The Antidepressant Effect of Magnolol on Depression-like Behavior of CORT-induced Depression Mice

doi:10.21203/rs.3.rs-3050662/v1

Download PDF

Research Article

The Antidepressant Effect of Magnolol on Depression-like Behavior of CORT-induced Depression Mice

https://doi.org/10.21203/rs.3.rs-3050662/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Although the antidepressant effect of magnolol has been revealed in previous reports, the mechanism remains unclear. In this study, the antidepressant effect of magnolol on corticosterone-induced (CORT-induced) depressed mice was investigated in vivo. After 21 days of CORT induction, the mice showed marked depressive-like behaviors, with a decrease in sucrose preference score and an increase in immobility time in tail suspension test (TST) and forced swimming test (FST). Pretreatment with either magnolol (50 mg/kg, i.p.) or the kappa opioid receptor (KOR) antagonist nor-BNI (10 mg/kg, i.p.) prevented CORT-induced depression-like behavior and reduced CORT-induced dynorphin (DYN A) elevation in the hippocampal DG. However, no depression-like behavior was observed in mice with KOR downregulation in the DG. We further found that upregulation of DYN A in the DG caused depression, which was blocked by intraperitoneal injection of nor-BNI and modulated by magnolol. The present study demonstrated that magnolol could ameliorate CORT-induced depression-like behaviors, by modulating the DYN A/KOR system in the DG of the hippocampus.

corticosterone

depression

hippocampal dentate gyrus

dynorphin/kappa opioid receptor system

magnolol

Depression is an emotional disorder characterized by behavioral hopelessness and emotional loss, which further develop into suicide [1, 2]. In previous studies, antidepressant effects had been found in many Chinese herbs [3–6], therefore, exploring the antidepressant components of Chinese herbs can provide some theoretical basis for clinical medication.

Houpoea officinalis, a magnolia plant, has the functions of dehumidification, phlegm elimination, and digestion. Magnolol is a constituent extract of Houpoea officinalis, and its good antibacterial and antidepressant activities have been reported recently. For example, magnolol could significantly increase the sucrose preference score of depressed mice and significantly decrease the immobility time of TST and FST of depressed mice [7], by promoting hippocampal neuron regeneration [8].

Dynorphin (DYN A) is an endogenous opioid peptide and an endogenous ligand of kappa opioid receptors (KOR). DYN A/KOR system is widely found in brain regions associated with negative emotions [9–11]. Recent studies on DYN A/KOR system have focused on the regulation of negative emotions such as anxiety and depression [12–15].It has been found that the upregulation of DYN A/KOR system leads to depression[16–19], and the antagonism of KOR contributes to antidepressant effects[20–22].

The hippocampus was one of several limbic brain structures related to emotional disorder, with its dorsal section mainly involved in cognition and learning, while the ventral section mainly involved in emotional responses [23–27], especially depression [28, 29], as the neurogenesis in the ventral DG of the hippocampus was significantly reduced in depressed mice[30, 31]. Moreover, it was reported that activating neurons without changing the number of neurogenesis could alleviate depression-like behaviors [32]. Other studies had also shown that KOR agonist could inhibit neurogenesis in the DG of mice by inhibiting the differentiation of adult neural stem cells, and this effect could be blocked by KOR antagonist [33]. Therefore, we hypothesized that the DYN A/KOR system of hippocampal DG neural stem cells in mice was worked in depression-like behavior, and the antidepressant effect of magnolol was based on this system.

In this study, we used molecular biology, experimental animal science and stereotactic brain injection techniques to investigate the role of hippocampus DYN A/KOR system in depression-like behaviors after CORT induction and the antidepressant effect of magnolol. We first established a stable CORT-induced depression model to examined the exact role of DYN A/KOR in depression, and the results showed that CORT-induced depression-like behaviors could be prevented by intraperitoneal KOR antagonists and magnolol. We further found that the hippocampal DG plays a key role in CORT-induced depression, and the down-regulation of KOR in DG neural stem cells could blocked CORT-induced depression-like behaviors. We finally demonstrated that CORT induces the up-regulation of DYN A, an endogenous ligand of KOR, in the DG of the hippocampus in mice. This depression-like behavior can be inhibited by down-regulating KOR on hippocampal DG neural stem cells. Magnolol can effectively improve the depression-like behavior of CORT-induced depression mice, and the mechanism was partly attributed to the DYN A/KOR system.

2.1 Animals

Male Oprk1^lox/lox mice (full name: B6;129-Oprk1tm2.1Kff/J; stain #: 030076) were purchased from The Jackson Laboratory (US) and genotyped through PCR. Male C57BL6/J mice aged 7–8 weeks (20–25 g) were obtained from Shanghai Slack Laboratory Animal Liability Co.LTD. (SCXK (Shanghai) 2017-0005). All mice were housed in the Laboratory Animal Center of Zhejiang Chinese Medical University accredited by the Association for Assessment and Accreditation of Laboratory Animal Care (AAALAC). Animals were cared under standard environmental conditions (12 hours light-dark cycle and 24 ± 2 ℃) with access to food and water provided ad libitum. All experimental procedures were approved by the Animal Ethics Committee of Zhejiang Chinese Medical University (permission number: IACUC-20220328-09) and conducted according to the National Institute of Health Guide for the Care and Use of Laboratory Animals (NIH Publications No. 80 − 23).

2.2 Materials

Corticosterone (CORT, 235135) was purchased from sigma, nor-Binaltorphimine dihydrochloride (nor-BNI, ab120078) and anti-dynorphin A17 antibody (DYN A17, ab82509) were purchased from Abcam, Anti-oprk 1 antibody (A14035) was purchased from Wuhan ABclonal, magnolol (M111378) was purchased from aladdin, fluoxetine (HY-B0102) was purchased from MCE.

Magnolol (25/50/100 mg/kg/day), nor-BNI (10 mg/kg/day) and fluoxetine (10 mg/kg/day) were uniformly dispersed in 1% Tween 80 and then dissolved in distilled water. All drugs were administered in an injection volume of 4 mL/ kg^− 1(i.p.). All drugs were dispensed on the spot[34].

2.3 CORT-induced depression model

CORT was dissolved in 0.45% beta-cyclodextrin, administered ad libitum in opaque bottles, and replaced every 3 days. mice received 70 µg/ml CORT, equivalent to 10 mg/kg/day[35].

2.4 Behavioral tests

2.4.1 Sucrose preference test (SPT)

This experiment was evaluated the affective deficit of depression-like emotion in mice. The mice were conditioned to drink sugar water before the experiment began. All mice were given one bottle of pure water, one bottle of pure water containing 1% sucrose and food. After 12 h, the positions of the two kinds of water were switched so that to exclude the influence of location preference. 12 h after food and water were deprived, a bottle of pure water and a bottle of pure water containing 2% sucrose were given to all mice. After drinking water for 2 h, consumption of pure water and sucrose water were measured respectively. Sucrose Preference Score (%) = sucrose water intake (mL)/(sucrose water intake + pure water intake) (mL).

2.4.2 Open field test (OFT)

The experiment was evaluated anxiety-like emotions in mice. Mice were placed in a black square box (40×40×50 cm), and the bottom of the box was evenly divided into 16 equal squares. The square around the outermost circle was the peripheral area, and the rest was the central area. At the beginning of the test, mice were placed in the central part of the open field. The total distance and center time of the mice in the open field for 5 minutes were analyzed automatically by ANY-maze 6.3 software.

2.4.3 Tail suspension test (TST)

This experiment was evaluated behavioral hopelessness in depression-like mood in mice. The mice were suspended upside down on a platform about 10 cm above the ground. After the mice adapted for 2 min, the time for the mice to give up struggle and remain immobility within the last 4 min was recorded as Immobility Time in TST.

2.4.4 Forced swimming test (FST)

This experiment was evaluated behavioral hopelessness in depression-like mood in mice. The mice were placed individually in a clear glass beaker containing 1.6 L of water (25 ± 1 ℃). After 2 minutes of adaptation, the time for mice to stop swimming and float on the water within the last 4 min was recorded as Immobility Time in FST.

2.5 Stereotaxic injection into the brain

After the mice were completely anesthetized, the skull tops of the mice were shaved and the mice were immobilized so that the head could not be moved easily. The skin of the skull was opened to expose the anterior and posterior fontanelles. After positioning to the desired position, a small hole was drilled and the 10 µL microsyringe was moved down to the indicated depth. Virus was injected into the hippocampus at a constant rate of 100 nL/min, and the mice were left at the same position for 8 min after the injection. At the end of the experiment, the wound was sutured, and the mice were raised in a clean cage after awakening.

The virus used in this study: rAAV-hSyn-Pdyn-P2A-tdTomato-WPRE-hGh pA(AAV2/9); pAAV-nestin-Cre-P2A-EGFP-3×FLAG-WPRE(AAV2/9)

2.6 Tissue preparation

After the behavioral experiment, the mice were euthanized, and the whole brain was first removed and then put into the mouse brain coronal section mold. The whole brain was cut into 500µm thick brain slices, and the brain slices containing hippocampus tissue were selected to peel off the DG and collected in the ultra-low temperature refrigerator at -80 ℃ until the experiment.

2.7 Western-blot assay

The DG tissues were weighed, and RIPA (medium) containing 1 mM PMSF was added at a ratio of 1:10. After grinding and homogenizing, the samples were centrifuged at 14000 rpm at 4°C for 15 min, and the supernatant was collected as protein samples. Protein samples were separated on 10% SDS-PAGE gels and electrophoretically transferred to polyvinyl difluoride (PVDF) membranes (Merck, Germany). The membrane was blocked with 5% skim milk at room temperature for 1 hour, and then incubated with primary anti-Oprk 1 (1:1000,), anti-dynorphin-A (1:1000,) and anti-β-tubulin (1:1000,) in a 4°C refrigerator overnight. The membrane was cleaned with TBST for 3×15 min, and the secondary antibody was incubated at room temperature for 1 h. After TBST cleaning for 3×15 min, chemiluminescent substrate (GE Healthcwere) and automatic chemiluminescent gel imager (ProteinSimple, USA) were used for protein detection. Image J software in Windows was used to quantify the gray value of the bands by Western blot, and normalized into β-Tubulin (total protein). The statistical results for each group were expressed as a percentage relative to the control group.

2.8 Primers for quantitative real-time PCR

mActin forward: AGAGGGAAATCGTGCGTGACATC

mActin reverse: ACCGCTCGTTGCCAATAGTGATG

mOprk1 forward: TGTGGTATTTGTGGTGGGCTTAGTG

mOprk1 reverse: TGTGGTATTTGTGGTGGGCTTAGTG

mPdyn forward: AAGCAGTAAGCAGGTCATTCATCCC

mPdyn reverse: ACCACGCCATTCTGACTCACTTG

2.9 Statistical analysis

All data statistical analysis and charting were performed using GraphPad Prism 9.1 software. Each data was represented by Mean and standard error of mean (Mean ± SEM). Statistical differences between values from two groups were determined using unpaired Student's t tests, whereas statistical differences between three or more groups were analyzed using analyses of variance (ANOVAs) followed by Tukey post hoc comparisons. Statistical significance was defined as p < 0.05.

3.1 The effect of magnolol on weight loss in CORT-induced mice

To test the effect of CORT induction and magnolol intervention, this study measured the body weight of CORT-induced mice over 21-day period. Compared with the control group, the body weight of the CORT group was significantly reduced (F _{49, 256}= 1.640, P < 0.001) three weeks after CORT induction. Compared with CORT group, medium and high dose magnolol and the KOR antagonist nor-BNI (10 mg/kg/day) treatment could reverse CORT-induced the loss of body weight (all F _{49, 256}= 1.640, P < 0.001), moreover there was no difference between the two doses groups. In addition, administration of fluoxetine (10 mg/kg/day) also reversed CORT-induced loss of weight. But all treatments did not reverse to the CORT group weight loss (Fig. 1).

3.2 The effects of magnolol on depression-like behavior induced by CORT

To evaluated the antidepressant effect of magnolol in CORT-induced mice, this study evaluated depression-like behavior in all mice such as OFT, SPT, FST and TST. When the total distance of mice in OFT was not different (F _{7, 40}= 0.6904, P = 0.6795), the time of mice in each group staying in the central area was not different from that in the control group in OFT (F _{7, 40}= 0.1813, P = 0.9857) (Fig. 2A,B). This indicated that there was no significant anxiety-like emotion in each mice. The immobility time of CORT group in TST and FST was significantly longer than that of the other seven groups (F _{7, 40}= 0.7466 or 0.6399, P < 0.001), and medium and high doses of magnolol could reduce the increase of immobility time induced by CORT (all P < 0.001) (Fig. 2C,D). The sucrose preference scores of mice in the CORT group were significantly lower than those in the other seven groups (F _{7, 40}= 0.7734, P < 0.001), moreover the decline was restored at low, medium and high doses of magnolol and nor-BNI (10 mg/kg/day) administration (all P < 0.001) (Fig. 2E). Although the effect of medium- and high-dose magnolol group was better than that of low-dose group, which could be adjusted to the same as that of control group, there was no significant difference between medium-and high-dose group. Fluoxetine (10 mg/kg/day) also alleviated the appearance of CORT-induced depressive-like behavior. In summary, CORT induces depression-like behavior in mice, and three doses of magnolol, nor-BNI, and fluoxetine all counteract this depression-like behavior.

3.3 The effects of magnolol on DYN A and OPRK 1 in hippocampal DG in CORT-induced mice

In order to investigated the anti-depression mechanism of magnolol, this study first used western blotting and real-time quantitative PCR to explore the anti-depression mechanism of magnolol from the DYN A/KOR system in the mice hippocampal DG. Since the low-dose group did not reduce CORT-induced depression-like behavior, and there was no significant difference between the medium- and high- dose groups, we chose the medium dose as the experimental dose. There were no significant difference in KOR (OPRK 1) in the hippocampal DG of mice among all groups (F_{3, 20}= 0.4262, P = 0.2432), but the expression of DYN A in CORT group was significantly higher than that in control group (F_{3, 20}= 2.082, P = 0.0013). Magnolol medium dose group (CORT + M-50 mg/kg/d) could restore the level of DYN A in CORT-induced mice (F_{3, 20}= 2.082, P < 0.001). KOR antagonist group (CORT + nor-BNI, 10 mg/kg/d) also could restore to normal levels (Fig. 3A-C).

Then, this study explored the anti-depression mechanism of magnolol from the DYN A/KOR system in the mice hippocampal DG by real-time quantitative PCR. There was no significant difference in the expression of KOR (Oprk1) in hippocampal DG among four groups (F_{3, 20}= 0.3533, P > 0.999), but the expression of prodynorphin (Pdyn) in CORT group was significantly higher than that in control group (F_{3, 20}= 2.396, P < 0.001). The upregulated level of Pdyn induced by CORT could be decreased in the magnolol treatment (CORT + M-50 mg/kg/d) (F_{3, 20}= 2.396, P < 0.001). The KOR antagonist group (CORT + no-BNI, 10 mg/kg/d) also recovered to normal levels (Fig. 3D,E) (F_{3, 20}= 2.396, P < 0.001). In conclusion, CORT-induced abnormalities of the hippocampal DG DYN A/KOR system in mice are characterized by up-regulated expression of DYN A, which can be mitigated by medium -dose magnolol and nor-BNI.

3.4 The effects of magnolol on depression-like behavior induced by Pdyn overexpression in the ventral DG

To investigated whether the anti-depression mechanism of magnolol was related to DYN A/KOR system, we injected a virus that could upregulate Pdyn into the DG of the hippocampus of C57 mice. After the magnolol intervention, the depression-like behavior of the two groups of mice were evaluated. First, the effectiveness of the virus was verified, both the protein (T test, p < 0.001, t = 10.84) and mRNA (T test, p < 0.001, t = 5.446) levels of DYN in the hippocampal DG of the AAV-Pdyn group increased significantly (Fig. 4C-E), indicating proper expression of Pdyn carried by the AAV vector.

We next evaluated the antidepressant effect of magnolol on depression-like behavior upon Pdyn upregulation, and discovered severe depression-like behaviors after expression of AAV-Pdyn, characterized by lower sucrose preference scores in SPT (F_{3, 20}=0.5802, P < 0.001) and longer immobility time in TST (F_{3, 20}= 0.6326, P < 0.001) and FST (F_{3, 20}= 0.5904, P < 0.001) (Fig. 4, F-H). The Pdyn overexpression-induced depression was further alleviated by a medium dose of magnolol (50 mg/kg/d) (F_{3, 20}= 0.6326 or 0.5904, P < 0.001), suggesting a potential role of magnolol in inhibiting the DYN A/KOR system.

3.5 The effects on depression-like behavior induced by CORT in KOR down-regulation of ventral DG neural stem cells mice

After confirming that KOR antagonists decreased CORT-induced depression-like behaviors (Fig. 2)and found abnormal neural differentiation in CORT-induced depression mice[36–38], in order to examined the antidepression effect of the DYN A/KOR system inhibiting in hippocampal DG neural stem cells, we injected a virus that could reduce KOR in neural stem cells of ventral DG in selective kappa opioid receptor knockout mice. After the CORT induction, the depression-like behavior of the two groups of mice were evaluated. First, the effectiveness of the virus was verified, both the protein (T test, p < 0.001, t = 14.34) and mRNA (T test, p < 0.001, t = 7.527) levels of KOR in the hippocampal DG of the AAV-Nestin group decreased significantly (Fig. 5C-E), indicating proper expression of Nestin carried by the AAV vector.

We next evaluated the depression-like behavior upon KOR downregulation, and discovered severe depression-like behavior after CORT-induction in AAV-control, characterized by lower sucrose preference scores in SPT (T test, p < 0.001, t = 7.075) and longer immobility time in TST (T test, p < 0.001, t = 14.20) and FST (T test, p < 0.001, t = 20.45) (Fig. 5, F-H). These behavioral experiments suggested that down-regulation of KOR in mice hippocampal DG neural stem cells could alleviate depression-like behavior in CORT-induced mice.

As mentioned earlier, magnolol in Houpoea officinalis has numerous pharmacological effects [39–42]. Although previous studies have shown an antidepressant effect of magnolol in some models[43–45, 8, 46], the exact mechanism of magnolol on CORT-induced depression model has not been clearly elucidated. CORT-induced depression mice are a model that simulates the high levels of glucocorticoid expression in patients with clinical depression and are widely used to study the pathogenesis of depression and to screen antidepressant drugs and their mechanisms of action [47–49]. The present study aimed to investigate the antidepressant mechanism of magnolol on CORT-induced depression-like models in vivo. Our finding that magnolol administration successfully increased sucrose preference scores and decreased immobility time is consistent with the former study [46, 8] ,and the mechanism is at least partially attributed to the DYN A/KOR system in the hippocampal DG.

Although this study focuses on the effect of DYN A/KOR system in hippocampus on depression, the antidepressant effects of magnolol also involves other mechanisms. Magnolol has been found to enhance hippocampus neurogenesis and intracellular signaling related to neurotrophic factors in OBX mice [8], modulate the HPA axis, up-regulate BDNF expression, and increase hippocampus neurotransmitter levels [49]. This suggests that it is worth investigating whether magnolol regulates neurogenesis in the hippocampus. When the expression of KOR in the DG was down-regulated in the present study, this group of mice showed less depression than normal mice after CORT induction. However, how KOR regulate the occurrence of depression through regulating neurogenesis needs more experiments.

There is increasing evidence that the dynorphin/KOR system plays an important role in the pathogenesis of depression [17, 15]. Our results suggest that antagonistic KOR reduce depression-like behavior in depressed mice, which is consistent with previous studies [49, 50]. However, in our magnolol intervention experiment, we found that the DYN A was also reduced when intraperitoneal injection of KOR antagonist was performed in CORT-induced mice, and the same phenomenon was also found in CORT-induced mice after down-regulating KOR in neural stem cells of hippocampal DG. It has been reported that ERK, an important downstream of the KOR system in depression regulation, is activated in the amygdala[9]. Therefore, we hypothesized that when mice were injected with KOR antagonist, which interferes with the production of depressed-like behavior, there might be an unknown negative feedback regulation from other brain regions that decrease DYN expression.

The hippocampus is one of the most important brain structures in the pathogenesis of depression [23–25]. Although the present study focused on exploring the antidepressant mechanism of magnolol from the hippocampus, it is interesting to know whether other brain structures are involved in the antidepressant mechanism of magnolol. Several recent studies have found that magnolol can significantly enhance CMS-induced reductions in 5-HT levels in the prefrontal cortex, hippocampus, striatum, hypothalamus, and nucleus accumbens, thereby reducing the elevated CORT concentration in serum and normalising hypothalamic-pituitary-adrenal (HPA) hyperfunction in CMS rats [44]. In addition, magnolol can restore the expression of brain-derived neurotrophic factor (BDNF) in the brain of rats induced by unpredictable chronic mild stress (CUMS) [46], and inhibit changes in brain proinflammatory factor IL-1β, IL-6 and TNF-α [51], exerting antidepressant effects. This suggests that whether magnolol exerts its antidepressant effect through other brain structures related to depression and its mechanism of action also deserve further investigation and attention.

Finally, it is worth mentioning that women have a higher incidence of depression than men[52]. Moreover, a large number of studies have shown that there are sex differences in the expression of depressive behavior and the effect of antidepressants [53–56], and female and male animals seem to have different responses and sensitivity to depression [57–59]. We believe that in the future, more researchers will focus on anti-depression studies in female depressed animal models.

In short, this study investigated the antidepressant effects of magnolol on CORT-induced depression-like mice, and explored its potential mechanism of action based on the DYN A/KOR system. This study confirmed that magnolol can improve depressive behavior in CORT-induced mice, and the mechanism could be at least partially attributed to the downregulation of DYN A of hippocampal DG, thereby correcting the imbalance of the DYN A/KOR system. This results could help expand new scientific understanding of magnolol in prevention and treatment of depression, and provide preclinical experimental basis for its application.

Data Availability

The datasets used or analyzed during the current study are available from the corresponding author on reasonable request.

Acknowledgements

This work was supported by Zhejiang Provincial Natural Science Foundation of China under Grant No. LY22H270004, by National Natural Science Foundation of China under Grant No. 82030112, and by Zhejiang Chinese Medical University under Grant No. 2022FSYYZZ11. We appreciate the technical support from the Public Platform of Medical Research Center, Academy of Chinese Medical Science, Zhejiang Chinese Medical University.

Ethics declarations

Competing interest

The authors declare no competing interests.

Ethical Approval

The current study was performed with the approval of the Association for Assessment and Accreditation of Laboratory Animal Care (AAALAC). All experimental procedures were approved by the Animal Ethics Committee of Zhejiang Chinese Medical University (permission number: IACUC-20220328-09) and conducted according to the National Institute of Health Guide for the Care and Use of Laboratory Animals (NIH Publications No. 80-23).

Consent for Publication

Consent for publication was obtained from the participants.

Vandeleur CL, Fassassi S, Castelao E, Glaus J, Strippoli MF, Lasserre AM, Rudaz D, Gebreab S, et al. (2017) Prevalence and correlates of DSM-5 major depressive and related disorders in the community. Psychiatry Res 250:50–58.
Dubovsky SL, Ghosh BM, Serotte JC, Cranwell V (2021) Psychotic Depression: Diagnosis, Differential Diagnosis, and Treatment. Psychotherapy and psychosomatics 90:160–177.
Avula SK, Khan A, Halim SA, Rehman NU, Karim N, Khan I, Csuk R, Das B, et al. (2022) Synthesis and antidepressant-like effects of new 5-epi-incensole and 5-epi- incensole acetate in chronic unpredictable mild stress model of depression; behavioural and biochemical correlates. Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie 156:113960.
Zhang FH, Wang ZM, Liu YT, Huang JS, Liang S, Wu HH, Xu YT (2019) Bioactivities of serotonin transporter mediate antidepressant effects of Acorus tatarinowii Schott. Journal of ethnopharmacology 241:111967.
Huang HL, Lim SL, Lu KH, Sheen LY (2018) Antidepressant-like effects of Gan-Mai-Dazao-Tang via monoamine regulatory pathways on forced swimming test in rats. Journal of traditional and complementary medicine 8:53–59.
Jin ZL, Gao N, Zhang JR, Li XR, Chen HX, Xiong J, Li YF, Tang Y (2014) The discovery of Yuanzhi-1, a triterpenoid saponin derived from the traditional Chinese medicine, has antidepressant-like activity. Prog Neuropsychopharmacol Biol Psychiatry 53:9–14.
Cheng J, Dong S, Yi L, Geng D, Liu Q (2018) Magnolol abrogates chronic mild stress-induced depressive-like behaviors by inhibiting neuroinflammation and oxidative stress in the prefrontal cortex of mice. International immunopharmacology 59:61–67.
Matsui N, Akae H, Hirashima N, Kido Y, Tanabe S, Koseki M, Fukuyama Y, Akagi M (2016) Magnolol Enhances Hippocampal Neurogenesis and Exerts Antidepressant-Like Effects in Olfactory Bulbectomized Mice. Phytotherapy research: PTR 30:1856–1861.
Zan GY, Sun X, Wang YJ, Liu R, Wang CY, Du WJ, Guo LB, Chai JR, et al. (2022) Amygdala dynorphin/κ opioid receptor system modulates depressive-like behavior in mice following chronic social defeat stress. Acta pharmacologica Sinica 43:577–587.
Ji MJ, Gao ZQ, Yang J, Cai JH, Li KX, Wang J, Zhang H, Zhou CH, et al. (2022) Dynorphin promotes stress-induced depressive behaviors by inhibiting ventral pallidal neurons in rats. Acta physiologica (Oxford, England) 236:e13882.
Bruchas MR, Land BB, Chavkin C (2010) The dynorphin/kappa opioid system as a modulator of stress-induced and pro-addictive behaviors. Brain Res 1314:44–55.
Baird MA, Hsu TY, Wang R, Juarez B, Zweifel LS (2021) κ Opioid Receptor-Dynorphin Signaling in the Central Amygdala Regulates Conditioned Threat Discrimination and Anxiety. eNeuro 8.
Vergara F, Sardi NF, Pescador AC, Guaita GO, Jark Stern CA, Chichorro JG, Fischer L (2020) Contribution of mesolimbic dopamine and kappa opioid systems to the transition from acute to chronic pain. Neuropharmacology 178:108226.
Pirino BE, Spodnick MB, Gargiulo AT, Curtis GR, Barson JR, Karkhanis AN (2020) Kappa-opioid receptor-dependent changes in dopamine and anxiety-like or approach-avoidance behavior occur differentially across the nucleus accumbens shell rostro-caudal axis. Neuropharmacology 181:108341.
Hang A, Wang YJ, He L, Liu JG (2015) The role of the dynorphin/κ opioid receptor system in anxiety. Acta pharmacologica Sinica 36:783–790.
Missig G, Fritsch EL, Mehta N, Damon ME, Jarrell EM, Bartlett AA, Carroll FI, Carlezon WA, Jr. (2022) Blockade of kappa-opioid receptors amplifies microglia-mediated inflammatory responses. Pharmacol Biochem Behav 212:173301.
Van't Veer A, Carlezon WA, Jr. (2013) Role of kappa-opioid receptors in stress and anxiety-related behavior. Psychopharmacology (Berl) 229:435–452.
Kastenberger I, Lutsch C, Herzog H, Schwarzer C (2012) Influence of sex and genetic background on anxiety-related and stress-induced behaviour of prodynorphin-deficient mice. PLoS One 7:e34251.
Pliakas AM, Carlson RR, Neve RL, Konradi C, Nestler EJ, Carlezon WA, Jr. (2001) Altered responsiveness to cocaine and increased immobility in the forced swim test associated with elevated cAMP response element-binding protein expression in nucleus accumbens. J Neurosci 21:7397–7403.
He G, Song Q, Wang J, Xu A, Peng K, Zhu Q, Xu Y (2020) Design, synthesis and biological evaluation of N-hydroxy-aminobenzyloxyarylamide analogues as novel selective κ opioid receptor antagonists. Bioorganic & medicinal chemistry letters 30:127236.
Wang J, Song Q, Xu A, Bao Y, Xu Y, Zhu Q (2017) Design, synthesis and biological evaluation of aminobenzyloxyarylamide derivatives as selective κ opioid receptor antagonists. Eur J Med Chem 130:15–25.
Page S, Mavrikaki MM, Lintz T, Puttick D, Roberts E, Rosen H, Carroll FI, Carlezon WA, et al. (2019) Behavioral Pharmacology of Novel Kappa Opioid Receptor Antagonists in Rats. The international journal of neuropsychopharmacology 22:735–745.
Motaghi S, Moghaddam Dizaj Herik H, Sepehri G, Abbasnejad M, Esmaeli-Mahani S (2022) The anxiolytic effect of salicylic acid is mediated via the GABAergic system in the fear potentiated plus maze behavior in rats. Molecular biology reports 49:1133–1139.
Carlezon WA, Jr., Thome J, Olson VG, Lane-Ladd SB, Brodkin ES, Hiroi N, Duman RS, Neve RL, et al. (1998) Regulation of cocaine reward by CREB. Science (New York, NY) 282:2272–2275.
Levone BR, Cryan JF, O'Leary OF (2021) Specific sub-regions of the longitudinal axis of the hippocampus mediate behavioural responses to chronic psychosocial stress. Neuropharmacology 201:108843.
Bian XL, Qin C, Cai CY, Zhou Y, Tao Y, Lin YH, Wu HY, Chang L, et al. (2019) Anterior Cingulate Cortex to Ventral Hippocampus Circuit Mediates Contextual Fear Generalization. J Neurosci 39:5728–5739.
Carr GV, Lucki I (2010) Comparison of the kappa-opioid receptor antagonist DIPPA in tests of anxiety-like behavior between Wistar Kyoto and Sprague Dawley rats. Psychopharmacology (Berl) 210:295–302.
Tartt AN, Mariani MB, Hen R, Mann JJ, Boldrini M (2022) Dysregulation of adult hippocampal neuroplasticity in major depression: pathogenesis and therapeutic implications. Molecular psychiatry 27:2689–2699.
Bassett B, Subramaniyam S, Fan Y, Varney S, Pan H, Carneiro AMD, Chung CY (2021) Minocycline alleviates depression-like symptoms by rescuing decrease in neurogenesis in dorsal hippocampus via blocking microglia activation/phagocytosis. Brain, behavior, and immunity 91:519–530.
Du Preez A, Onorato D, Eiben I, Musaelyan K, Egeland M, Zunszain PA, Fernandes C, Thuret S, et al. (2021) Chronic stress followed by social isolation promotes depressive-like behaviour, alters microglial and astrocyte biology and reduces hippocampal neurogenesis in male mice. Brain, behavior, and immunity 91:24–47.
Zhang J, Rong P, Zhang L, He H, Zhou T, Fan Y, Mo L, Zhao Q, et al. (2021) IL4-driven microglia modulate stress resilience through BDNF-dependent neurogenesis. Science advances 7.
Tunc-Ozcan E, Peng CY, Zhu Y, Dunlop SR, Contractor A, Kessler JA (2019) Activating newborn neurons suppresses depression and anxiety-like behaviors. Nat Commun 10:3768.
Xu C, Fan W, Zhang Y, Loh HH, Law PY (2021) Kappa opioid receptor controls neural stem cell differentiation via a miR-7a/Pax6 dependent pathway. Stem Cells 39:600–616.
Nakazawa T, Yasuda T, Ohsawa K (2003) Metabolites of orally administered Magnolia officinalis extract in rats and man and its antidepressant-like effects in mice. The Journal of pharmacy and pharmacology 55:1583–1591.
Hill AS, Sahay A, Hen R (2015) Increasing Adult Hippocampal Neurogenesis is Sufficient to Reduce Anxiety and Depression-Like Behaviors. Neuropsychopharmacol 40:2368–2378.
Kong H, Zeng XN, Fan Y, Yuan ST, Ge S, Xie WP, Wang H, Hu G (2014) Aquaporin-4 knockout exacerbates corticosterone-induced depression by inhibiting astrocyte function and hippocampal neurogenesis. CNS neuroscience & therapeutics 20:391–402.
Zhang K, Wang F, Zhai M, He M, Hu Y, Feng L, Li Y, Yang J, et al. (2023) Hyperactive neuronal autophagy depletes BDNF and impairs adult hippocampal neurogenesis in a corticosterone-induced mouse model of depression. Theranostics 13:1059–1075.
Gao C, Wu M, Du Q, Deng J, Shen J (2022) Naringin Mediates Adult Hippocampal Neurogenesis for Antidepression via Activating CREB Signaling. Frontiers in cell and developmental biology 10:731831.
Yang J, Wei Y, Zhao T, Li X, Zhao X, Ouyang X, Zhou L, Zhan X, et al. (2022) Magnolol effectively ameliorates diabetic peripheral neuropathy in mice. Phytomedicine: international journal of phytotherapy and phytopharmacology 107:154434.
Tang Y, Wang L, Yi T, Xu J, Wang J, Qin JJ, Chen Q, Yip KM, et al. (2021) Synergistic effects of autophagy/mitophagy inhibitors and magnolol promote apoptosis and antitumor efficacy. Acta pharmaceutica Sinica B 11:3966–3982.
Peng CY, Yu CC, Huang CC, Liao YW, Hsieh PL, Chu PM, Yu CH, Lin SS (2022) Magnolol inhibits cancer stemness and IL-6/Stat3 signaling in oral carcinomas. Journal of the Formosan Medical Association = Taiwan yi zhi 121:51–57.
Li CH, Ku MC, Lee KC, Yueh PF, Hsu FT, Lin RF, Yang CC, Wang WC, et al. (2022) Magnolol Suppresses ERK/NF-κB Signaling and Triggers Apoptosis Through Extrinsic/Intrinsic Pathways in Osteosarcoma. Anticancer research 42:4403–4410.
Yang TH, Ma YB, Geng CA, Yan DX, Huang XY, Li TZ, Zhang XM, Chen JJ (2018) Synthesis and biological evaluation of magnolol derivatives as melatonergic receptor agonists with potential use in depression. Eur J Med Chem 156:381–393.
Xu Q, Yi LT, Pan Y, Wang X, Li YC, Li JM, Wang CP, Kong LD (2008) Antidepressant-like effects of the mixture of honokiol and magnolol from the barks of Magnolia officinalis in stressed rodents. Prog Neuropsychopharmacol Biol Psychiatry 32:715–725.
Tao W, Hu Y, Chen Z, Dai Y, Hu Y, Qi M (2021) Magnolol attenuates depressive-like behaviors by polarizing microglia towards the M2 phenotype through the regulation of Nrf2/HO-1/NLRP3 signaling pathway. Phytomedicine: international journal of phytotherapy and phytopharmacology 91:153692.
Li LF, Lu J, Li XM, Xu CL, Deng JM, Qu R, Ma SP (2012) Antidepressant-like effect of magnolol on BDNF up-regulation and serotonergic system activity in unpredictable chronic mild stress treated rats. Phytotherapy research: PTR 26:1189–1194.
Li H, Li J, Zhang T, Xie X, Gong J (2022) Antidepressant effect of Jujuboside A on corticosterone-induced depression in mice. Biochemical and biophysical research communications 620:56–62.
Ding H, Cui XY, Cui SY, Ye H, Hu X, Zhao HL, Liu YT, Zhang YH (2018) Depression-like behaviors induced by chronic corticosterone exposure via drinking water: Time-course analysis. Neurosci Lett 687:202–206.
Amigo J, Garro-Martinez E, Vidal Casado R, Compan V, Pilar-Cuéllar F, Pazos A, Díaz A, Castro E (2021) 5-HT(4) Receptors Are Not Involved in the Effects of Fluoxetine in the Corticosterone Model of Depression. ACS chemical neuroscience 12:2036–2044.
Wang Q, Long Y, Hang A, Zan GY, Shu XH, Wang YJ, Liu JG (2016) The anxiolytic- and antidepressant-like effects of ATPM-ET, a novel κ agonist and µ partial agonist, in mice. Psychopharmacology (Berl) 233:2411–2418.
Bai Y, Song L, Dai G, Xu M, Zhu L, Zhang W, Jing W, Ju W (2018) Antidepressant effects of magnolol in a mouse model of depression induced by chronic corticosterone injection. Steroids 135:73–78.
Shorey S, Ng ED, Wong CHJ (2022) Global prevalence of depression and elevated depressive symptoms among adolescents: A systematic review and meta-analysis. The British journal of clinical psychology 61:287–305.
Keers R, Aitchison KJ (2010) Gender differences in antidepressant drug response. International review of psychiatry (Abingdon, England) 22:485–500.
Stickel S, Wagels L, Wudarczyk O, Jaffee S, Habel U, Schneider F, Chechko N (2019) Neural correlates of depression in women across the reproductive lifespan - An fMRI review. Journal of affective disorders 246:556–570.
Sramek JJ, Murphy MF, Cutler NR (2016) Sex differences in the psychopharmacological treatment of depression. Dialogues in clinical neuroscience 18:447–457.
Schwalsberger K, Reininghaus B, Reiter A, Dalkner N, Fleischmann E, Fellendorf F, Platzer M, Reininghaus EZ (2022) Sex-Related Differences in the Pharmacological Treatment of Major Depression - Are Women and Men Treated Differently? Psychiatria Danubina 34:219–228.
Xia J, Wang H, Zhang C, Liu B, Li Y, Li K, Li P, Song C (2022) The comparison of sex differences in depression-like behaviors and neuroinflammatory changes in a rat model of depression induced by chronic stress. Frontiers in behavioral neuroscience 16:1059594.
Dai W, Yang M, Xia P, Xiao C, Huang S, Zhang Z, Cheng X, Li W, et al. (2022) A functional role of meningeal lymphatics in sex difference of stress susceptibility in mice. Nat Commun 13:4825.
Franceschelli A, Herchick S, Thelen C, Papadopoulou-Daifoti Z, Pitychoutis PM (2014) Sex differences in the chronic mild stress model of depression. Behav Pharmacol 25:372–383.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

The Antidepressant Effect of Magnolol on Depression-like Behavior of CORT-induced Depression Mice

Status:

Version 1

Abstract

Figures

1. Introduction

2. Materials and methods

2.1 Animals

2.2 Materials

2.3 CORT-induced depression model

2.4 Behavioral tests

2.4.1 Sucrose preference test (SPT)

2.4.2 Open field test (OFT)

2.4.3 Tail suspension test (TST)

2.4.4 Forced swimming test (FST)

2.5 Stereotaxic injection into the brain

2.6 Tissue preparation

2.7 Western-blot assay

2.8 Primers for quantitative real-time PCR

2.9 Statistical analysis

3. Results

3.1 The effect of magnolol on weight loss in CORT-induced mice

3.2 The effects of magnolol on depression-like behavior induced by CORT

3.4 The effects of magnolol on depression-like behavior induced by Pdyn overexpression in the ventral DG

4. Discussion

5. Conclusion

Declarations

References

Additional Declarations

Status:

Version 1