Adult longhorn beetles (Cerambycidae latreille) collected from a forest in Ilasa Ekiti, Ekiti State, Nigeria were verified by the Department of Crop Soil and Pest Management at the Federal University of Technology, Akure, Nigeria. Before the experiment, the insects were acclimatized to the laboratory environment and provided with wood shavings for food.
2.1.1 Chemicals/Reagents
Chemicals, including dinitro-salicylic acid (DNSA), diethylaminoethyl sephacel, bovine serum albumin (BSA), DEAE Sephacel, and Sephacryl S-200 were obtained from Sigma-Aldrich CHEMIE GmbH, and other chemicals were of analytical grade.
2.1.2 Equipment
In this study, various instruments and materials were utilized, such as a refrigerated centrifuge, UV-visible spectrophotometer (Axiom 721 Vis spectrophotometer UK), pressure steam sterilizer (Model YX-18LM), water bath shaker (WHY-2), pH meter (Philips India), water bath (HH-W420 thermostatic water cabinet), analytical and top loading balance (OHAUS Corporation), and glassware, spatulas, inoculating loop, and microliter pipettes.
2.1.3 Organism Source
The Enzymology Laboratory in the Biochemistry Department of the Federal University of Technology, Akure, provided a strain of Aspergillus awamori AFE1 isolated from a longhorn beetle (Cerambycidae latreille), which was confirmed to be pure.
2.2 METHODOLOGY
2.2.1 Fungus Preparation
Aspergillus awamori AFE1 was propagated by subculturing on a petri dish supplemented with Potato Dextrose Agar (PDA). The fungus was then suspended in potato dextrose broth (PDB) to obtain a seed culture. To activate the organism before inoculation, it was incubated in an orbital shaker for 72 h at a rotational speed of 125 revolutions per minute (rpm).
2.2.2 Cellulolytic Ability of Aspergillus awamori AFE1
The cellulolytic activity was screened using the method of Teather and Wood (1982) in a sterile medium containing carboxymethyl cellulose (CMC) agar, NaCl 6.0 g/l, K2HPO4 0.5 g/l, KH2PO4 0.5 g/l, (NH4)2SO4 1.0 g/l, Cacl2 0.1 g/l, MgSO4 0.1 g/l, CMC 10.0 g/l, agar-agar 2.0 g/l and the medium was sterilized. The sterile medium was inoculated with the pure strain of Aspergillus awamori AFE1 in a sterile petri-dish and was incubated for 72 h. Subsequently, a generous amount of 1% Congo red dye was applied to the plate and carefully rinsed with an excess of 1 M NaCl solution for a duration of 15 mins. This procedure was conducted to quantify cellulolytic activity by assessing the hydrolysis zone.
2.2.3. Molecular Analysis of the Isolate
The cellulose-degrading isolate was cultivated in general fungal medium at 28 °C for 24 h.
The PCR cocktail mix consists of 2.5ul of 10 × PCR buffer, 1 µL of 25 mM MgCl2, 1 µL each of forward primer (ITS4 TCCTCCGCTTATTGATATGS) and reverse primer (ITS5 GGAAGTAAAAGTCGTAACAAGG), 1 µL of DMSO, 2ul of 2.5 mM DNTPs, 0.1 µL of 5u/ µL Taq DNA polymerase, and 3ul of 10 ng/µL DNA. Using nuclear-free water, the total reaction volume was further increased to 25ul using 13.4 µL. A 5 min initial denaturation at 94 °C was followed by 36 cycles of denaturation at 94 °C for 30sec, 54 °C for 30sec annealing, and elongation at 72 °C for 45sec elongation. Subsequently, the temperature was maintained at 10 °C indefinitely after a final elongation step that lasted 7 min at 72 °C. Amplified fragments were observed on 1.5% agarose electrophoresis gels stained with Safe View. Sequencing was performed using a 3130 XL Genetic Analyzer from Applied Biosystems GeneAmp PCR system 9700 thermal cycler. Using the BLASTN program, the sequences were opened in BioEdit and compared with the gene sequences found in GenBank. (http://blast.ncbi.nlm.nih.gov/Blast.cgi).
2.2.4. Phylogenetic Analysis
2.2.4.1. Evolutionary Relationships of Taxa
The neighbor-joining approach is contingent on evolutionary history (Saitou and Nei 1987). A bootstrap consensus tree derived from 1000 replications was used to accurately depict the evolutionary history of the taxa under investigation (Felsenstein 1985). Branch collapse transpires when partitions are replicated in less than 50% of the bootstrap replicates. The branches within the bootstrap test (1000 replicates) indicate the percentage of duplicated trees in which the associated taxa were clustered (Felsenstein 1985). In the present study, Tamura and Nei. (1993) method was utilized to compute evolutionary distances, which were quantified as the number of base substitutions per site. A total of 21 nucleotide sequences were included in the analysis. Any position in the dataset exhibiting more than 5% of alignment gaps, missing data, or ambiguous bases was excluded. Additionally, positions with less than 95% site coverage were retained using the partial deletion option. MEGA X software was employed to conduct evolutionary analyses on the resulting dataset, which comprised 501 locations (Kumar et al. 2018).
To obtain accession codes, DNA sequences of the fungal strains were deposited in the GenBank database.
2.3. Optimization Parameters for Cellulase Production
2.3.1 Influence of pH
Minimal salt medium was used for fermentation of Aspergillus awamori AFE1 at varying pH levels during cellulase production. Each broth was sterilized after the pH was changed using citrate buffer (4.0 and 5.0), phosphate buffer (6.0, 7.0), and Tris/HCl (8.0, 9.0, and 10). The fungus was added to a sterile medium, and the mixture was placed in an orbital shaker at a temperature of 30 °C and a speed of 125 rpm for a period of 7 days. Every 24 h, 5 ml of the mixture was aseptically removed for enzyme measurements.
2.3.2 Influence of Temperature
Cellulase production was carried out using minimal salt medium across varying temperature ranges. The medium was sterilized and inoculated with the fungal strain Aspergillus awamori AFE1. The culture medium was placed in an orbital shaker and incubated at 27, 30, and 35 °C in separate flasks for 7 days. At the interval of 24 hr, five (5) ml were aseptically withdrawn for enzyme assays.
2.3.3. Influence of Carbon Sources
The following carbon sources were investigated: lactose, fructose, maltose, sucrose, starch, glucose, and carboxymethylcellulose (CMC) in minimal salt using CMC as the control. After sterilization and cooling, each basal medium was inoculated with the fungus. The medium was incubated in an orbital shaker at 30 °C for 7 days at 125 rpm. Every 24 h, 5 ml of the mixture was aseptically removed for enzyme measurements.
2.3.4. Influence of Nitrogen Sources
Using NaNO3 as a control, the effects of nitrogen sources, such as peptone, (NH4)2SO4, and casein, on the optimization of cellulase were investigated. Each basal medium was prepared with different nitrogen sources, sterilized, cooled, and then inoculated with Aspergillus awamori AFE1 culture. Using an orbital shaker, they were incubated at 30 °C for 7 days at 125 rpm. At the interval of 24 h, five (5) ml were aseptically withdrawn for enzyme assays.
2.3.5. Influence of Agricultural Residues
Different substrates were examined to identify suitable agro-based wastes for cellulase production. The agricultural residues investigated in this optimization stage included sugarcane bagasse, locust beans,wheat bran, soya beans, corn stick, millet bran, cassava peel, rice bran, and CMC was used as the control. Various sources of agricultural residue have been utilized to prepare distinct basal media. Following sterilization and cooling, each medium was inoculated with A. awamori AFE1. Each flask was incubated in an orbital shaker at 30 °C for 7 days at 125 rpm. Every 24 h, 5 ml of the mixture was aseptically removed for enzyme measurements.
2.4. Cellulase production from Aspergillus awamori AFE1
The basal medium for cellulase production was prepared according to the method of Mekala et al. (2008), with some modifications. The best parameters from the optimization stage were incorporated in the preparation of the minimal salt medium containing NaNO3 3 g, NaHPO4 1 g, FeSO4 0.002 g, MgSO4 0.1 g, KCL 0.5 g, and CMC 10 g. The broth medium (1000 ml, pH 5) was divided equally into five (500 ml) conical flasks and autoclaved for 1 h 15 min. Each conical flask containing the broth medium received five milliliters (5 ml) of the seed culture of Aspergillus awamori AFE1. The medium was incubated at 30 °C for seven days and agitated at a rate of 125 rpm using an orbital shaker. The culture broths were combined and centrifuged in a cold centrifuge for 20 min at 15,000 × g. Following centrifugation, the resulting supernatant was obtained and preserved as a crude enzyme for subsequent purification and characterization.
2.4.1 Determination of Cellulase Activity
Mandels (1985) method was used to conduct cellulase experiments. A test tube was filled with half a milliliter (0.5) of 1% CMC in 0.1M citrate buffer (pH 4.8) and 0.5 ml of the enzyme solution. After 30 min of incubation at 50 °C, the reaction mixture was terminated by adding 1.5 ml of the 3,5-dinitrosalicylic acid (DNSA) reagent. The test tubes were subjected to heating in a boiling water bath for a duration of five minutes at a temperature of 100 °C, followed by cooling to reach room temperature. The absorbance was measured at a wavelength of 540 nm. A blank was prepared, which did not contain the enzyme, but was treated in the same manner as the test tubes containing the samples. The enzyme activity is expressed in International Units (U), representing the release of 0.05 mg/ml of glucose per minute of enzyme solution.
2.4.2 Determination of Protein Concentration
The protein concentration was regularly assessed using the bovine serum albumin standard following the Braford (1976) technique, and the absorbance was recorded at a wavelength of 595 nm using a spectrophotometer.
2.4.3 Purification of Enzymes
Garchow et al. (2006)method with modifications, was used to purify the crude cellulase.
2.4.4 Ammonium Sulphate Precipitation
The crude enzyme was subjected to gradual addition and continuously stirred with 80% solid ammonium sulfate (426.26 g) to achieve saturation at a temperature of 4 °C. The mixture was allowed to stand overnight to enable precipitation of proteins as pellets. The resultant solution was centrifuged at 6000 rpm for 20 min. The obtained pellet was dissolved in 10 mL of pH 4.8 0.1 M citrate buffer and dialyzed for 96 hours with pH 5.5 of 0.02 M citrate buffer, with four buffer changes. To eliminate particles, the dialysate was subjected to centrifugation at 4°C at a force of 10,000 g for a duration of 10 mins.
2.4.5 Ion Exchange Chromatography
The dialysate was loaded onto a DEAE-Sephacel column (1.25 × 15 cm) with a flow rate of 62.5 mL per hr. Before applying the protein sample, the resin column was prepared by equilibrating it with citrate buffer at a pH of 5.5, with a concentration of 2 mM. The starting buffer was employed as the eluent to remove unbound proteins from the column. Subsequently, a linear gradient consisting of 1.0 M NaCl in 20 mM citrate buffer pH 5.5 was used to elute the bound protein. The protein content in the eluent was quantified by measuring absorbance at a wavelength of 280 nm. Furthermore, the cellulase activity of the fractions demonstrating protein presence was assessed using a designated cellulase assay protocol. Fractions exhibiting cellulase activity were combined and concentrated.
2.4.6 Gel Filtration Chromatography
A properly packed gel-filtration column (2.5 x 70 cm) containing Sephadex G-100 was initially prepared by equilibrating it with a 20 mM citrate buffer at pH 5.5. Subsequently, the concentrated eluate obtained from the ion-exchange chromatography was loaded onto the column. The eluted fractions were collected at a flow rate of 25 mL/h. The protein concentration in each fraction was assessed at a wavelength of 280 nm and cellulase activity was determined according to the established standard protocol. Fractions demonstrating cellulase activity were combined and subjected to different concentrations.
2.4.7 Enzyme Molecular Weight
The determination of the molecular weight of the purified enzyme was determined following the method described by Laemmli (1970), utilizing SDS-PAGE with a 10% gel. Standard protein markers were used for comparison, and the protein bands were visualized by staining with Coomassie brilliant blue dye.
2.5. Physicochemical Properties of the Purified Enzyme
2.5.1 The Effect of pH on the Activity
The effect of pH on the activity of cellulase derived from Aspergillus awamori AFE1 was explored using different buffer systems. These included 0.1 M glycine/HCl, citrate buffers at pH 4.0 and 5.0, phosphate buffers at pH 6.0 and 7.0, and Tris/HCl buffers at pH 8.0, 9.0, and 10. Cellulase activity in each pH medium was assessed using a standard cellulase assay technique.
2.5.2 The Effect of Temperature on the Activity
The optimal temperature for the purified cellulase obtained from Aspergillus awamori AFE1 was determined by subjecting the reaction mixture to a range of temperatures between 25 and 90 °C at 10 °C intervals. Enzyme assays were conducted according to the standard procedure for assessing cellulase activity.
2.5.3 The Thermal Stability
To evaluate the thermal stability of the purified cellulase, it was pre-incubated with citrate buffer (pH 5.5) for a duration of 2 h at temperatures ranging from 30 to 70 °C at intervals of 10 °C. The enzyme solution was initially sampled at 0 min and subsequently at 20-min intervals for 2 h. Cellulase activity was assessed using a standard assay procedure, and the remaining activity was calculated relative to the initial activity observed at 0 min.
2.5.4 The Effect of pH on the Stability
The impact of pH on the stability of purified cellulase was assessed by employing buffers with pH values spanning from 3.0 to 10.0. These included using 20 mM glycine/HCl buffer at pH 3.0, citrate buffers at pH 4.0, and 5.0, phosphate buffers at pH 6.0, and 7.0, and Tris/HCl buffers within the pH range of 8.0 to 10.0. The enzyme aliquot was pre-incubated with each designated buffer during the experiment. The enzyme solution was then sampled initially at 0 h and subsequently at 1-hour intervals for a total duration of 6 h. The cellulase activity was determined following the standard assay procedure, and the remaining activity was assessed relative to the initial activity observed at 0 h.
2.5.5 The Effect of Different Metal Ions on the Activity
The effects of various metal ions, including Zn2+, Cu2+, Mn2+, Fe2+, K+, and Na+, on the activity of the purified enzyme were examined. Different concentrations of these metal ions (5, 10, and 20 mM) were used in the investigation. After incubation of each metal ion, as previously specified, with the enzyme and substrate solutions in acetate buffer at pH 5.5, enzyme activity was evaluated using the standard assay procedure.
2.5.6 The Effect of Different Inhibitors and Activators
To evaluate the effect of different inhibitors, specifically EDTA, ascorbic acid, and urea, on the activity of the purified enzyme, concentrations of 5, 10, and 20 mM were used. Each inhibitor was incubated with enzyme and substrate solutions in acetate buffer at pH 5.5. Subsequently, enzyme activity was measured following the standard assay procedure.
2.5.7 The Effect of Organic Solvents on Cellulase Stability
The impact of various organic solvents at a concentration of 30% (v/v) on the stability of cellulases A and B was investigated over a duration of 6 h, with measurements taken at 1-hour intervals. This assay was performed according to the method described by Gaur and Tiwari (2015). The organic solvents used were isopropanol, Methanol, Toluene, n-butanol, n-hexane, Benzene, and Ethanol. The purified enzyme was subjected to pre-incubation with each solvent at a concentration of 30% (v/v). At the start of the experiment and subsequently at 1-hour intervals for a total of 5 h, the enzyme aliquot (0.5 mL) was withdrawn. Enzyme assays were performed using a standard method for activity assessment.
2.6. Measurement of Kinetic Constant
The kinetic parameters of the purified enzyme, including Km and Vmax, were determined by manipulating the concentration of the substrate (carboxymethyl cellulose) within the range of 5-25 mM. These variations were carried out in 0.1 M citrate buffer with a pH of 5.5. Enzyme activity, specifically the initial velocity, was assessed using the standard assay method. Subsequently, a Lineweaver-Burk plot was constructed using the inverse of the velocities (V-1) and the reciprocal of the substrate concentrations ([S]-1). The Km and Vmax values were determined by extrapolating the Lineweaver-Burk plot.