Serum samples and plasmids
Forty-eight goat ORFV-negative serum samples (goat were clinically healthy and tested negative for antibodies to ORFV by agar diffusion test), 243 Orf vaccine-immunized goat serum samples, 180 unimmunized goat serum samples, goat Foot and Mouth Disease Virus-A (FMDV-A), Foot and Mouth Disease Virus-O (FMDV-O), Foot-and-mouth disease virus 3ABC recombinant protein (FMDV-3ABC), Peste des petits ruminants virus (PPRV), Brucella-positive serum samples and pMD18-T-B2L, pMD18-T-F1L, and pET-32a vectors were kept by the Key Laboratory of Animal Disease and Veterinary Public Health of Guizhou Province.
Design of truncated ORFV B2L and F1L genes
DNAstar software was used to bioinformatically analyze the sequences of the B2L and F1L genes, and the sequences from aa 208 to aa 378 encoded by the B2L gene and from aa 2 to aa 182 encoded by the F1L gene were selected and intercepted as the main fragment of ORFV double gene fusion.
Primer design and synthesis
Based on the gene sequences of the best dominant antigen fragments of the B2L and F1L genes, a pair of primers was designed to add the HindШ restriction enzyme cutting site and the protected base at the 5′ end of the upstream primer of the B2L gene and the EcoR I restriction enzyme cutting site and the protected base at the 5′ end of the downstream primer of the F1L gene. The upstream primer of the fusion gene was designed by adding a linker containing 10 hydrophobic amino acid polypeptide bases at the 5′ end of the downstream primer of the B2L gene, and the downstream primer of the fusion gene was designed by adding a linker with a polypeptide base fully complementary to it at the 5′ end of the upstream primer of the F1L gene. The primer sequences were sent to Shanghai Bioengineering Corporation for synthesis, and the primer information is shown in Table 5.
Table 5
Primers | Primer sequence(5′→3′) | Product size(bp) |
B2L-F | CCAAGCTTCCGGAGCGCTTCCTAGGCT | 510 bp |
B2L-R | TATTGGTTTGCAGAACTCCG |
F1L-F | GAAGGCCGCGGGACCAAGG | 540 bp |
F1L-R | CGGAATTCCATGAGCTCGGGGTCGCCG |
B2L-F1L- F | GCTTCCGCCACCGCCGCTTCCACCGCCACCTATTGGTTTGCAGAACTCCG | 1080 bp |
B2L-F1L- R | GGTGGCGGTGGAAGCGGCGGTGGCGGAAGCGAAGGCCGCGGGACCAAGG |
Note: The underlined part is the restriction site; the italic part is the peptide base linker. |
Construction and identification of recombinant expression plasmids
The pMD18-T-B2L and pMD18-T-F1L clone plasmids were extracted as templates according to the instructions of the plasmid extraction kit, and the primers B2L-F/B2L-R and F1L-F/F1L-R were used for PCR amplification. PCR products were recovered and purified as templates, and SOE-PCR amplification was performed using B2L-F1L- F/B2L-F1L-R primers. The PCR product was purified and ligated into the pET-32a(+) vector and transformed into DH5α competent cells to construct the recombinant expression plasmid pET-32a- B2L-F1L, and the recombinant plasmid was identified by PCR, double digestion and sequencing.
Inducible expression, purification and western blot identification of recombinant proteins
The recombinant expression plasmid pET-32a-B2L-F1L was transformed into BL21(DE3) competent cells and incubated at 37 ℃ 180 r/min until the OD600 value was 0.4 ~ 0.8. Then, IPTG at a final concentration of 0.2 mmol/L was added and induced at 37 ℃ for 5 hours. Bacteria were collected by centrifugation at 10,000 r/min for 10 mins. After centrifugation, the supernatant and precipitate were collected and identified by SDS‒PAGE electrophoresis. The supernatant of the bacterium was purified by Ni-IDA affinity chromatography after ultrasonic fragmentation, and a BCA kit was used to determine the concentration of purified protein. After electrophoresis by SDS‒PAGE, the protein was electrotransferred to a PVDF membrane, which was blocked with 5% skimmed milk powder at 37 ℃ for 2 hours. The inactivated ORFV-positive serum (1:200) was used as the primary antibody, and rabbit anti-gaot HRP-IgG (1:5000) was used as the secondary antibody, and the purified B2L-F1L protein was identified by western blot.
Establishment of indirect ELISA method and optimization of conditions
Determination of optimal antigen coating concentration and optimal dilution of serum by square matrix titrimetry test. The purified B2L-F1L protein was diluted to 8 µg/mL, 4 µg/mL, 2 µg/mL, 1 µg/mL, 0.5 µg/mL and 0.25 µg/mL in carbonate buffer (pH 9.6), added to 96-well enzyme-labeled plates at 100 µL/well and coated overnight at 4 ℃. ORFV-positive and -negative sera were diluted 1:50, 1:100, 1:200 and 1:400 times and then subjected to a square matrix titrimetry test. Based on the OD450nm of the measured ORFV antibody-positive and -negative sera, the reaction conditions at the maximum P/N value are the best working conditions. The protein coating time (overnight at 4 ℃, 2 hours at 37 ℃ followed by overnight at 4 ℃, and 2 hours at 37 ℃), 37 ℃ action time (30 mins, 60 mins, 90 mins, and 120 mins) of the blocking solution (5% skimmed milk powder), serum action time (30 mins, 45 mins, 60 mins, and 75 mins), rabbit anti-goat HRP-IgG (1:5000, 1:8000, 1:10,000, 1:12000 and 1:15000), action time (30 mins, 45 mins, 60 mins and 75 mins), substrate (TMB) color development time (10 mins, 15 mins and 20 mins), etc., were optimized.
Determination of the critical value
Forty-eight ORFV-negative serum samples were tested according to the preliminary established ELISA method, and the OD450 nm values of the 48 negative serum samples were read by enzyme marker. The resulting 48 negative serum OD450nm values were processed for data, the negative control mean (‾X) and standard deviation (SD) were calculated, and the statistical formula was used to calculate the cutoff critical value: ‾X + 3 SD. That is, the sample to be tested with an OD450 nm value ≥ ‾X + 3 SD was determined to be positive, and the opposite was determined to be negative.
Specificity test
ORFV-, FMDV-A-, FMDV-O-, FMDV-3ABC-, PPRV- and Brucella-positive sera were detected by indirect ELISA, together with a control of ORFV-negative sera, to assess the specificity of the method.
Sensitivity testing
ORFV-positive sera were diluted multiple times (1:1 to 1:2048), and the sensitivity of the ELISA method was evaluated by measuring the maximum dilution of the positive sera after multiple dilutions using the indirect ELISA method established in this study.
Repeatability test
The same and different batches of B2L-F1L protein-coated ELISA plates were taken, and four ORFV-positive sera samples were tested, with five replicates each. According to the formula coefficient of variation = standard variance (SD)/mean (‾X), the coefficient of variation of intra- and inter-batch reproducibility tests were calculated to evaluate the intra- and inter batch reproducibility of the established ELISA method.
Testing of clinical serum samples
The established ELISA method was used to analyze 243 goat serum samples immunized with the ORFV vaccine and 180 goat serum samples not immunized with the ORFV vaccine for antibody detection, while negative and positive controls were established.