The role and mechanism of quercetin via TLR4/MyD88/IRAK4 signaling pathway in the treatment of allergic rhinitis

doi:10.21203/rs.3.rs-3029080/v1

Download PDF

Article

The role and mechanism of quercetin via TLR4/MyD88/IRAK4 signaling pathway in the treatment of allergic rhinitis

https://doi.org/10.21203/rs.3.rs-3029080/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

An ovalbumin (OVA)-induced allergic rhinitis (AR) mouse model was established to investigate whether quercetin (QUE) treats AR via TLR4/MyD88/IRAK4 signaling pathway. SPF grade Balb/c mice were randomly divided into 4 groups: normal control (NC), OVA, dexamethasone (DEX), and (QUE) groups. OVA and aluminum hydroxide [AL(OH)₃] were injected intraperitoneally for basic sensitization and OVA was dripped into the nose for challenge to induce a mouse model of AR. The mice were scored by observing the behaviors of scratching, sneezing and runny nose to assess whether the modeling was successful. The treatment groups (DEX and QUE) were given the corresponding drugs for gavage treatment for 1 week after successful modeling, and the OVA and NC groups were treated with normal saline instead. The levels of OVA-IgE, IL-4, IL-13, IL-1β, IL-17 and IL-10 in serum were measured by enzyme-linked immunosorbent assay (ELISA); the changes of mice nasal mucosa were observed in hematoxylin-eosin (HE) stained histopathological sections; the relative expression levels of mRNA and protein of TLR4, MyD88, IRAK4, NF-κB in lung tissues were measured by quantitative real-time PCR (qPCR) and western blot, respectively; the changes in the percentages of regulatory T cells (Treg) and helper T cells 17 (Th17) in splenocytes were detected by flow cytometry. The results showed that the allergic symptoms scores were greater than 10 points and the expression levels of OVA-IgE, IL-4, IL-13, IL-1β and IL-17 in the serum increased and the expression level of IL-10 decreased in the OVA group compared with NC group. HE staining of the nasal cavity suggested detachment and necrosis of the nasal mucosa, tissue edema, and inflammatory cell infiltration in the OVA group. The relative expression levels of mRNA and protein of TLR4, MyD88, IRAK4, NF-κB in lung tissues were increased and the percentage of Treg cells decreased and the percentage of Th17 cells increased in splenocytes of the OVA group. Based on these results, we speculate that QUE may inhibit inflammatory responses and induce immune tolerance via TLR4/MyD88/IRAK4 signaling pathway in mice model of AR.

Biological sciences/Immunology/Inflammation

Biological sciences/Immunology/Immunotherapy/Immunosuppression

quercetin

TLR4/MyD88/IRAK4 signaling pathway

inflammatory response

immune regulation

allergic rhinitis

Allergic rhinitis (AR) is a non-infectious chronic inflammatory disease of the nasal mucosa mediated mainly by immunoglobulin E (IgE) after atopic individuals inhale allergens¹. Although AR is not a serious disease, it is the basis for many complications and is a major risk factor for poorly controlled asthma. Statistically, perennial AR has no less impact on quality of life than asthma, and it has significant negative consequences on the productivity of society as a whole^2,3. The prevalence of AR is on the rise globally. Increased urbanization, decreased time spent outdoors, and the misuse of antibiotics are contributing factors, and lifestyle changes, increased air pollution, fungi, infectious agents, tobacco, smog, and other risk factors have influenced the prevalence of AR, leading to its increased prevalence and worsened impact⁴. At present, the etiology of AR is not very clear, and there are no efficient strategies to prevent the occurrence of the disease⁵. The existing therapeutic options cannot completely cure the disease. Therefore, conducting more in-depth research on its pathogenesis and finding new targets for preventing and treating AR is of great significance. Quercetin (QUE), a naturally occurring flavonoid chemically known as 3,3',4',5,7-pentahydroxyflavone, is commonly found in vegetables, fruits and medicinal herbs and more, with powerful therapeutic potential including anti-inflammatory, anti-tumor, antioxidant, neuroprotective, anti-allergic and antibacterial activities^6,7. Toll-like receptor (TLR) is an important component of innate immunity³. The TLR4 signaling pathway can activate the downstream inflammatory response nuclear factor-κB (NF-κB) signaling pathway, leading to the release of inflammatory cytokines and chemokines⁸. Blocking the activity of TLR4/NF-κB signaling can significantly reduce the inflammatory response⁹. In this study, we investigated the effects of QUE on the inflammatory response and immune regulation of AR via TLR4/MyD88/IRAK4 signaling pathway by establishing a mouse model of AR.

2.1 Allergic symptom score in OVA-induced mice model

The mice in the NC group occasionally had scratchy noses, while the mice in the model group had obvious symptoms such as scratchy noses, sneezing and runny nose, and the scores were all > 10, indicating the success of our modeling. The OVA group scores were significantly higher than those of the NC group, and the difference was statistically significant (****P < 0.0001). The symptoms such as scratching were significantly reduced in the DEX and QUE groups compared with those in the OVA group after treatment, and the difference was statistically significant (###P < 0.001, ##P < 0.01). We can also observe from the local manifestation of the nasal cavity of mice that the nasal mucosa of OVA group was significantly congested compared with NC group, and after treatment the nasal congestion of mice in DEX and QUE groups was significantly better compared with OVA group (Fig. 1).

2.2 OVA-IgE, IL-4, IL-13, IL-1β, IL-17 and IL-10 expression levels in the serum of mice

We detected OVA-IgE, IL-4, IL-13, IL-1β, IL-17 and IL-10 in mice serum by ELISA, respectively. Our results showed that OVA-IgE, IL-4, IL-13, IL-1β and IL-17 were increased in the OVA group and decreased in the DEX and QUE groups. This indicates that OVA can increase the expression of OVA-IgE, IL-4, IL-13, IL-1β and IL-17 in the serum of mice, and QUE can reverse the above-mentioned indexes induced by OVA. At the same time, we also detected IL-10 in mice serum by ELISA. the results showed that IL-10 was decreased in the OVA group and increased in the QUE group. This suggests that QUE can reverse OVA-induced IL-10 (Fig. 2).

2.3 Histopathological changes of nasal mucosa in mice

The HE-stained sections of the nasal cavity of mice showed that the nasal mucosa of NC group was basically neat, with intact epithelial structure, the morphological structure of glandular cells was neat and orderly, the inflammatory cells were less infiltrated, and there was no obvious exudation around. In OVA group, the nasal mucosa was incomplete, with obvious mucosal disruption, shedding, necrosis, tissue edema, small vessels dilatation, glandular hyperplasia, disorganized arrangement of glandular cells, and obvious inflammatory cells infiltration. In DEX and QUE groups, mucosal morphology improved, glandular hyperplasia was reduced, glandular cells arrangement tended to be orderly, inflammatory cells infiltration were reduced, tissue edema was reduced, and small vessels dilation were not obvious (Fig. 3).

2.4 Effect of QUE on the mRNA expression levels of TLR4, MyD88, IRAK4, and NF-κB

We detected the mRNA expression levels of TLR4, MyD88, IRAK4, and NF-κB in mice lung tissues by qPCR. Our results showed that the mRNA expression levels of TLR4, MyD88, IRAK4, and NF-κB were increased in the OVA group and decreased in the DEX and QUE groups. This suggests that OVA can increase the mRNA expression levels of TLR4, MyD88, IRAK4 and NF-κB, while QUE can reverse the OVA-induced effects of the above mRNAs (Fig. 4).

2.5 Effect of QUE on the protein expression levels of TLR4, MyD88, IRAK4 and NF-κB

We detected the relative expression levels of TLR4, MyD88, IRAK4 and NF-κB proteins in mice lung tissue by Western blot and found that the relative expression levels of these proteins were significantly increased in the OVA group. The relative expression levels of these proteins were reduced in the DEX and QUE groups after treatment compared with the OVA group. This indicates that QUE inhibits the expression of related proteins in the TLR4/MyD88/IRAK4 signaling pathway (Fig. 5).

2.6 Effect of QUE on the percentage of Treg cells and Th17 cells in splenocytes

We detected the percentage of Treg (CD4⁺ CD25⁺ FOXP3⁺) and Th17 (CD4⁺ IL-17) cells in the splenocytes of mice by a flow cytometer, respectively. Our results showed that the percentage of Treg cells decreased in the OVA group and increased in the DEX and QUE groups. This suggests that OVA can reduce Treg cells in splenocytes of mice, while DEX and QUE can reverse the percentage of Treg cells induced by OVA and potentially induce Treg differentiation and proliferation. Meanwhile, our results showed that the percentage of Th17 cells increased in the OVA group and decreased in the DEX and QUE groups. This indicates that OVA can increase the percentage of Th17 in the splenocytes of mice, while DEX and QUE can reverse the percentage of Th17 induced by OVA (Fig. 6).

The main clinical symptoms of AR include itchy nose, runny nose, and sneezing. The examination can reveal pale edema of the nasal mucosa, clear water-like secretions in the nasal cavity, and hyperemia of the nasal mucosa in the acute phase. We found that Balb/c mice had significant nasal scratching after successful modeling, suggesting that they may have nasal itching symptoms. Repeated nose scratching can lead to whisker loss and thinning of the fur around the nose in OVA-induced mice, and we observed these manifestations by post-modeling. We observed that the nasal mucosa of the OVA-induced mice model was more congested than that of the NC group (Fig. 2B), indicating that the inflammation was in the acute phase. This also shows that our modeling was successful. Scratching and rubbing were significantly reduced in the DEX and QUE groups after treatment, and congestion of the nasal mucosa was improved compared to the OVA group (Fig. 2C, Fig. 2D). This indicates that QUE can improve nasal itching symptoms and alleviate congestion of the nasal mucosa in mice with AR. From this perspective, our treatment is effective. The symptoms of AR are caused by allergic inflammatory factors released by allergens entering the body and stimulating the nasal mucosa. When sensitized individuals are re-exposed to the same allergen, the allergen binds to high-affinity receptors (FcεRI) on the surface of mast cells and basophils, leading to activation and degranulation of these cells, which in turn release histamine, leukotrienes, prostaglandins and other inflammatory factors resulting in acute symptoms of AR^1,10.

IL-17 is mainly produced by Th17 cells and is often elevated in AR¹¹. This was also demonstrated by the results of our ELISA experiments, which were consistent with our flow cytometry results. IL-1β is a key cytokine that promotes the occurrence of AR¹². IL-1β activates NF-κB pathway to promote IL-13 production¹³. IL-4 and IL-13 are involved in mucus and IgE production, leading to the release of pro-inflammatory mediators, which in turn promote the development of allergic reactions¹⁴. IL-10 has multiple roles in immune regulation and inflammation, and its deficiency is associated with increased IgE in AR¹⁵. Our results showed that OVA-specific IgE, IL-4 and IL-13 were increased and IL-10 was decreased in serum of the OVA-induced mice model, and that the increase of OVA-specific IgE may be associated with the increase of IL-13 and IL-4 and the decrease of IL-10. It is necessary to conduct more in-depth research on the relationship between them in subsequent experiments.

QUE, with anti-allergic function of inhibiting the production of histamine and pro-inflammatory mediators, can regulate the stability of Th1/Th2, reduce antigen-specific IgE antibodies released by B cells, and decrease IL-4 in serum, thereby reducing allergic airway inflammation and airway hyperresponsiveness¹⁶. QUE can also reduce the Ca²⁺ influx induced by allergy and inhibit the release of chemokines in a manner similar to that of the mast cell stabilizer DEX¹⁷. In our treatment groups (DEX and QUE) we observed that IL-4 and IL-13 were lower than in the OVA group, suggesting that QUE can reduce OVA-induced IL-4 and IL-13, and that the reduction of IL-4 and IL-13 further leads to a reduction of IgE. Our experimental results also suggest that the therapeutic effect of QUE is comparable to that of DEX. This also suggests that blocking the production of IL-4 and IL-13 can treat AR, and further verifies the anti-inflammatory and anti-allergic effects of QUE.

The nasal mucosa is rich in small blood vessels. When allergens cause the body to be allergic, the inflammatory mediators will cause congestion and edema of the submucosal tissue, smooth muscle contraction, increased vascular permeability and mucus secretion. These inflammatory mediators can also lead to an increase in the number of eosinophils deep in the nasal mucosa, and the excessive accumulation of eosinophils further releases some toxic proteins that can damage the integrity of respiratory epithelial cells^18,19. Under the synergistic effect of chemokines, inflammatory cells infiltrate the nasal mucosal tissue causing inflammatory responses, which further leads to damage of the nasal mucosal tissue and clinical symptoms¹. Our HE staining results showed that the nasal mucosa had obvious disruption, shedding and necrosis, submucosal small blood vessels dilated, glandular hyperplasia, glandular cell arrangement disorder, and inflammatory cells infiltrated in the OVA group. After treatment, the integrity of the nasal mucosa was somewhat restored, tissue edema was alleviated, submucosal small blood vessels were not significantly dilated, the arrangement of glandular cells tended to be neat, and the number of infiltrating inflammatory cells was reduced compared to the OVA group. From a morphological perspective, QUE can improve mucosal morphology, reduce the number of inflammatory cells, and restore the integrity of the nasal mucosal epithelium in the OVA-induced mice model.

TLR4-mediated signaling links innate and adaptive immunity, and activation of TLR4 drives and promotes the development of inflammation²⁰. When TLR4 is activated it binds to MyD88 protein and further activates IRAK4, which eventually leads to the activation of NF-κB and the release of inflammatory cytokines and chemokines causing inflammation^20,21. Our results showed that the relative expression of related proteins in the TLR4/MyD88/IRAK4 signaling pathway was significantly increased in the OVA-induced mice model, suggesting that inflammation in AR may be related to this signaling pathway. The expression of these proteins in the signaling pathway was restored after treatment with QUE, indicating that QUE can improve the expression of related proteins in the TLR4/MyD88/IRAK4 signaling pathway caused by inflammation in AR. We further detected the expression levels of the relevant mRNAs in the TLR4/MyD88/IRAK4 signaling pathway by qPCR, and the results were consistent with those obtained by Western blot. This suggests a consistent effect of QUE on related proteins and mRNAs in the TLR4/MyD88/IRAK4 signaling pathway and further adds to the evidence that QUE treats AR via the TLR4/MyD88/IRAK4 signaling pathway.

Th17 and Treg represent two distinct phenotypes of CD4⁺ T cells with completely different functions. Th17 cells have pro-inflammatory effects, while Treg cells have anti-inflammatory effects, and inflammatory cytokines can affect the balance of Th17/Treg²². Th17 and Treg cells antagonize each other in terms of function and differentiation, and Th17/Treg imbalance will lead to inflammatory responses, which will further lead to the occurrence of AR^23,24. Our results showed that the percentage of Treg in splenocytes decreased and the percentage of Th17 increased in the OVA-induced mice model, suggesting that OVA can decrease Treg and increase Th17. Treg percentage was upregulated and Th17 percentage was downregulated in spleen after QUE treatment, suggesting that QUE can reduce Th17 while reversing the abnormally downregulated Treg in splenocytes by OVA and potentially inducing Treg differentiation and proliferation. Therefore, we can treat AR by improving the Th17/Treg imbalance.

In conclusion, QUE can effectively alleviate the symptoms of scratching and sneezing in OVA-induced mice model, improve the damage of nasal mucosa by OVA, reduce the expression level of inflammatory factors, and regulate the imbalance of Treg/Th17 cells. Its mechanism of action may be to reduce the inflammatory response via the TLR4/MyD88/IRAK4 signaling pathway and induce immune tolerance in the body. This study mainly evaluated the therapeutic effects of QUE on AR, but its toxic and side effects were not explored in more depth. Therefore, it is necessary to conduct more in-depth studies on its toxic and side effects while observing the therapeutic effects in the future.

4.1 Experimental materials

4.1.1 Animal ethics declaration

Our study was conducted in accordance with the ARRIVE guidelines for animal research and complied with its regulations. All experimental protocols used in this study were approved by the Experimental Animal Ethics Committee of Shenzhen Institute of Otolaryngology (NO:2020 − 0129). All experimental methods and steps complied with the relevant institutional, regional and national guidelines and legislation and we did our best to minimize the suffering to the animals.

4.1.2 Experimental reagents

Quercetin (Puxi, China); Dexamethasone (Sigma-Aldrich, China); TLR4, MyD88 (Beyotime, China); NF-κB p65 (CST, USA); IRAK4 (Abcam, USA); BCA kit (Thermo, USA); SYBR Green qPCR Master Mix and RT Master Mix for qPCR (MCE, USA); ELISA kit OVA-IgE (Genie, Ireland); Mouse Interleukin 17 (IL-17) ELISA Kit (Cusabio China); Mouse Interleukin 1β (IL-1β) ELISA Kit, Mouse Interleukin 10 (IL-10) ELISA Kit, Mouse Interleukin 13 (IL-13) ELISA Kit and Mouse Interleukin 4 (IL-4) ELISA Kit (Dayu, China); Flow-through antibody FITC Rat anti-mouse CD4 antibody, APC Rat anti-mouse CD25 antibody, PerCP Rat anti-mouse FOXP3 antibody (BD Biosciences, USA); Cell Fixation Membrane Breaker (eBioscience, USA).

4.1.3 Animal study

4–6 weeks old female Balb/c mice were purchased from Guangdong Experimental Animal Center, Animal Use License No. SCXK (Guangdong) 2022-0002, Certificate of Conformity No. 44007200114118. The mice were housed in an air-conditioned animal room (temperature: 25 ± 1°C, humidity: 65%±5%) for one week after acclimatization to start the experiment.

4.1.4 Experimental instruments

SDS-PAGE electrophoresis system, Western blot transfer system, ChemiDoc MP multifunctional chemiluminescence imaging system (Bio-Rad, USA); BD FACSCanto II flow cytometer (BD Bioscience USA); Enzyme labeler SpectraMax Paradigm MultiMode Microplate Reader (Molecular Devices, USA).

4.2 Experimental methods

4.2.1 Animal model establishment

The mice were randomly divided into 4 groups, normal control (NC), Ovalbumin (OVA), dexamethasone (DEX), and QUE, with 6 mice in each group. Except for the NC group, the remaining groups were sensitized with 200 µl of sensitization working solution [containing 2 mg Al(OH)₃ and 100µg OVA] by intraperitoneal injection on days 0, 7 and 14 for basal sensitization, and challenged on day 21 by nasal drip (10 µl per nostril) with OVA dissolved in saline (10µg/µl) in mice once daily for 7 days. Behavioral assessment after challenge on day 28 (within 30 minutes). The treatment groups (DEX and QUE) were treated with gavage in the afternoon of the day of challenge after successful modeling, DEX group (10 mg /kg) and QUE group (50 mg/kg), once daily for 7 days. The NC group was replaced by normal saline in the same way and at the same time (Fig. 7).

4.2.2 Animal model evaluation

The mouse model will show symptoms such as sneezing, rubbing, face scratching, and runny nose after a successful challenge, and will be observed for 30 minutes after the final challenge. Scoring was done according to the following criteria (Table 1). The total score was recorded by the superposition method, and a total score of more than 5 was considered successful modeling.

Table 1

Criteria for scoring allergic symptoms in OVA-induced mice model.
Scratching	Sneezing	Runny nose	Biological scoring
None	None	None	0
Occasionally(1–2 times)	1–3	Flow to anterior nostril	1
Frequently	4–10	Beyond the anterior nostril	2
Scratching incessantly	＞10	Runny nose all over the face	3

4.2.3 ELISA to detect OVA-IgE, IL-4, IL-13, IL-1β, IL-17 and IL-10 expression levels in the serum of mice

The eye blood of mice was collected, left at room temperature for half an hour and then centrifuged at 4°C to extract the upper serum layer, which was stored at -80℃ in the refrigerator for use. The expression levels of OVA-IgE, IL-4, IL-13, IL-1β, IL-17 and IL-10 in the serum of mice were detected by ELISA. Specific steps were performed according to the reagent instructions.

4.2.4 Histopathological analysis by hematoxylin-eosin (HE) staining

The nasal tissues of mice were isolated intact under aseptic conditions, washed off the surface blood and stored in EP tubes containing 4% paraformaldehyde for fixation. After decalcification, dehydration, transparency, wax immersion and embedding, the sections were sliced to a thickness of 5 µm. Then the sections were stained with hematoxylin and eosin solution after spreading, baking, dewaxing and rehydration, and sealed after being dehydrated and transparent again, dried and observed under the microscope.

4.2.5 Quantitative real-time PCR (qPCR)

Total RNA was isolated from mice lung tissues by TRIzol, and the concentration and purity of RNA were determined by UV spectrophotometer. According to the instructions of the RT Master Mix for qPCR (gDNA digest plus) kit, the total RNA was reverse transcribed to cDNA with a transcription system of 20 µl. TLR4, MyD88, IRAK4, NF-κB p65 and GAPDH primers were designed and sent to Biotech for synthesis (primer sequences are detailed in Table 2). The qPCR amplification was performed according to the instructions of SYBR Green qPCR Master Mix (Low ROX) kit. The relative expression levels of mRNAs in each group were calculated by the 2^−△△Ct method and compared.

Table 2

qPCR primer sequences
qPCR testing genes	Primer sequences(5'-3')
TLR4-F	ATGGCATGGCTTACACCACC
TLR4-R	GAGGCCAATTTTGTCTCCACA
MyD88-F	TCATGTTCTCCATACCCTTGGT
MyD88-R	AAACTGCGAGTGGGGTCAG
IRAK4-F	CATACGCAACCTTAATGTGGGG
IRAK4-R	GGAACTGATTGTATCTGTCGTCG
NF-κB-F	ATGGCAGACGATGATCCCTAC
NF-κB-R	TGTTGACAGTGGTATTTCTGGTG
GAPDH-F	AGGTCGGTGTGAACGGATTTG
GAPDH-R	TGTAGACCATGTAGTTGAGGTCA

4.2.6 Western blot to detect the expression of relevant proteins in lung tissue of mice

Mice lung tissues were collected under aseptic conditions, stripped of surrounding fat, blood vessels and connective tissue and stored in a -80°C refrigerator. They were thawed at room temperature and washed 3 times with PBS, and added with protein lysis solution and protease inhibitor, then put into a grinder for grinding and continued to be lysed for 30 minutes in a 4℃ refrigerator, and then centrifuged at 4°C (12000r/10min). The supernatant was collected as a protein stock solution. Protein concentration was measured by a BCA kit. After adjusting the protein concentration of each group to the same, the mass of 30µg was sampled for SDS-PAGE electrophoresis. After the sample was added, the voltage was adjusted to 80V and the proteins were observed to enter the separation gel. Then the voltage was adjusted to 120v after the marker was stratified and the electrophoresis was continued until the target proteins were completely stratified. Subsequently, the proteins were transferred to PVDF membranes, closed with TBST containing 5% skim milk powder for 1 h. The membranes were cut and incubated with primary antibodies (GAPDH 1:2000, TLR4 1:2000, NF-κB 1:1000, IRAK4 1:1000, MyD88 1:1000) and shaken overnight in the refrigerator at 4°C. The membranes were rewarmed at room temperature for 1 h and washed three times with TBST for 10 minutes each time. Then they were incubated with goat anti-rabbit IgG antibody (1:5000) for 2 h and washed three times again with TBST for 10 min each time and developed. The results were analyzed with ImageJ software.

4.2.7 Flow cytometry to detect splenic Treg cells and Th17 cells in splenocytes

After sacrificing mice, the spleen was aseptically stripped, with half used for Treg cells assay and the other half for Th17 cells assay. All the spleens were ground in a flat dish containing PBS, then filtered, washed with PBS, added 300 µl of erythrocyte lysate, shaken and mixed, and placed in a 4°C refrigerator for 5 minutes. 1 µl each of CD4 and CD25 antibodies were added to each tube of the Treg cells assay; 1 µl of CD4 antibody was added to each tube for the Th17 cells assay, and all the samples were incubated for half an hour in the dark at 4°C in a refrigerator, and then added 400 µl of fixation buffer to fix for 1 h. 1 µl of FOXP3 antibody and 300 µl of permeabilization buffer were added to each tube of the Treg cells assay; 2 µl of IL-17 antibody and 300 µl of permeabilization buffer were added to each tube of the Th17 cells assay; and all the samples were shaken well and placed in the refrigerator overnight at 4°C. Washed them twice with PBS and assessed by a flow cytometer.

4.2.8 Statistical analysis

The data were statistically analyzed and plotted using Graph Pad Prism 8.0 software, and the measurement data were expressed by (x̅±s), t-student test was used for two-way comparison, and One-Way ANOVA was used for comparison between multiple groups; P < 0.05 was considered a statistically significant difference.

Data availability

All data supporting this publication can be available from the corresponding author S.Q upon reasonable request.

Acknowledgements

This work was supported by grants Natural Science Foundation of China (No. 81700888), Guangdong Basic and Applied Basic Research Foundation (No. 2021A1515010971), Shenzhen Science and Technology Program (No. JCYJ20210324142207019), Shenzhen Key Medical Discipline Construction Fund (No. SZXK039), and Science and Technology Development Special Fund of Shenzhen Longgang District (No. LGKCYLWS2019000864, LGKCZSYS2019000046).

Author contributions

Conceptualization and writing—preparation of the original draft, CK; Writing—review and editing: CK, JL, SQ, PL, YL, XL, ZW, XZ and HZ. All authors have read and agreed to the published version of the manuscript.

Competing interests

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Bousquet, J. et al. Allergic rhinitis. Nat Rev Dis Primers. 6, 95, doi:10.1038/s41572-020-00227-0 (2020).
Greiner, A. N., Hellings, P. W., Rotiroti, G. & Scadding, G. K. Allergic rhinitis. Lancet. 378, 2112–2122, doi:10.1016/s0140-6736(11)60130-x (2011).
Kirtland, M. E., Tsitoura, D. C., Durham, S. R. & Shamji, M. H. Toll-Like Receptor Agonists as Adjuvants for Allergen Immunotherapy. Front Immunol. 11, 599083, doi:10.3389/fimmu.2020.599083 (2020).
Murrison, L. B., Brandt, E. B., Myers, J. B. & Hershey, G. K. K. Environmental exposures and mechanisms in allergy and asthma development. J Clin Invest. 129, 1504–1515, doi:doi:10.1172/JCI124612 (2019).
Johannes, W. et al. Genome-wide association and HLA fine-mapping studies identify risk loci and genetic pathways underlying allergic rhinitis. Nat Genet. 50, 1072–1080, doi:10.1038/s41588-018-0157-1 (2018).
Shen, P. et al. Potential Implications of Quercetin in Autoimmune Diseases. Front Immunol. 12, 689044, doi:10.3389/fimmu.2021.689044 (2021).
Manzoor, M. F. et al. Novel extraction, rapid assessment and bioavailability improvement of quercetin: A review. Ultrason Sonochem. 78, 105686, doi:10.1016/j.ultsonch.2021.105686 (2021).
Yang, S., Zhang, J., Wang, S., Zhao, X. & Shi, J. SOCS2 overexpression alleviates diabetic nephropathy in rats by inhibiting the TLR4/NF-κB pathway. Oncotarget. 8, 91185–91198, doi:10.18632/oncotarget.20434 (2017).
Zhang, Y. & Zeng, Y. Curcumin reduces inflammation in knee osteoarthritis rats through blocking TLR4 /MyD88/NF-κB signal pathway. Drug Dev Res. 80, 353–359, doi:10.1002/ddr.21509 (2019).
Cheng, L. et al. Chinese Society of Allergy Guidelines for Diagnosis and Treatment of Allergic Rhinitis. Allergy Asthma Immunol Res. 10, 300–353, doi:10.4168/aair.2018.10.4.300 (2018).
Hofmann, M. A. et al. Role of IL-17 in atopy-A systematic review. Clin Transl Allergy. 11, e12047, doi:10.1002/clt2.12047 (2021).
Wang, H. R. et al. IL-1β and Allergy: Focusing on Its Role in Allergic Rhinitis. Mediators Inflamm. 2023, 1265449, doi:10.1155/2023/1265449 (2023).
Kato, A. Group 2 Innate Lymphoid Cells in Airway Diseases. Chest. 156, 141–149, doi:10.1016/j.chest.2019.04.101 (2019).
Busse, W. W. et al. Understanding the key issues in the treatment of uncontrolled persistent asthma with type 2 inflammation. Eur Respir J. 58, 2003393, doi:10.1183/13993003.03393-2020 (2021).
Shao, J. B. et al. Histone deacetylase 11 inhibits interleukin 10 in B cells of subjects with allergic rhinitis. Int Forum Allergy Rhinol. 8, 1274–1283, doi:10.1002/alr.22171 (2018).
Jafarinia, M. et al. Quercetin with the potential effect on allergic diseases. Allergy Asthma Clin Immunol. 16, 36, doi:10.1186/s13223-020-00434-0 (2020).
Ding, Y. et al. Quercetin inhibits Mrgprx2-induced pseudo-allergic reaction via PLCγ-IP3R related Ca(2+) fluctuations. Int Immunopharmacol. 66, 185–197, doi:10.1016/j.intimp.2018.11.025 (2019).
Liu, Y., Sha, J., Meng, C. & Zhu, D. Mechanism of Lower Airway Hyperresponsiveness Induced by Allergic Rhinitis. J Immunol Res. 2022, 4351345, doi:10.1155/2022/4351345 (2022).
Okubo, K. et al. Japanese guidelines for allergic rhinitis 2020. Allergol Int. 69, 331–345, doi:10.1016/j.alit.2020.04.001 (2020).
Zamyatina, A. & Heine, H. Lipopolysaccharide Recognition in the Crossroads of TLR4 and Caspase-4/11 Mediated Inflammatory Pathways. Front Immunol. 11, 585146, doi:10.3389/fimmu.2020.585146 (2020).
Bruno, K. et al. Targeting toll-like receptor-4 (TLR4)-an emerging therapeutic target for persistent pain states. Pain. 159, 1908–1915, doi:10.1097/j.pain.0000000000001306 (2018).
Zhang, S. et al. The Alterations in and the Role of the Th17/Treg Balance in Metabolic Diseases. Front Immunol. 12, 678355, doi:10.3389/fimmu.2021.678355 (2021).
Shan, J., Jin, H. & Xu, Y. T Cell Metabolism: A New Perspective on Th17/Treg Cell Imbalance in Systemic Lupus Erythematosus. Front Immunol. 11, 1027, doi:10.3389/fimmu.2020.01027 (2020).
Chen, Z., Ke, X., Wang, X., Kang, H. & Hong, S. LncRNA JPX contributes to Treg/Th17 imbalance in allergic rhinitis via targeting the miR-378g/CCL5 axis. Immunopharmacol Immunotoxicol. 44, 519–524, doi:10.1080/08923973.2022.2055566 (2022).

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

The role and mechanism of quercetin via TLR4/MyD88/IRAK4 signaling pathway in the treatment of allergic rhinitis

Status:

Version 1

Abstract

Figures

1. Introduction

2. Results

2.1 Allergic symptom score in OVA-induced mice model

2.2 OVA-IgE, IL-4, IL-13, IL-1β, IL-17 and IL-10 expression levels in the serum of mice

2.3 Histopathological changes of nasal mucosa in mice

2.4 Effect of QUE on the mRNA expression levels of TLR4, MyD88, IRAK4, and NF-κB

2.5 Effect of QUE on the protein expression levels of TLR4, MyD88, IRAK4 and NF-κB

2.6 Effect of QUE on the percentage of Treg cells and Th17 cells in splenocytes

3. Discussion

4. Materials and methods

4.1 Experimental materials

4.1.1 Animal ethics declaration

4.1.2 Experimental reagents

4.1.3 Animal study

4.1.4 Experimental instruments

4.2 Experimental methods

4.2.1 Animal model establishment

4.2.2 Animal model evaluation

4.2.3 ELISA to detect OVA-IgE, IL-4, IL-13, IL-1β, IL-17 and IL-10 expression levels in the serum of mice

4.2.4 Histopathological analysis by hematoxylin-eosin (HE) staining

4.2.5 Quantitative real-time PCR (qPCR)

4.2.6 Western blot to detect the expression of relevant proteins in lung tissue of mice

4.2.7 Flow cytometry to detect splenic Treg cells and Th17 cells in splenocytes

4.2.8 Statistical analysis

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1