Resveratrol and Quercetin Protect From Benzo(a)pyrene-induced Autophagy in Retinal Pigment Epithelial Cells

doi:10.21203/rs.3.rs-3081540/v1

Download PDF

Research Article

Resveratrol and Quercetin Protect From Benzo(a)pyrene-induced Autophagy in Retinal Pigment Epithelial Cells

https://doi.org/10.21203/rs.3.rs-3081540/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Purpose

This study aims to investigate the role of Resveratrol (RES) and Quercetin (QR) treatments against Benzo(a)pyrene (B(a)p)-induced autophagy in retinal pigment epithelial cells.

Methods

The IC50 doses of B(a)p,RES and QR in retinal pigment epithelial cells were determined by MTT assay and the relevant agents were administered singly or in combinations to ARPE-19 cells for 24 hours. Occurrence of autophagy in the cells was verified by detection of autophagosomes under fluorescence microscope. Also, the mRNA expression levels of LC3 and Beclin 1 genes were analyzed by RT-PCR to collect further data on autophagy. Caspase-3 and IL-1β levels in lysed cells were analyzed by ELISA.

Results

Autophagosomes were detected in B(a)p-treated ARPE-19 cell lines, as well as a 1.787-fold increase in LC3 mRNA expression levels. No autophagosome occurred in RES and QR treatments, and a significant decrease in theirpercentage amounts were observed in B(a)p + RES and B(a)p + QR. The mRNA expression levels of LC3 and Beclin 1 also supported these findings.B(a)p had no effect on Caspase-3 levels in ARPE-19 cells, but combined with RES and QR, it increased Caspase-3 levels significantly.IL-1β levels were higher in B(a)p, B(a)p + QR, B(a)p + RES, RES and QR than control group. This rise in IL-1β levels was correlated with suppression of mRNA expression levels of Beclin 1.

Conclusion

B(a)p exposure caused autophagy in ARPE-19 cells, but did not induce apoptosis. RES and QR treatmentsprevented B(a)p-induced autophagy. Therefore, RES and QR treatments showedprotective effect against potential degenerative diseases caused by chronic exposure to B(a)p.

Apoptosis

ARPE-19

autophagy

benzo(a)pyrene

retinal pigment epithelium

The retinal pigment epithelium (RPE) is a fundamental component of the retina and plays an essential role in visual functions. Possible damages to the structure and dysfunctioning of the RPE can lead to various types of retinopathies, and currently there is no satisfactory treatment for these diseases. Therefore, studying the relationship between the development, function and pathobiology of the RPE is crucial for the prevention and treatment of retinopathies.The RPE isa monolayerformation of regular polygonal cells arranged atthe outermost layer of the retina. The outer side ofthe RPE rests on Bruch’s membrane and the choroid, while the inner side of it is attached to the outer segment of the photoreceptor cells. The basement membrane is closely connected to the basal folds by semi-desmosomes located in the innermost layer of Bruch’s membrane. There aremicrovilli structures extending between the outer photoreceptor segments (POS) inside the RPE cells, which are involved in phagocytic function of the RPE [1, 2].

Age-related macular degeneration (AMD) is the most common cause of irreversible loss of central vision in elderly people in developed countries.The most important, yet non-modifiable risk factor for AMD is age followed by genetic predisposition [3]. Considering the modifiable risk factors, antioxidant-poor diet or low plasma concentrations may be associated with AMD [3]. Although the protective effect of direct vitamin interventions remainsunclear, dietary and micronutrient supplementation is becoming more widely recognized as a preventive intervention [4]. Obesity, a diet with too much fat, alcohol consumption, and smoking all elevate the risk of AMD [3]. The administration of intravitreal antivascular endothelial growth factor (VEGF) has increased in the treatment of AMD in recent years.This expensive treatment modality only provides partial clinical benefit to a subset of patients; at best, it slows the progression of the disease but does not recover lost vision. Hence, efforts should be directed toward identifying modifiable risk factors for AMD.

The retinal pigment epithelium cells are exposed to chronic oxidative stress, they continuously absorb the light energy and are subjected to phagocytosis of the lipid-rich scattered ends of the photoreceptor outer layers involved in the physiological visual cycle. Oxidative stress refers to progressive cellular damage that contributes to protein misfolding and functional abnormalities in RPE cells during cellular ageing [5, 6]. RPE cell degeneration and cell death have a secondary negative effect on the neural retina, resulting in vision loss. In the absence of an effective preventive cure for AMD, the number of patients who are severely disabled by the disease is expected to nearly triple over the next few decades. Interestingly, the Age-Related Eye Disease Study found that nutritional factors may help to prevent the development of AMD [7].

Tobacco use is a major risk factor for many chronic diseases, particularly respiratory and cardiovascular diseases [8]. Researchers have reported that tobacco users have more eye diseases than nonsmokers [9, 10]. Numerous studies in the literature show that tobacco use increases the risk of AMD development [11, 12]. Tobacco use has been linked to early-onset age-related maculopathy in some studies [7, 13]. It was emphasized in a population-based study that it is a direct indicator of AMD [14]. A recent systematic case-control study concluded that tobacco use is an important risk factor for AMD; in that study, tobacco users had a 2- to 3-fold increased risk of AMD development compared to non-smokers over a 13-year period [15]. Benzo(a)pyrene (BaP) is only one of the toxic components of cigarette smoke [16].

Because of their antioxidant properties, resveratrol and quercetin compounds are abundant in vitamin preparations used for the treatment of dry AMD. Resveratrol (RES) is the most well-known polyphenolic compound with the structure 3,4¹,5 trihydroxy-trans-stilbene, which can be found in grapes, blueberries, peanuts, rhubarb, and other plants [17]. It has been reported that RES protects against PM-induced autophagy in the lungs, doxorubicin-induced autophagy in cardiomyocytes,and autophagy induced by inhibition of mammalian S6 kinase, as well as prevents autophagy formation [18–20]. Quercetin (QR) is a flavonoid found in foods that is particularly abundant in onions [21]. QR has previously been reported to have protective properties against autophagy caused by M2 tumor-associated macrophages [22]. Also, QR has been shown to suppress autophagy and promote apoptosis to prevent the formation of neutrophil extracellular traps and neutrophil activitiesaccording to the experiments in rats with rheumatoid arthritis [23].

This study aimed to evaluate the effect of RES and QR onBaP-treated ARPE-19 cells by assessing the occurrence of both autophagy and apoptosis.

Cell Culture

The ARPE-19 retinal pigmented epithelium cell line (purchased from American Type Culture Collection - CRL-2302, Manassas, VA, USA) was cultured in Dulbecco’s Modified Eagle’s Medium (DMEM) containing 10% fetal bovine serum (FBS), 5% L-Glutamine and 1% penicillin-streptomycin. The cells were maintained at 37°C a humidified incubator with 5% CO₂ and 100% humidity.

MTT cell viability test and experimental groups

Cells were seeded in 96- well plates with 10.000 cells per well. The cells were treated with different concentrations (1 µM, 10 nM, 50 µM, 100 µM, 250 µM, 500 µM ve 1000 µM) of B(a)p(Sigma-Aldrich, Germany), RES (Molekula, Cambridge, UK) and QR (Cayman Chemical Company, Tallinn, Estonia)for 24h. Then 10 µl MTT solution (5mg/ml, SERVA Electrophoresis GmbH, Heidelberg, Germany) was added to each well and incubated for 4 h at 37°C, with %5 CO₂. Next, 100 µL dimethyl sulfoxide (DMSO) was added to each well to the absorbance of each well was measured at 570 nm using an automated reader (Epoch, Biotek, USA). The IC50 values were calculated for B(a)p, RES and QR by the GraphPad Prism version 8.0.1 (GraphPad Software, Inc., CA, USA). After the determination of IC50 values, the IC50 doses for B(a)p, RES and QR were treated in the cells separately and together. Accordingly, six study groups were considered as follows: 1) control group, 2) B(a)p group, 3) RES group, 4) QR group, 5) B(a)p and RES(B(a)p + RES)combination group and6) B(a)p and QR (B(a)p + QR) group. Each assay was performed in triplicate.

Autophagy assay

Autophagy assay was performed by using autophagy assay kit (MAK138, Sigma Aldrich).Cells were seeded at a density of 10⁴ cells/well in 6-well plates containing a glass slide, and incubated for 24 hours. Then, cells attached to the substrate were exposed to the agents for 24 hours. At the end of incubation period, the culture medium from each well was removed and 100 L of autophagosome detection reagent was added to each well, and incubated for 45 minutes at 37 C with 5% CO₂. The cells were then washed three times with wash buffer and 10 randomly selected fields were photographed using a microscope camera (Zeis, Axiocam 506 mono) on a fluorescence microscope (Zeis, Axio Observed Z1) with a DAPI channel. ImageJ photo analysis software was used to determine the fluorescence intensity in the photographs. B(a)p-induced autophagy was presumed to be 100% and the rate at which RES and QR combinations changed this rate was calculated.

Total protein analyses from cell lysates

The cells were washed twice with PBS and then were harvested using lysis buffer containing protease inhibitor cocktail (Roche Complete, Indianapolis, USA). The lysates were centrifuged at 16.000 g at 4˚C for 15 min. The protein concentration collected from the supernatant were determined by BCA method (TaKaRa, Shiga, Japan)

ELISAtest

The cells were treated with the agents for 24 hours incubation, then the Caspase 3 and IL-1β levels were measured in the extracted protein from the cell lysate according to the manufacturer’s instructions by Caspase 3 and IL-1β ELISA kit (BT-LAB, Shanghai, China). The results were expressed as pg/mg protein.

Total RNA Extraction, Reverse Transcription, and Quantitative PCR

The cells were collected and washed with PBS after completion of incubations for 24 h. The total RNA for mRNA expression level was isolated by GeneJET RNA Purification Kit (Thermo Scientific Catalog No: K0731). Quantification and purity of isolated RNAs were analyzed using the Epoch Take3 plate system (Agilent, USA).Then,complementary DNA (cDNA) Synthesis kit (Biorad Cat No: BR1708891) was generated with according to manufacturer’s instructions. Shortly, 1 µg of total RNA was used as template in the PCR reaction, which was performed with reverse transcriptase (RT).Then, 1µl of cDNA of each sample was taken and appropriate amounts of SYBR green PCR Master Mix, forward and reverse primer were added according to the protocols. Expression levels of the target genes were normalized to the housekeeping gene GAPDH. Gene expression values were then calculated based on the ΔΔCt method using the equation: RQ = 2^−ΔΔCt by REST2009 program. The primer sequences used in PCR reactions and PCR conditions are described in Table 1. Each assay was performed in four replicate.

Table 1

Oligonucleotide Primer Sequences and PCR Programs
Genes	Primer sequences (5' → 3')	RT-PCR Programs	Cycle
GAPDH	F-5’ GATTTGGTCGTATTGGGCGC 3’ R-5’AGTGATGGCATGGACTGTGG 3’	95˚C-30s/59˚C-1m/72˚C-30s	35
LC3	F-5’ CAGCATGGTGAGTGTGTCCA 3’ R-5’ GCAGAGGGACAATGACCACA 3’	95˚C-30s/57˚C-1m/72˚C-30s	35
Beclin 1	F-5’ CTCTCGCAGATTCATCCCCC 3’ R-5’ TGGGCATAACGCATCTGGTT 3’	95˚C-30s/59˚C-1m/72˚C-30s	35

Statistical analysis

The data were analyzed by SPSS statistical software version 20.0. The conformity of variables to normal distribution was tested with theKolmogorov-Smirnov test. The descriptive statistics of variables were expressed as mean ± standard deviation for normal distributions. The presence of a statistically significant study groups were examined with the one-way ANOVA for parametric. The comparison of groups for parametric was used Tukey’s Multiple Comparisons test. P < 0.05 was considered the threshold of statistical significance level.

IC50 values of B(a)p, RES and QR were 179,6 µM and 198,6 µM and 349 µM for 24 hours treatment respectively (Fig. 1). No autophagic signal was detected in Control, RES and QR groups. RES reduced the autophagic fluorescence intensity to an average of 40.2%, and QR reduced it to an average of 71.81% (Table 2, Figs. 2 and 3).

Table 2

Comparison of Caspase-3, IL-1β and % autophagy data between groups
Groups	Caspase 3	IL-1β	% Autophagy
Control	0,4552 ± 0,01551^a	17,93 ± 2,636^a	Not detected
B(a)p	0,4491 ± 0,02161^a	49,56 ± 1,375^b	100^a
RES	0,5600 ± 0,1612^a	77,94 ± 7,114^c	Not detected
QR	0,7302 ± 0,07756^a	85,20 ± 0,659^c	Not detected
B(a)p + RES	0,8550 ± 0,1262^b	61,33 ± 7,095^b	71,81 ± 21,07^c
B(a)p + QR	0,9878 ± 0,1765^b	57,35 ± 6,192^b	40,20 ± 12,59^b
B(a)p: Benzo(a)pren, RES: Resveratrol, QR: Quercetin, B(a)p + R: Benzo(a)prene + Resveratrol, B(a)p + Q: Benzo(a)prene + Quercetin. Not detected: No fluorescence intensity was detected. There is statistical significance between different superscripts. p < 0.05 was considered statistically significant.

Caspase-3 levels were found to be comparable in the control, B(a)p, RES and QR groups, while higher in the B(a)p + RES and B(a)p + QR groups. B(a)p exposure elevated IL-1β levels compared to the control group. As a result of RES and QR treatments, IL-1β levels were found to be higher than those of the other groups. IL-1β levels were lower in the B(a)p + RES and B(a)p + QR groups compared to RES and QR groups, higher compared to control group and higher compared to B(a)p group, although this elevation was not statistically significant (Table 2 and Fig. 4).

B(a)p increased mRNA expression levels of LC3 as 1.787-fold in comparison to the control group, whereas the combination of B(a)p with RES and QR lowered mRNA expression levels of LC3 to the control level. mRNA expression levels of Beclin 1 were lowered 0.269-fold and 0.463-fold in the QR and B(a)p + RES groups, respectively, compared to the control group, whereas they were comparable in the B(a)p, RES, and B(a)p + QR groups (Table 3).

Table 3

Comparision of mRNA Expression Levels of Genes
Groups	LC3				Beclin 1
Groups	Gene expression		P value	Up/down regulation	Gene expression			P value	Up/down regulation
B(a)p	1,787	0,011		UP	0,835		0,634		NS
RES	0,412	0,005		DOWN	0,648	0,053			NS
QR	0,372	0,007		DOWN	0,269	0,009			DOWN
B(a)p + RES	1,193	0,057		NS	0,463	0,022			DOWN
B(a)p + QR	1,159	0,061		NS	1,14	0,071			NS
NS: Non statistical (p > 0,05), UP: fold increase, DOWN: fold decrease, p < 0.05 was considered statistically significant. All expression levels were compared to the control group

Previous literature hasreported the association between tobacco use and AMD [24, 25]. In the light of this information, experimental AMD was induced in ARPE-19 cells by giving B(a)p found in cigarette smoke in this work. Also,these ARPE-19 cells were treated with RES and QR, and the results were observed. Higher levels of autophagy have been observed in diseased RPE than those of normal cells. The impaired autophagy function of the diseased donor RPE was also demonstrated by the measurement of the autophagy markers LC3-II/LC3-I ratio [26]. These findings suggest a potential pathogenic mechanism for all degenerative diseases of the retina through aberrant apoptosis and autophagy, thus providing new targets for novel therapeutic strategies because the RPE is exposed to light over a prolonged period of time, it has a plentiful oxygen supply and consequently produces huge amount of reactive oxygen.Furthermore, increased systemic glucose levels, such as those found in diabetic patients, could facilitate an excessive accumulation of reactive oxygen species [27, 28]. Antioxidant levels in cells are reduced in degenerative retinopathy. Many studies on retinal epithelium damage caused by oxidative stress and inflammation have been conducted, and recent studieshave shown that redox-sensitive microRNA (miR) play a significant role in the regulation of antioxidant signaling pathways in human and rat RPEs [29]. RPE cell damage is caused by oxidative stress and inflammation, which leads to retinal dysfunction and even blindness.

Resveratrol has been employed in studies to grasp the potential value of the molecule as a preventive or curative treatment in AMD to understand whether it protects RPE cells from oxidation due to its recognized antioxidant action. In 2010, Sheu et al. [30] analyzed the toxic effects of acrolein, a powerful oxidant molecule. They reported that resveratrol had beneficial effects on RPE cells at relatively low concentrations (10 uM), including abrogation of acrolein-induced phagocytosis inhibition and protection against the toxicity of an acrolein/H₂O₂ cocktail.

In addition, Pintea et al. [31] reported that polyphenols exert protect effects against cytotoxicity induced by hydrogen peroxide in RPE cells. Under both normal and oxidative stress circumstances, resveratrol elevated the level of reduced glutathione, an antioxidant molecule naturally synthesized by cells. Besides, resveratrol inhibited the production of reactive oxygen species (ROS) by RPE cells

Previous studies have reported that QRS is an excellent antioxidant with anti-inflammatory, anti-proliferative, and in vitro gene expression modification properties [32]. QRS has also been demonstrated to protect the RPE from oxidative damage in vitro [33–35].

Zhuang et al. reported that QRS can inhibit choroidal neovascular membrane formation both in vivo and in vitro and may be useful for delaying the progression of AMD. They reported QRS as a promising candidate for the treatment of AMD.

These previous studies, however, did not explain the biochemical mechanisms by which QRS and RS exert their beneficial effects. In the present study, experimental AMD was induced by exposing ARPE-19 cells to B(a)p found in cigarette smoke. The cells were also treated with QRS and RS. Thus, it was demonstrated in this work how these molecules act at the biochemical level in B(a)p-induced AMD.

Many significant studies have been published regarding the fact that Caspase-3 activation protects the cell from autophagy and leads to apoptosis. The analysis of these studiesshow thatCaspase-3 exert its anti-autophagic impact through autophagy-related protein 5 (ATG5), Beclin 1 cleavage, and Autophagy/beclin-1 regulator 1 (AMBRA1) [36–40].

Beclin 1, a key regulatory protein of autophagic pathway, interacts with apoptotic cell death pathway regulatory proteins and plays a significant role in its regulation [41]. Downregulation of Beclin 1 reveals an anti-autophagic impact and opens the way to apoptotic process [42]. In this study, Beclin 1 mRNA expression levels in the B(a)p group were found to be similar to the control group and downregulated in the RES and QR treatment groups. In this sense, it was found to be consistent with the literature data.

As the stress exposure exceeds the threshold value or becomes chronic (e.g. stress caused by a toxic compound), the behavior of the cell becomes tumorigenic and the tumor cell starts to use autophagy as a tumor survival mechanism to meet its exaggerated cellular requirements. The cell thus acquires the building block materials required due to the aggressive proliferation response from the organelles destroyed by autophagic degradation, while also protecting itself againstapoptosis [41]. In the study, B(a)p, which was utilized as a stressor in this study, was found to cause severe autophagy. It is supported by the literature data that if this effect of B(a)p becomes chronic, it may induce degenerative disordersin the eye. It was observed that RES and QR treatments against autophagy caused by B(a)p decreased the mRNA expression levels of LC3, an autophagy marker, and increased Beclin 1 mRNA expression levels. These results clearly showed that both RES and QR treatments prevented B(a)p-induced autophagy in retinal pigment epithelial cells. Furthermore, it is clear from the increase in Caspase-3 protein levels that retinal pigment epithelial cells were led to apoptosis by the RES and QR treatments in order to prevent possible B(a)p-induced carcinogenesis and degenerative diseases such as AMD that may occur with chronic exposure to B(a)p as the result of the RES and QR treatments.

It is well-known that inhibiting autophagy potentiates the activity of IL-1β while activating autophagy decreases IL-1β levels [43–45]. It has been previously reported that inhibition of autophagy by suppression of Beclin 1 stimulates IL-1β secretion [46]. Similar to the literature, it was found that suppressing autophagy via RES and QR decreased Beclin 1 mRNA expression levels while elevating IL-1β levels.

In conclusion, the result demonstrated that B(a)pinduced autophagy in retinal pigment epithelial cells, but this was eliminated by treatments with RES and QR combinations. Furthermore, given that long-term B(a)p exposure may cause retinal degenerative diseases, it can be suggested that RES and QR may be protective agents against degenerative diseases such as cancer and AMD caused by chronic toxin stress in retinal cells, since increasing caspase-3 levels of RES and QR would prevent possible retinopathy.

Conflicts of Interest: No conflict of interest was declared by the authors

Financial Interest: The authors certify that they have no association or participation with any organization or individual with any financial interest or non-financial interest in the subject matter or materials discussed in this article

Financial Disclosure: The authors declared that this study recived no financial support

Song T, Zhou J. Primary Cilia in Corneal Development and Disease. Zool Res. 2020;41(5):495–502. doi:10.24272/j.issn.2095-8137.2020.109.
Zhou P, Zhou J. The Primary Cilium as a Therapeutic Target in Ocular Diseases. Front. Pharmacol. 2020;11:977. doi:10.3389/fphar.2020.00977.
Evans JR. Risk factors forage-related macular degeneration. Prog Retin Eye Res. 2001;20:227–253.
Evans JR. Antioxidant Vitamin and Mineral Supplements for Age-related Macular Degeneration (CochraneReview). Update Software: Oxford, 2003.
Kaarniranta K, Salminen A. Age-related macular degeneration: Activation of innate immunity system via pattern recognition receptors. J Mol Med. 2009;87:117−123.
Kaarniranta K, Hyttinen J, Ryhänen T, Viiri J, Paimela T, Toropainen E, et al. Mechanisms of protein aggregation in the retinal pigment epithelial cells. Front biosci Elite edition. 2010;2:1374−1384.
Age-Related Eye Disease Study Group. A randomized, placebo-controlled, clinical trial of high-dose supplementation with vitamins C and E, beta carotene, and zinc for age-related macular degeneration and vision loss: AREDS report no. 8. Arch Ophthalmol. 2001;119:1417−1436.
Scientific Committee on Tobacco and Health. Report of the Scientific Committee on Tobacco and Health. The Stationary Office: London, 1998.
Cheng AC, Pang CP, Leung AT, Chua JK, Fan DS, Lam DS. The association between cigarette smoking and ocular diseases. Hong Kong Med J. 2000;6(2):195-202.
Yuen BG, Tham VM, Browne EN, Weinrib R, Borkar DS, Parker JV, Uchida A, Vinoya AC, Acharya NR. Association between Smoking and Uveitis: Results from the Pacific Ocular Inflammation Study. Ophthalmology. 2015;122(6):1257-61.
Moore TO, Moore AY, Carrasco D, Straten MV, Arany I, Au WW, Tyring SK. "Human papillomavirus, smoking, and cancer. Journal of cutaneous medicine and surgery. 2001;5(4):323-328.
Sasco AJ, Secretan MB, Straif K. "Tobacco smoking and cancer: a brief review of recent epidemiological evidence." Lung cancer. 2004;45(2):S3-S9.
Smith W, Mitchell P, Leeder SR. Smoking and age-related maculopathy: The Blue Mountains Eye Study. Arch Ophthalmol. 1996;114:1518 –1523.
Tomany SC, Wang JJ, Van Leeuwen R, et al. Risk factors for incident age-related macular degeneration. Pooled findings from 3 continents. Ophthalmol. 2004;111:1280 –1287.
Thornton J, Edwards R, Mitchell P, et al. Smoking and age-related macular degeneration: a review of association. Eye. 2005;19:935–944.
Kaiserman MJ, Rickert WS. "Carcinogens in tobacco smoke: benzo [a] pyrene from Canadian cigarettes and cigarette tobacco." American Journal of Public Health. 1992;82(7):1023-1026.
Malaguarnera L. Influence of Resveratrol on the Immune Response. Nutrients. 2019;26;11(5):946.
Li Y, Fu S, Li E, Sun X, Xu H, Meng Y, Xu P. Modulation of autophagy in the protective effect of resveratrol on PM2. 5‐induced pulmonary oxidative injury in mice. Phytotherapy research, 2018;32(12):2480-2486.
Xu X, Chen K, Kobayashi S, Timm D, Liang Q. Resveratrol attenuates doxorubicin-induced cardiomyocyte death via inhibition of p70 S6 kinase 1-mediated autophagy. J Pharmacol Exp Ther. 2012;341(1):183-195.
Armour SM, Baur JA, Hsieh SN, Land-Bracha A, Thomas SM, Sinclair DA. Inhibition of mammalian S6 kinase by resveratrol suppresses autophagy. Aging (Albany NY). 2009;1(6):515-528.
Ross JA, Kasum CM. Dietary flavonoids: bioavailability, metabolic effects, and safety. Annu Rev Nutr. 2002;22:19-34.
Chen B, Xiao H, Wu L, Wang T, Wang S, Yu H, Wan G, Xie M, Zhang R, Xiao H, Deng W. Quercetin inhibits the tumorigenesis of colorectal cancer cells through downregulation of hsa_circ_0006990. Front Pharmacol. 2022;18(13):874696.
Yuan K, Zhu Q, Lu Q, Jiang H, Zhu M, Li X, Huang G, Xu A. Quercetin alleviates rheumatoid arthritis by inhibiting neutrophil inflammatory activities. J Nutr Biochem. 2020;84:108454.
Thornton J, Edwards R, Mitchell P, Harrison RA, Buchan I, Kelly SP. Smoking and age-related macular degeneation: a review of association. Eye. 2005;19(9):935-944
Chakravarthy U,Augood C,Bentham GC, de Jong PTVM, Rahu M, Selan J, Soubrane G, Tomazzoli L, Topouzis F, Vingerling JR, Vioque J, Young IS, Fletcher AE. Cigarette Smoking and Age-Related Macular Degeneration in the EUREYE Study. Opthalmol. 2007;114(6):1157-1163.
Golestaneh N, Chu Y, Xiao YY, Stoleru GL, Theos AC. Dysfunctional Autophagy in RPE, a Contributing Factor in Age-Related Macular Degeneration. Cell Death Dis. 2017;5;8(1):e2537. doi:10.1038/cddis.2016.453.
Yu F, Guo S, Li T, Ran J, Zhao W, Li D, Li M, Yan X, Yan X, Zhu X, Zhou J. Ciliary Defects Caused by Dysregulation of O-GlcNAc Modification are Associated with Diabetic Complications. Cell Res. 2019;29(2):171–173. doi:10.1038/s41422-018-0114-7.
Yu F, Li T, Sui Y, Chen Q, Yang S, Yang J, et al. O-GlcNAc Transferase Regulates Centriole Behavior and Intraflagellar Transport to Promote Ciliogenesis. Protein Cell. 2020;11(11):852–857. doi:10.1007/s13238-020-00746-2.
Jadeja RN, Martin PM. Data on the Role of miR-144 in Regulating Fetal Hemoglobin Production in Retinal Pigmented Epithelial Cells. Data Brief. 2020;28:104874. doi:10.1016/j.dib. 2019.104874
Sheu SJ, Liu NC,Chen JL. Resveratrol protects human retinal pigment epithelial cells from acrolein-induced damage. J. Ocul. Pharmacol. Ther. 2010;26:231–236.doi: 10.1089/jop.2009.0137.
Pintea A, Rugina˘ D, Pop R, Bunea A, Socaciu C, Diehl HA. Antioxidant effect of trans-resveratrol in cultured human retinal pigment epithelial cells. J. Ocul. Pharmacol. Ther. 2011;27(4):315–321.
Boots AW, Haenen GRMM, Bast A. Health effects of quercetin: from antioxidant to nutraceutical. Eur J Pharmacol. 2008;585(2-3):325-327.
Hanneken A, Lin FF, Johnson J, Maher P. Flavonoids protect human retinal pigment epithelial cells from oxidative-stress-induced death. 2006;47(7):3164-3177.
Kook D, Wolf AH, Yu AL, Neubauer AS, Priglinger SG, Kampik A, Welge-Lüssen UC. The protective effect of quercetin against oxidative stress in the human RPE in vitro. Invest Ophthalmol Vis Sci. 2008;49(4):1712-1720.
Cao X, Liu M, Tuo J, Shen D, Chan C. The effects of quercetin in cultured human RPE cells under oxidative stress and in Ccl2 ／ Cx3cr1 double deficient mice. Exp Eye Res. 2010;91(1):15－25.
Zhuang P, Shen Y, Lin BQ, Zhang WY, Chiou GCY. Effect of Quercetin on Formation of Choroidal Neovascularization in AMD. Eye Sci. 2011;26(1):23-29.
Herawati I, Lesmana R, Levita J, Subarnas A. Molecular Interaction Of Ricin-A With Caspase-3, Caspase-8, Caspase-9 And Autophagy-Related Gene5 (ATG5) To Understand Its Role As Anticancer Agent. Rasayan J. Chem. 2021;14(3):1790-1794.
Tsapras P, Nezis IP. Caspase involvement in autophagy. Cell Death Differ. 2017;24(8):1369-1379. doi: 10.1038/cdd. 2017.43. Epub 2017 Jun 2.
Pagliarini V, Wirawan E, Romagnoli A, Ciccosanti F, Lisi G, Lippens S, Cecconi F, Fimia GM, Vandenabeele P, Corazzari M, Piacentini M. Proteolysis of Ambra1 during apoptosis has a role in the inhibition of the autophagic pro-survival response. Cell Death Differ. 2012;19(9):1495-1504.
Ojha R, Ishaq M, Singh SK. Caspase-mediated crosstalk between autophagy and apoptosis: Mutual adjustment or matter of dominance. J Cancer Res Ther. 2015;11(3):514-524.
Prerna K, Dubey VK. Beclin1-mediated interplay between autophagy and apoptosis: New understanding. Int J Biol Macromol. 2022;15;204:258-273.
Zhou H, Ling H, Li Y, Jiang X, Cheng S, Zubeir GM, Xia Y, Qin X, Zhang J, Zou Z, Chen C. Downregulation of beclin 1 restores arsenite-induced impaired autophagic flux by improving the lysosomal function in the brain. Ecotoxicol Environ Saf. 2022;1;229:113066.
Saitoh T, Fujita N, Jang MH, Uematsu S, Yang BG, Satoh T, Omori H, Noda T, Yamamoto N, Komatsu M, Tanaka K, Kawai T, Tsujimura T, Takeuchi O, Yoshimori T, Akira S. Loss of the autophagy protein Atg16L1 enhances endotoxin-induced IL-1beta production. Nature. 2008;13;456(7219):264-268.
Nakahira K, Haspel JA, Rathinam VA, Lee SJ, Dolinay T, Lam HC, Englert JA, Rabinovitch M, Cernadas M, Kim HP, Fitzgerald KA, Ryter SW, Choi AM. Autophagy proteins regulate innate immune responses by inhibiting the release of mitochondrial DNA mediated by the NALP3 inflammasome. Nat Immunol. 2011;12(3):222-230.
Shi CS, Shenderov K, Huang NN, Kabat J, Abu-Asab M, Fitzgerald KA, Sher A, Kehrl JH. Activation of autophagy by inflammatory signals limits IL-1β production by targeting ubiquitinated inflammasomes for destruction. Nat Immunol. 2012;13(3):255-263.
Crişan TO, Plantinga TS, van de Veerdonk FL, Farcaş MF, Stoffels M, Kullberg BJ, van der Meer JW, Joosten LA, Netea MG. Inflammasome-independent modulation of cytokine response by autophagy in human cells. PLoS One. 2011;6(4):e18666.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Resveratrol and Quercetin Protect From Benzo(a)pyrene-induced Autophagy in Retinal Pigment Epithelial Cells

Status:

Version 1

Abstract

Purpose

Methods

Results

Conclusion

Figures

Introduction

Materials and methods

Cell Culture

MTT cell viability test and experimental groups

Autophagy assay

Total protein analyses from cell lysates

ELISAtest

Total RNA Extraction, Reverse Transcription, and Quantitative PCR

Statistical analysis

Results

Discussion

Declarations

References

Additional Declarations

Status:

Version 1