigger a signaling pathway activating HERV-W ENV protein production in T-cells is raised and should be addressed in a comprehensive study. Considering the present results, an unstable variable conformation of this trimeric spike antigen and/or an induction of a receptor in few cells only, would then explain the low proportion of HERV expressing cells in PBMC cultures of responding donors in the present in vitro conditions.

SARS-CoV-2 did not infect normal U87 cells and, unlike HHV-6A, did not induce HERV-W ENV expression in normal U87 cells either. When lentifected with ACE2/TMPRSS2 receptor, U87 cells became susceptible to SARS-CoV-2 virus infection and co-expressed spike and N proteins. This human cellular model showed that the productive coronavirus infection also induced HERV-W ENV expression but, here again, HERV-K ENV protein and RNA were not detected. This provides an additional control in-between HERV-W activation without SARS-CoV-2 infection in human lymphoid cells and SARS-CoV-2 infection and replication without HERV-W expression in simian Vero cells.

SARS-CoV-2 virus, unlike HHV-6A, did not activate HERV-W expression in U87 cells naturally devoid of ACE2/TMPRSS2 receptors, but did so after ACE2/TMPRSS2 receptors expression in transduced U87 cell membrane. Because SARS-CoV-2 induced HERV-W expression in human lymphoid cells that neither express ACE2 (confirmed with specific RT-qPCR) nor TMPRSS2 receptor and were not infected, these cannot be expected to be the receptors through which SARS-CoV-2 would trigger a signaling pathway resulting in HERV activation. This activation was also obtained with a recombinant trimer tested for an effective binding to ACE2 receptors, but not stabilized in a specific conformation. Pre- and post-fusion variable conformations of this spike protein may confer divergent properties⁵², whereas vaccine preparations are likely to stabilize its structure^53-55 with a good safety profile^54,56. Here again, further studies are needed to define sequence-related and protein conformational properties involved in a protein-receptor interaction leading to HERV activation in susceptible individuals. This may further provide relevant information for viral constructs or preparation envisaged for SARS-CoV-2 vaccines.

At the transcriptional level, within the present short-term PBMC cultures after a single exposure to SARS-CoV-2 or to its active protein, a single peak of HERV RNA is seen when occurring in responding donors. The absence of recurrent stimulation and/or of renewed PBMC comprising susceptible cell-type(s) may explain this single peak nonetheless followed by active HERV-W protein synthesis. Thus, an increase in the number and percentage of lymphoid cells with HERV-W activation strongly expressing the envelope protein under persisting SARS-CoV-2 virion release would be consistent with observations from COVID-19 patients³⁷.

A feed-back inhibitory loop triggered by abnormal HERV activation is probably limiting the yield of HERV expression in targeted PBMC in the present cultures. When HERV activation was not seen in PBMC cultures from 7 out of 11 healthy blood donors exposed to the virus and from 1 out of 4 exposed to the spike trimers, this coincided, with constantly decreased RNA levels in PBMC exposed to the virus or to the recombinant spike trimer, compared to non-exposed PBMC. Thus, an inter-individual variability in the rapidity and potency of expression of HERV inhibitors, with a genetic or epigenetic origin, may offer an avenue of research to understand why some individuals do not activate this HERV expression in PBMC. Symptoms potentially superimposed or synergized by the pathogenic effects of HERV envelope protein expression may consequently occur in certain individuals only. This should also be investigated in COVID-19 patients for it may provide possible prognostic information on individuals who may present an enhanced reaction to the infection with severe evolution or long-lasting post-infectious syndromes.

Finally, since the HERV-W ENV protein was shown to have multifaceted pathogenic effects with a common TLR4 activation⁵¹ and appeared consistent with pathognomonic features of diseases in the lifelong course of which it was detected within tissue lesions^{23-25,28-30,32,35,39,40}, its induction by SARS-CoV-2 in lymphocytes is not expected to be neutral. Observation of the induction of HERV-W⁺ CD3-low lymphocytes and the significant detection of exhaustion markers on HERV-W⁺ T-cells from patients with COVID-19, correlating with parameters of severity in disease outcome³⁷, raise the question of a possible contribution of this HERV expression in the frequently observed lymphopenia. Thus, beyond a possible lymphotoxicity, previous studies also suggest a potential impact on endothelial cells³² and on Schwann cells⁴⁰, as well as on microglia and remyelinating oligodendrocyte precursor cells^23,25, which would be relevant with known vascular and neurological syndromes associated with COVID-19 during the acute infection or in the so-called post-COVID period^3,5-7,31. This does not exclude promoting autoimmunity as already shown in a humanized mouse model²⁴, when autoimmune features are often observed in COVID-19 or post-COVID patients^57-60. Altogether, these data call for evaluating HERV-W ENV as a potential target for therapeutic intervention in COVID-19 associated syndromes.

In conclusion, this study aimed at elucidating the possible origin of HERV-W ENV expression in lymphocytes of COVID-19 patients and revealed that SARS-CoV-2 via its spike protein may trigger HERV expression in human PBMC and, in particular, in T-lymphocytes, which could play a role in the immunopathogenesis of COVID-19.

Acknowledgments

We acknowledge World Reference Center for Emerging Viruses and Arboviruses (WRCEVA) and UTMB investigator, Dr. Pei Yong Shi for kindly providing recombinant NeonGreen virus based on 2019-nCoV/USA_WA1/2020 isolate and VirPath from the CIRI, Centre International de Recherche en Infectiologie, Lyon, France (B. Lina, A. Pizzorno, O. Terrier and M. Rosa-Calatrava), for providing us with the BetaCoV/France/IDF0571/2020 virus and C. Goujon (CNRS, Montpellier, France) and Olivier Moncorgé (IRIM, CNRS, Montpellier) for providing the plasmids used for the lentifection. This work was supported by ANR-CoronaPepStop (ANR-20-COVI-000) and Fondation de France to BH and Agence Nationale de la Recherche (ANR, France)-COVERI to HP.

HP, BC, JB, JP and NQ receive compensation from Geneuro-Innovation for their work. MM, SM, MI, DD, CM and BH declare that they have no conflict of interest.

1 Pence, B. D. Severe COVID-19 and aging: are monocytes the key? Geroscience 42, 1051-1061, doi:10.1007/s11357-020-00213-0 (2020).

2 Hu, F. et al. A compromised specific humoral immune response against the SARS-CoV-2 receptor-binding domain is related to viral persistence and periodic shedding in the gastrointestinal tract. Cell Mol Immunol 17, 1119-1125, doi:10.1038/s41423-020-00550-2 (2020).

3 Ellul, M. A. et al. Neurological associations of COVID-19. Lancet Neurol 19, 767-783, doi:10.1016/S1474-4422(20)30221-0 (2020).

4 Hue, S. et al. Uncontrolled Innate and Impaired Adaptive Immune Responses in Patients with COVID-19 Acute Respiratory Distress Syndrome. Am J Respir Crit Care Med 202, 1509-1519, doi:10.1164/rccm.202005-1885OC (2020).

5 Nath, A. & Smith, B. Neurological issues during COVID-19: An Overview. Neurosci Lett, 135533, doi:10.1016/j.neulet.2020.135533 (2020).

6 Gupta, A. et al. Extrapulmonary manifestations of COVID-19. Nat Med 26, 1017-1032, doi:10.1038/s41591-020-0968-3 (2020).

7 Martin-Rojas, R. M. et al. COVID-19 coagulopathy: An in-depth analysis of the coagulation system. Eur J Haematol 105, 741-750, doi:10.1111/ejh.13501 (2020).

8 Cao, X. COVID-19: immunopathology and its implications for therapy. Nat Rev Immunol 20, 269-270, doi:10.1038/s41577-020-0308-3 (2020).

9 Medina, J. et al. [Endogenous retroviral sequences in the human genome can play a physiological or pathological role]. Med Sci (Paris) 33, 397-403, doi:10.1051/medsci/20173304009 (2017).

10 Qin, C. et al. Elevation of Ser9 phosphorylation of GSK3beta is required for HERV-W env-mediated BDNF signaling in human U251 cells. Neurosci Lett 627, 84-91, doi:10.1016/j.neulet.2016.05.036 (2016).

11 Dai, L. et al. Transactivation of human endogenous retrovirus K (HERV-K) by KSHV promotes Kaposi's sarcoma development. Oncogene 37, 4534-4545, doi:10.1038/s41388-018-0282-4 (2018).

12 Charvet, B. et al. Induction of Proinflammatory Multiple Sclerosis-Associated Retrovirus Envelope Protein by Human Herpesvirus-6A and CD46 Receptor Engagement. Front Immunol 9, 2803, doi:10.3389/fimmu.2018.02803 (2018).

13 Vincendeau, M. et al. Modulation of human endogenous retrovirus (HERV) transcription during persistent and de novo HIV-1 infection. Retrovirology 12, 27, doi:10.1186/s12977-015-0156-6 (2015).

14 Bergallo, M. et al. CMV induces HERV-K and HERV-W expression in kidney transplant recipients. J Clin Virol 68, 28-31, doi:10.1016/j.jcv.2015.04.018 (2015).

15 Li, F. et al. Transcriptional derepression of the ERVWE1 locus following influenza A virus infection. J Virol 88, 4328-4337, doi:10.1128/JVI.03628-13 (2014).

16 Mameli, G. et al. Expression and activation by Epstein Barr virus of human endogenous retroviruses-W in blood cells and astrocytes: inference for multiple sclerosis. PLoS One 7, e44991, doi:10.1371/journal.pone.0044991 (2012).

17 Toufaily, C., Landry, S., Leib-Mosch, C., Rassart, E. & Barbeau, B. Activation of LTRs from different human endogenous retrovirus (HERV) families by the HTLV-1 tax protein and T-cell activators. Viruses 3, 2146-2159, doi:10.3390/v3112146 (2011).

18 Nellaker, C. et al. Transactivation of elements in the human endogenous retrovirus W family by viral infection. Retrovirology 3, 44 (2006).

19 Perron, H. et al. Herpes simplex virus ICP0 and ICP4 immediate early proteins strongly enhance expression of a retrovirus harboured by a leptomeningeal cell line from a patient with multiple sclerosis. J Gen Virol 74 ( Pt 1), 65-72, doi:10.1099/0022-1317-74-1-65 (1993).

20 van Horssen, J., van der Pol, S., Nijland, P., Amor, S. & Perron, H. Human endogenous retrovirus W in brain lesions: Rationale for targeted therapy in multiple sclerosis. Mult Scler Relat Disord 8, 11-18, doi:10.1016/j.msard.2016.04.006 (2016).

21 Serra, C. et al. In vitro modulation of the multiple sclerosis (MS)-associated retrovirus by cytokines: implications for MS pathogenesis. J Neurovirol 9, 637-643, doi:FEXW4YLT6UVQXD01 [pii] (2003).

22 Derfuss, T. et al. A phase IIa randomised clinical study of GNbAC1, a humanised monoclonal antibody against the envelope protein of multiple sclerosis-associated endogenous retrovirus in multiple sclerosis patients. Mult Scler 21, 885-893, doi:10.1177/1352458514554052 (2015).

23 Kremer, D. et al. pHERV-W envelope protein fuels microglial cell-dependent damage of myelinated axons in multiple sclerosis. Proc Natl Acad Sci U S A 116, 15216-15225, doi:10.1073/pnas.1901283116 (2019).

24 Perron, H. et al. Human endogenous retrovirus protein activates innate immunity and promotes experimental allergic encephalomyelitis in mice. PLoS One 8, e80128, doi:10.1371/journal.pone.0080128 (2013).

25 Kremer, D. et al. Human endogenous retrovirus type W envelope protein inhibits oligodendroglial precursor cell differentiation. Ann Neurol 74, 721-732, doi:10.1002/ana.23970 (2013).

26 Meylan, F. et al. Negative thymocyte selection to HERV-K18 superantigens in humans. Blood 105, 4377-4382, doi:10.1182/blood-2004-07-2596 (2005).

27 Stauffer, Y. et al. Interferon-alpha-induced endogenous superantigen. a model linking environment and autoimmunity. Immunity 15, 591-601 (2001).

28 Perron, H. et al. Multiple sclerosis retrovirus particles and recombinant envelope trigger an abnormal immune response in vitro, by inducing polyclonal Vbeta16 T-lymphocyte activation. Virology 287, 321-332, doi:10.1006/viro.2001.1045 S0042-6822(01)91045-1 [pii] (2001).

29 Firouzi, R. et al. Multiple sclerosis-associated retrovirus particles cause T lymphocyte-dependent death with brain hemorrhage in humanized SCID mice model. J Neurovirol 9, 79-93, doi:10.1080/13550280390173328 (2003).

30 Rolland, A. et al. The envelope protein of a human endogenous retrovirus-W family activates innate immunity through CD14/TLR4 and promotes Th1-like responses. J Immunol 176, 7636-7644, doi:176/12/7636 [pii] (2006).

31 Saresella, M. et al. Multiple sclerosis-associated retroviral agent (MSRV)-stimulated cytokine production in patients with relapsing-remitting multiple sclerosis. Mult Scler 15, 443-447, doi:1352458508100840 [pii] 10.1177/1352458508100840 (2009).

32 Duperray, A. et al. Inflammatory response of endothelial cells to a human endogenous retrovirus associated with multiple sclerosis is mediated by TLR4. Int Immunol 27, 545-553, doi:10.1093/intimm/dxv025 (2015).

33 Li, W. et al. Human endogenous retrovirus-K contributes to motor neuron disease. Sci Transl Med 7, 307ra153, doi:10.1126/scitranslmed.aac8201 (2015).

34 Kury, P. et al. Human Endogenous Retroviruses in Neurological Diseases. Trends Mol Med 24, 379-394, doi:10.1016/j.molmed.2018.02.007 (2018).

35 Johansson, E. M. et al. Human endogenous retroviral protein triggers deficit in glutamate synapse maturation and behaviors associated with psychosis. Sci Adv 6, eabc0708, doi:10.1126/sciadv.abc0708 (2020).

36 Engel, M. E. & Hiebert, S. W. The enemy within: dormant retroviruses awaken. Nat Med 16, 517-518, doi:nm0510-517 [pii] 10.1038/nm0510-517 (2010).

37 Balestrieri, E. et al. First evidence of pathogenic HERV-W envelope expression in T lymphocytes in association with the respiratory outcome of COVID-19 patients. EBioMedicine in revision, doi:https://papers.ssrn.com/sol3/papers.cfm?abstract_id=3763768) (2021).

38 Rebendenne, A. et al. SARS-CoV-2 triggers an MDA-5-dependent interferon response which is unable to control replication in lung epithelial cells. J Virol, doi:10.1128/JVI.02415-20 (2021).

39 Levet, S. et al. An ancestral retroviral protein identified as a therapeutic target in type-1 diabetes. JCI Insight 2, doi:10.1172/jci.insight.94387 (2017).

40 Faucard, R. et al. Human Endogenous Retrovirus and Neuroinflammation in Chronic Inflammatory Demyelinating Polyradiculoneuropathy. EBioMedicine 6, 190-198, doi:10.1016/j.ebiom.2016.03.001 (2016).

41 Milhem, C., Ingelaere, C., Mordon, S., Moralès, O. & Delhem, N. Beta-2 Microglobulin And Ubiquitin C Identified as Two Robust Housekeeping Genes for RNA Expression Normalization in Real Time PCR on Human Leukocytes and Regulatory T Cells. Biomed J Sci & Tech Res, 24425-24430, doi:10.26717/BJSTR.2020.31.005146 (2020).

42 Niedergang, F. et al. The Staphylococcus aureus enterotoxin B superantigen induces specific T cell receptor down-regulation by increasing its internalization. J Biol Chem 270, 12839-12845, doi:10.1074/jbc.270.21.12839 (1995).

43 Cheng, M. H. et al. Superantigenic character of an insert unique to SARS-CoV-2 spike supported by skewed TCR repertoire in patients with hyperinflammation. Proc Natl Acad Sci U S A 117, 25254-25262, doi:10.1073/pnas.2010722117 (2020).

44 Perron, H. & Lang, A. The human endogenous retrovirus link between genes and environment in multiple sclerosis and in multifactorial diseases associating neuroinflammation. Clin Rev Allergy Immunol 39, 51-61, doi:10.1007/s12016-009-8170-x (2010).

45 Mallet, F. et al. The endogenous retroviral locus ERVWE1 is a bona fide gene involved in hominoid placental physiology. Proc Natl Acad Sci U S A 101, 1731-1736 (2004).

46 Wilson, K. D. et al. Endogenous Retrovirus-Derived lncRNA BANCR Promotes Cardiomyocyte Migration in Humans and Non-human Primates. Dev Cell 54, 694-709 e699, doi:10.1016/j.devcel.2020.07.006 (2020).

47 Wang, T. et al. Regulation of stem cell function and neuronal differentiation by HERV-K via mTOR pathway. Proc Natl Acad Sci U S A 117, 17842-17853, doi:10.1073/pnas.2002427117 (2020).

48 Younan, P. et al. Ebola Virus Binding to Tim-1 on T Lymphocytes Induces a Cytokine Storm. mBio 8, doi:10.1128/mBio.00845-17 (2017).

49 Baillet, N. et al. Systemic viral spreading and defective host responses are associated with fatal Lassa fever in macaques. Commun Biol 4, 27, doi:10.1038/s42003-020-01543-7 (2021).

50 Janssen, N. A. F. et al. Dysregulated innate and adaptive immune responses discriminate disease severity in COVID-19. J Infect Dis, doi:10.1093/infdis/jiab065 (2021).

51 Madeira, A. et al. MSRV envelope protein is a potent, endogenous and pathogenic agonist of human toll-like receptor 4: Relevance of GNbAC1 in multiple sclerosis treatment. J Neuroimmunol 291, 29-38, doi:10.1016/j.jneuroim.2015.12.006 (2016).

52 Rui, L., Haonan, L. & Wanyi, C. Silico analysis of interaction between full-length SARS-CoV2 S protein with human Ace2 receptor: Modelling, docking, MD simulation. Biophys Chem 267, 106472, doi:10.1016/j.bpc.2020.106472 (2020).

53 Xia, X. Domains and Functions of Spike Protein in Sars-Cov-2 in the Context of Vaccine Design. Viruses 13, doi:10.3390/v13010109 (2021).

54 Walsh, E. E. et al. Safety and Immunogenicity of Two RNA-Based Covid-19 Vaccine Candidates. N Engl J Med 383, 2439-2450, doi:10.1056/NEJMoa2027906 (2020).

55 Juraszek, J. et al. Stabilizing the closed SARS-CoV-2 spike trimer. Nat Commun 12, 244, doi:10.1038/s41467-020-20321-x (2021).

56 Xia, S. et al. Safety and immunogenicity of an inactivated SARS-CoV-2 vaccine, BBIBP-CorV: a randomised, double-blind, placebo-controlled, phase 1/2 trial. Lancet Infect Dis 21, 39-51, doi:10.1016/S1473-3099(20)30831-8 (2021).

57 Zhou, Y. et al. Clinical and Autoimmune Characteristics of Severe and Critical Cases of COVID-19. Clin Transl Sci 13, 1077-1086, doi:10.1111/cts.12805 (2020).

58 Zhou, S., Jones-Lopez, E. C., Soneji, D. J., Azevedo, C. J. & Patel, V. R. Myelin Oligodendrocyte Glycoprotein Antibody-Associated Optic Neuritis and Myelitis in COVID-19. J Neuroophthalmol 40, 398-402, doi:10.1097/WNO.0000000000001049 (2020).

59 Gao, Z. W., Zhang, H. Z., Liu, C. & Dong, K. Autoantibodies in COVID-19: frequency and function. Autoimmun Rev, 102754, doi:10.1016/j.autrev.2021.102754 (2021).

60 Acosta-Ampudia, Y. et al. COVID-19 convalescent plasma composition and immunological effects in severe patients. J Autoimmun 118, 102598, doi:10.1016/j.jaut.2021.102598 (2021).

FigureS1.tif
Figure S1: Kinetics of HERV-W ENV, HERV-K ENV and SARS-CoV-2 N RNA detection in PBMC from healthy blood donors exposed to SARS-CoV-2. The mRNA levels of (A) HERV-W ENV and (B) HERV-K ENV of PBMCs cultures from 4 healthy blood donors, exposed (plain histograms) or not (hatched histograms) to infectious SARS-CoV-2 (MOI:0.1), were analyzed by RT-qPCR. Results are presented as RT-qPCR fold change versus the corresponding non infected condition. NI: Control culture Not Inoculated with SARS-CoV-2 virus; pi: post-inoculation (C) The quantity of N-SARS-CoV-2 mRNA was monitored 2, 19 and 24 hours after SARS-CoV-2 infection (black histograms). These 2-ΔΔCt results obtained on cultures of PMBCs from 4 different healthy blood donors (donors # 26 to 29) were normalized with the corresponding non infected condition (hatched histograms). The quantity of SARS-CoV-2 N mRNA corresponds to the initial input of virus and did not increase with time but significantly decreased, thereby indicating the absence of productive SARS-CoV-2 replication in PBMCs cultures.
FigureS2.tif
Figure S2: Immunodetection of HERV-W ENV in primary PBMC from healthy Donor #12 following the exposure to SARS-CoV-2: complement to Figure 2.
PBMCs from healthy blood donor #12 were inoculated (B, D) or not (A, C) with SARS-CoV-2 virus (MOI: 0.1). GN_mAb_Env01 (A-B’, red frame) or GN_mAb_Env-K01 (C-D’, blue frame) antibodies were respectively used to detect HERV-W ENV or HERV-K ENV (green labelling). Blue (A-D) and green (A’-D’) channels are separately presented to appreciate the background level.
FigureS3.tif
Figure S3: anti-N- and anti-SARS-CoV-2-S antibodies validation and RT-qPCR controls using the simian Vero cells permissive for infection with SARS-CoV-2 and its replication. SARS-CoV-2 was cultured on Vero cells for viral stock production and represent a good model for anti-SARS-CoV-2 antibodies validation. Non infected Vero cells (A, C) were used as negative controls for immunostainings while SARS-CoV-2 infected Vero cells (B, D) were used as positive controls for anti-N- and anti-S-SARS-CoV-2 immunodetection (respectively B and D, red labelling). The efficiency of viral replication was monitored between 2H post-infection (pi) and 24H pi by RT-qPCR using N-SARS-CoV-2 primers (G). Simian Vero cells (African Green Monkey) showed no expression of HERV-W ENV and HERV-K ENV mRNA at 2H pi and 24H pi (respectively E and F) nor of HERV-W ENV protein (A-D, green labelling). DAPI was used to stained nuclei (A-D, blue staining). RT-qPCR results were presented as change fold versus the corresponding non infected condition (NI).
FigureS4.tif
Figure S4: Specificity of anti-HERV-W ENV and anti-HERV-K ENV antibodies. HEK293T cells were transfected with plasmids encoding for GFP, HERV-W ENV, ERVWE1 (syncytine-1) or HERV-K ENV. GN_mAb_Env01 (anti-HERV-W ENV) and GN_mAb_EnvK01 (anti-HERV-K ENV) do not present any staining on GFP expressing cells (A, E, red staining). GFP transfected cells allowed to determine the transfection efficacy, evaluated around 80%. GN_mAb_Env01 detects HERV-W ENV on transfected cells (B, green staining) but did not detect the homologous Syncytine-1, forming syncytia in transfected cells cultures (C, syncytia were surrounded with dotted lines). Anti-HERV-K ENV was also very efficient to detect its target antigen in HERV-K ENV transfected cells culture (D). Background of secondary antibodies was assessed in absence of primary antibodies (F, G). DAPI was used to stained nuclei (A-G, blue staining).
FigureS5.tif
Figure S5: Negative controls in immunofluorescence analyses (IF) performed on PBMCs and Vero cells. In order to evaluate the background level generated by the secondary antibodies, negative controls in the absence of primary antibodies controls were made with PBMC cultures from 3 healthy donors (donors # 7-9) , exposed to infectious SARS-CoV-2 MOI:0.1 since 72 hours (D-F) or not (A-C). IF controls without primary antibodies are also presented for Vero cells infected with SARS-CoV-2 MOI:0.1 since 24 h (G). DAPI was used to stained nuclei (A-G, blue staining).
FigureS6.tif
Figure S6: SARS-CoV-2 serology of healthy donors used in this study. In order to determine if the healthy donors used in this study have previously been infected by the SARS-CoV-2 virus, a systematic serology was performed on plasma harvested during PBMCs isolation. This serology was performed using the SARS-CoV-2 multi-antigens serology detection module for Simple Western instruments produced by ProteinSimple® (here Wes device, ProteinSimple®). Electrophoregrams and digital western blot representation of a negative (blue panel) and positive (red panel) samples were presented (A). The table of the serology of all donors used in this study was presented (B). Of note, serology analysis was not available when the donors # 7 to 12 were obtained.
FigureS7.tif
Figure S7: Cell viability assay. PBMCs isolated from 5 healthy blood donors (donors # 17 to 21), were treated, or not (NT), with 0.5 µg/mL or 2.5 µg/mL of active trimer Spike recombinant protein. Viability of cultures was assessed using the Promega® “CellTiter-Glo 2.0®” kit assay. Results were expressed on percentage of viability measured in the non-treated culture at 24 h post treatment (hpt). Statistical analysis: Sidak’s multiple comparison. 2 types of comparisons were performed: comparison between NT and treated condition and comparison between 24 hpt and 48 hpt conditions. (n.s: p>0.5; *: 0.5<p<0.01; **: 0.01<p<0.005; ***: 0.005<p<0.0001; ****: p<0.0001).
FigureS8.tif
Figure S8: Expression of ACE2 receptor in ACE2/TMPRSS2-U87 cells and in PBMC from healthy individuals. (A) Absence of immunodetection in normal U87 cells with specific anti-ACE2 antibody (B) Immunodetection of ACE2 receptor protein in U87 cells transduced with ACE2+/TMPRSS2+ lentiviral vector. (C) RT-qPCR with specific ACE2 primers in PBMCs from 11 healthy donors, showing the absence of detectable mRNA expression in human PBMC.

Download PDF

Version 1

posted

You are reading this latest preprint version

SARS-CoV-2 induces transcription of human endogenous retrovirus RNA followed by type W envelope protein expression in human lymphoid cells.

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Results

Discussion

Declarations

References

Supplementary Files

Status:

Version 1