Human Datasets and Survival Analysis
All mRNA gene expression analyses were performed within R2: genomics analysis and visualization platform (http://r2.amc.nl).The platform allowed us to access and analyze several publicly available datasets relevant to neuroblastoma. Specifically, we utilized the Neuroblastoma integrated platforms dataset, which includes data from 786 patients. Additionally, we analyzed the GSE62654 Neuroblastoma dataset, consisting of 498 patients, and the GSE85047 Tumor Neuroblastoma - Ora - dataset, which includes data from 283 patients. Kaplan scanning was performed within R2 (http://r2.amc.nl).
Cell lines and cell culture
The neuroblastoma cell lines used in this study were obtained from specific sources. SH-SY5Y, SK-N-BE (2), SK-N-SH, Neuro2A, and IMR-32 cell lines were purchased from the Typical Culture Preservation Commission Cell Bank, Chinese Academy of Sciences (Shanghai, China). SK-N-AS cell line was purchased from Procell Life Science & Technology Co., Ltd. (Wuhan, China). The cell lines were cultured in different media according to their specific requirements. SH-SY5Y cells were grown in Minimum Essential Medium/Ham's F-12 Nutrient Mixture (MEM: F-12 1:1, Thermo, Waltham, MA, USA) supplemented with 10% fetal bovine serum, 1% Sodium pyruvate, 1% MEM Non-Essential Amino Acids, and 1% GlutaMAX. SK-N-BE (2), SK-N-SH, and Neuro2A cells were cultured in MEM medium supplemented with 10% fetal bovine serum, 1% MEM Non-Essential Amino Acids, and 1% GlutaMAX. IMR-32, SK-N-AS, and 293T cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum and 1% GlutaMAX. All cell lines were incubated in a humidified atmosphere with 5% CO2 at 37°C, and the media were changed every other day to maintain cell growth and viability.
Lentiviral Vector Construction and Viral Production
To generate lentiviral vectors for overexpressing target genes, the 909-bp sequence downstream from the first ATG of the human KLF7 gene and 906-bp sequence of the mouse Klf7 gene were amplified using KOD DNA polymerase (TOYOBO, Osaka, Japan) with primers (forward, 5′-ATGGACGTGTTGGCTAGT-3′, reverse, 5′- TTAGATATGTCTCTTCATGTGG-3′; forward, 5′-ATGGACGTGTTGGCTAGTTATA-3′, reverse, 5′- TTAGATATGTCTCTTCATATGGAGC − 3′, excluding an additional flanking EcoRI - BamHI site) and subcloned into the lentiviral vector pLVSIN CMV Puro (TaKaRa, Ohtsu, Japan) and verified by DNA sequencing. For knockdown experiments, three independent short hairpin RNAs (shRNAs) for each gene (KLF7, NTRK1, AHNAK, AHNAK2), were selected and cloned into lentiviral vector pLKO.1 (Table S1). To generate viral particles, the lentiviral vectors were transfected into plated 293T cells along with gag/pol and VSV-G vectors at proportions of 9:9:1 using calcium phosphate transfection. After 24 hours, 6 mL of fresh medium was added, and the supernatant containing viral particles from the transfected cells was collected at 48 hours and 72 hours. The lentivirus carrying the overexpressing or knockdown target genes was obtained through centrifugation and filtration using a 0.45 µm filter.
Cell viability assay
Cell viability was evaluated using the CCK-8 assay, according to the manufacturer's instructions. After lentiviral transduction, the cells were seeded onto 96‐well plates with the same cell number. CCK‐8 (10 µL) was added to each well and the cells were incubated for 2 hours at 37°C. The optical density (OD) was measured at 450 nm using an auto‐microplate reader (Infinite M200; Tecan, Männedorf, Switzerland).
RNA extraction and quantitative reverse transcriptase PCR (qRT-PCR).
Total RNA was extracted from cell lines using TRIzol reagent (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer’s instructions; RNA quality was assessed by agarose gel electrophoresis. For the gene expression analysis, a total of 1 µg of RNA for each sample was reverse-transcribed to cDNA using reverse-transcription kits (Promega, Madison, WI, USA), and real-time quantitative reverse transcription (qRT)-PCR was performed on the LightCycler 480 real-time PCR system (Roche, Mannheim, Germany) using FastStart Universal SYBR Green Master Rox (Roche, Mannheim, Germany). The primers used in the present study are shown in Table S2. GAPDH was used as the internal reference for normalization. The relative mRNA expression was analyzed using the 2–ΔΔCt method.
Cell Neurite Induction
After lentiviral transduction, cells were seeded onto 6-well plates. FBS free Neurobasal medium containing 1x B27 supplement, 20 µM GlutaMAX and 10 µM all-trans-retinoic acid (ATRA) was added to the culture cells 24 hours after plating to promote neural differentiation. After 3–5 days differentiation induction, the differentiated cells were monitored and assessed their morphological changes and neurite outgrowth.
Immunostaining.
The cells were first seeded on glass coverslips, fixed with 4% paraformaldehyde for 15 min, permeabilized by 70% methanol at -20°C for 10 min, and subsequently blocked in a blocking buffer for 2 h at room temperature. The cells were incubated with primary antibodies overnight at 4°C and then incubated with Alexa-conjugated secondary antibodies for 45 min at room temperature. After the final washes, cells were mounted in fluorescence mounting medium (Thermo Fisher Scientific, Waltham, MA, USA) and analyzed with an Axiovert 200M microscope (Carl Zeiss, Oberkochen, Germany) or a confocal microscope (TCS-SP2; Leica, Wetzlar, Germany).
Chromatin immunoprecipitation sequencing
To detect direct target genes of KLF7, chromatin immunoprecipitation (ChIP) sequencing was performed by using 3×HA-KLF7 overexpression-SH-SY5Y cells, and 3×HA-GFP-SH-SY5Ycells. To detect the changes of super-enhancer genes after KLF7 depletion, shKLF7-SK-N-BE2 cells and shcontrol-SK-N-BE2 cells were used. ChIP procedure was performed as our previously study described [16]. Briefly, 2×107 cells were crosslinked with 1% formaldehyde for 10 min and neutralized by 1.25 M glycine for 5 min at room temperature. Fixed cells were harvested, lysed and sonicated with Bioruptor (Diagenode, Liege, Belgium). Sonicated chromatin was incubated with following antibodies overnight at 4°C: anti-H3K4me3 rabbit monoclonal antibody (#9751, CST, Danvers, MA, USA), anti-H3K27ac rabbit monoclonal antibody (#8173, CST, Danvers, MA, USA), and anti-HA rabbit monoclonal antibody (#3724, CST, Danvers, MA, USA). DNA was eluted and purified with QIAquick PCR spin kit (Qiagen, Hilden, Germany). Samples were sequenced on an Illumina HiSeq 2000.
Luciferase reporter assay
The 2kb DNA sequence 5’ of transcription start site (+ 1) of AHNAK and AHNAK2 gene were amplified using KOD DNA polymerase (TOYOBO, Osaka, Japan) with primers (forward, 5′- CGTGAGCCACCAATCGTGCTAC − 3′, reverse, 5′- TATGTGGTGTTTGGGTGGCATGA − 3′,excluding an additional flanking XhoI - HidnIII site; forward, 5′- CAGCGCGGCTAACGGGAACTGTCTAG − 3′, reverse, 5′- GCGGACACCGCGCGCCAG − 3′, excluding an additional flanking KpnI - XhoI site) from human genomic DNA and subcloned into the PGL4.11 vector (Promega, Madison, WI, USA), upstream of the Firefly luciferase reporter gene, and verified by DNA sequencing. Sequentially shorter reporter constructs of the human AHNAK promoter were generated from the human AHNAK promoter (2000 bp) construct, using the following forward primers excluding an additional flanking XhoI site: 5′- AGGGCTGGCAGCAGAGTTGACT − 3′ (1161 bp); 5′- GTTCTGTGCGGATATGGACGGA − 3′ (549 bp); 5′- ACTCCCGGGTCCCTCCAGG − 3′ (143bp); and 5′- CCGCCCTCTCCCCACAGC − 3′ (77 bp). While sequentially shorter reporter constructs of the human AHNAK2 promoter were generated from the human AHNAK2 promoter (2000 bp) construct, using the following forward primers excluding an additional flanking KpnI site: 5′- AGGGAGGCTCCCACCCTCTGCACT − 3′ (1118 bp); 5′- GAAAGGATGACTCTGGGCGGGGTTCT − 3′ (560 bp); 5′- CGGACGCGACAGGCGGGC − 3′ (200bp); and 5′- CCGCAGTGGCCCGGCAGG − 3′ (226 bp). The KLF7 binding motif mutant reporter plasmids (AHNAK and AHNAK2 MUT1, MUT 2, and MUT 12) were generated from the human AHNAK2 promoter (2000 bp) construct by site-directed mutagenesis using the following mutation primer pairs: MUT1 for AHNAK forward, 5′- TAGGGAAAGAATGTCCCCGCGTCCCCCAGCGGCCATTAGTAACAGCAGCCCACTCCCGGGT-3′; reverse, 5′- GGGGACATTCTTTCCCTAATCATTCGCATCCACTGCCCCCTGT − 3′; MUT1 for AHNAK2 forward,5′-TTACCTGGCTGGGAGAATGATTACCGCGGCGACGGCAGCCA-3′; reverse,5′- TTCTCCCAGCCAGGTAATCATTCACCCCGCGCCCCCGGCCC − 3′; MUT2 for AHNAK forward, 5′- TTAGTAAGGATTAGTAATCTCCCCACAGCTCCGGGC-3′;reverse,5′- TTACTAATCCTTACTAATCCGGAGCGGGGCTGGGAC-3′; MUT2 for AHNAK2 forward, 5′- AATGATTACCAATGATTATCCTAGCTGAGCGGCTGGG-3′; reverse, 5′- AATCATTGGTAATCATTAGCCCTGCCGGGCCACTGC − 3′; for MUT12 we used the MUT2 primer pairs while AHNAK or AHNAK2 MUT1 construct as template. HEK293 cells were co-transfected with the vector containing AHNAK and AHNAK2 gene transcripts or deletion/ mutant of promoter cotransfection with the Renilla luciferase expression vector pGL4.74 (Promega, Madison, WI, USA) was used as an internal control for all reporter assays.
After 48 hrs, luciferase activity was measured in triplicate using a Dual Luciferase Reporter Assay System (Promega, Madison, WI, USA). Renilla luciferase activity was used for normalization, and Firefly luciferase activity in transfected cells was compared to that in mock-transfected cells.
RNA Sequencing and Bioinformatics
RNA from KLF7 overexpressing SH-SY5Ycells and RNA from KLF7 knockdown cells such as shKLF7,SH-SY5Y or SK-N-BE2 cells was extracted and subjected to RNA sequencing (RNAseq) Strand-specific library construction and sequencing of ~ 100M pairedend 100-bp-long reads by Illumina HiSeq were performed at Novogene Co. Ltd. (Beijing, China). RNA-seq reads were aligned to the hg19 human reference genome using STAR 2.5.2a with out- FilterMultimapNmax set to 1. Total mapped reads were quantified using htseqcount version 0.6.1, and count tables were generated based on Ensembl hg19 gene annotation gtf files. Differential expression analysis was conducted using the Bioconductor package DESeq2 version 1.12.4. Gene expression for each neuroblastoma cell lines was estimated in transcripts per million (TPM) using Kallisto software version 0.43.1. All RNA-Seq data were normalized using the Sleuth R package from Patcher lab41. Selected gene expression from sleuth normalized TPM were used to generate heatmap using web-based heatmap tools, heatmapper42. Genes differentially expressed after knockdown of each transcription factor were selected using the following criteria: adjusted p value < 0.05, log 2 fold-change < − 0.5 or > 0.5, and TPM > 3.
Protein extraction and western blot analysis
For western blotting, cells were lysed and the proteins were separated by SDS-PAGE using pre-cast gradient gels (4–12% Nu-Page Bis-Tris, Invitrogen, Carlsbad, CA, USA) and then transferred to nitrocellulose membranes. The nitrocellulose membranes was incubated with primary antibody for 1 hr at room temperature or overnight at 4°C, followed with 1 hr incubation with horseradish peroxidase-conjugated secondary antibodies (DAKO, Glostrup, Denmark). Proteins were detected using ECL Western blot reagent (GE Healthcare, Chalfont St. Giles, UK).
Rac1and Cdc42 activation assays
Rac1 and Cdc42 activity assays were performed as previously described [17]. In brief, 107 cells were grown in 10-cm dishes, washed in cold PBS, and lysed on ice in lysis buffer (50 mM Tris-HCl, pH 7.4, 1% NP-40, 100 mM NaCl, 10% glycerol, 5 mM MgCl2, and protease inhibitors). Cleared lysates were incubated for 1hr at 4°C with PAK-PBD beads (Cytoskeleton Inc.) to precipitate GTP-bound Rac1 and Cdc42, respectively. Precipitated complexes were washed three times in wash buffer and boiled in sample buffer. Total lysates and precipitates were analyzed on Western blot using mAbs against Rac1 and Cdc42 (Cytoskeleton, Inc., Denver, CO).
The half-maximal inhibitory concentration assay
The KLF7 knock down or control cells were seeded into a 96-well plate at a density of 10,000 cells per well, and allowed to grow for a day before treatment. After three days of treatment with cisplatin, the cell growth was evaluated by CCK-8 assay. The results were analyzed using GraphPad Prism 7.01 to determine the half-maximal inhibitory concentration (IC50) value.
Cell transwell invasion and migration assay
A transwell insert with 8 µm pore polycarbonate membrane (Corning, #3403) coated with Matrigel was used in the assay. Cells were seeded into the upper compartment of the transwell with serum-free media, while media containing 10% fetal bovine serum was added to the lower compartment. This creates a gradient that stimulates cell migration. After incubation for 48 hours, the cells migrated in the lower compartment were visualized by staining with 0.1% crystal violet. The number of migrated cells in five representative fields per membrane was counted.
Statistical Analysis
The results are presented as the means ± standard deviations. All experiments were performed in triplicate, and statistical significance was determined by a two-tailed unpaired t-test. A P-value of < 0.05(*) was considered significant; a P-value < 0.01 (**) was considered highly significant.