Chondrocyte culture and treatment
Male Sprague-Dawley (SD) rats (1-month-old, Laboratory Animal Services Centre, the Chinese University of Hong Kong, HK) were sacrificed and used for isolation of chondrocytes under institutional ethical approval. Articular cartilage was isolated from right femoral head cap, and chondrocytes were obtained after digestion of cartilage fragments by 0.25% trypsin (w/v) for 30 minutes followed by about 12 hours of digestion within 0.2% collagenase II (w/v) in serum-free Dulbecco's Modified Eagle Medium (DMEM; Gibco, Carlsbad, CA). After that, the chondrocytes were collected and cultured in DMEM containing 10% fetal bovine serum (FBS; Gibco, Carlsbad, CA), 100 units/ml of penicillin and 100 mg/ml of streptomycin and cultured at 37 °C, 5% CO2. The staining for collagen type II and Toluidine blue O staining were used for chondrocyte identification. To avoid dedifferentiation, only the passage 1 to 3 was used for our experiment.
Cell viability assay
MTT (Sigma-Aldrich, St Louis, MA) assay was used to measure the effect of AA on the viability of chondrocytes. In brief, the chondrocytes at a density of 6 × 103/well were cultured in a 96-well plate overnight and treated by various concentrations (0, 5, 10, 25 μM) of AA (Chengdu Biopurify Phytochemical, Chengdu, China) for additional 24 h. Then, 20 μl MTT (5 mg/ml) was loaded into each well for 4 h. Next, the supernatant was discarded and 150 μl DMSO was applied for solubilization of formazan. The absorbance at 570 nm was measured with the micro-plate reader (Bio-red, Hercules, USA).
Transfection and dual-luciferase reporter assays
NF-κB / p65 Renilla/firefly dual luciferase reporter system was constructed in this research as the method described previously [28]. 1 μg of NF-κB/p65 promoter/Luciferase Plasmid DNA along with 1μg of internal control pRL-TK plasmid was transiently transfected into 1×105 293T cell/well in a 6-well plate using lipofectamine 2000 (Thermo Fisher Scientific, USA) reagents for 24 h according to manufactures’ instruction. After that, the cells were treated with AA (0, 5, 10, 25 μM) for 24 h. Each well was then washed twice by cold PBS and harvested by Dual-Luciferase® Reporter Assay System (Promega, USA). After sample preparation, luminescence was measured by PerkinElmer VictorTM X2 2030 multilabel reader (Waltham, USA). The luciferase activity was normalized with expression of control pRL-TK.
NO assay
Chondrocytes were pretreated by AA 24 h and then stimulated with interleukin (IL)-1β (Cell Signal Technology, USA) for 24 h. The concentration of NO within the culture medium was measured by the Griess reagent (Beyotime Biotechnology, Guangzhou, China) according to the manufacturer’s instructions.
Chondrocyte real-time quantitative PCR
Total RNAs of chondrocytes were extracted by using TRIzol (Invitrogen, Carlsbad, CA, USA). RNA concentrations were measured using Nanodrop method (Thermo Scientific, Wilmington, NC, USA). Then, single-stranded cDNA was synthesized from 500 ng of total RNA by reverse transcriptase (TaKaRa Biotechnology, Otsu, Japan). Real-time PCR was applied using SYBR Green Master mix (Thermo Fisher, Waltham, USA) and results were detected by ABI 7500 Sequencing Detection System (Applied Biosystems, Foster City, CA, USA). The primers were designed corresponding to the coding region of genes as listed: Aggrecan (forward: GAAGTGGC-GTCCAAACCAAC, reverse: AGCTGGTA-ATTGCAGGGGAC), SOX9(forward: ATCTGAAGAAGGAGAGCG-AG, reverse: CAAGCTCTGGAGACTGCTGA), Col2 a1(forward: ATCGCCACG-CTCCTACAATG, reverse: GGCCCTAATTTTCGGGCATC), MMP-13 (forward: TGACTATGCGTGGCTGGAA, revise: AAGCTGAAATCTTGCCTTGGA), PPAR-γ (forward: forward: GAGTCCGTCTAGCAGTGT, reverse: CGAGGACATCCA AGACAAC), GAPDH (forward: CCT-CGTCTCATAGACAAGATGGT, reverse: GGGTAGAGTCATACTGGAACAT-G). The final data were analyzed using the 2−ΔΔ𝐶T method. All values were normalized to the level of the housekeeping gene GAPDH.
Western Blot Analysis
Chondrocyte were washed three times with cold PBS and whole cell protein were extracted by using Radioimmunoprecipitation assay (RIPA) buffer (50 mmol/L Tris–HCl, pH 7.5, 150 μmol/L sodium chloride, 0.5% cholic acid, 0.1% SDS, 2 mmol/L EDTA, 1% Triton, and 10% glycerol) including protease and phosphatase inhibitors. The protein within cytoplasma and nuclear was extracted by using NE-PER Nuclear and Cytoplasmic Extraction Reagents (Pierce Biotechnology, Rockford, USA) according to the manufacturer’s protocol. Then, all the protein samples were normalized by BCA protein assay kit. Aliquots of the samples (40 μg) were separated within 10% SDS-polyacrylamide gel and transferred to PVDF membranes. After blocked with 10% FBS, the membrane was incubated overnight under 4°C with primary antibodies to COX2 (sc-376861), iNOS (ab-3523), MMP-13 (ab219620), PPAR-γ (ab209350), phospho-IκB-alpha (CST #2859), IκB-alpha (CST #4814), NF-κB p65 (ab16502), GAPDH (CST #5174). After that, the membrane was incubated with horseradish-peroxidase (HRP)-conjugated secondary antibody for additional 1.5 h (Cell Signaling, Danvers), flowed with visualization by the chemiluminescence.
OA animal model
This animal surgical procedures were approved by the Animal Experimental Ethics Committee of the Chinese University of Hong Kong (CUHK, ref. 18-089-GRF) and performed according to previous reports [29]. Male ICR outbred mice (Laboratory Animal Services Centre, CUHK, HK), 12-week old and body weighing 20-25 g, were used in this study. Animals were kept in local vivarium conditions at a temperature of 24–26 °C and humidity of 70% with free access to water and a pelleted commercial diet in the mouse house under specific pathogen-free (SPF) conditions. To induce mice OA, the right knee joints were received anterior cruciate ligament and medial collateral ligament transection (ACLT) surgery as previously mentioned [30]. After surgery, OA mice were randomly treated with AA (5 μg/g in saline, twice per week, s.c., n = 8) or vehicle (saline, 100 μl, s.c., n= 8) for 6 weeks. In the sham-operated animals (n = 8), only a small piece of skin covering each right knee joint was resected. Animals were euthanasia by carbon dioxide after 6 weeks. The knee joints were then harvested and fixed in 10% buffered formalin.
Microcomputed tomography (μCT) analysis
The right knee joints were analyzed using high-resolution μCT (μCT40, Scanco Medical, Basserdorf, Switzerland) as previous described [29]. Image acquisition was performed at 70 kV and 118 μA, with a resolution of 12 μm per voxel. Three dimensional (3D) reconstructions of the mineralized tissues were performed by using a global threshold (158 mg hydroxyapatite/cm3) and a Gaussian filter (sigma = 0.8, support = 2) was applied for noise suppression. One hundred sagittal images of the subchondral bone of medial tibial plateau was selected to perform the 3D Histomorphometry analysis. The bone volume/total tissue volume (BV/TV) was analyzed as the 3D structural parameters.
Histological and immunochemical examinations
The right knee joints of mice were decalcified within 10 % EDTA for about 21 days and embedded in paraffin. Five micrometer-thick sagittal-oriented sections of the sample were used for Safranin-O/fast green and immunohistochemistry (IHC) staining.
IHC staining was performed as our previous mentioned [29]. We incubated sections with primary antibodies to rabbit collagen type II (Abcam, 1:20, ab34712), MMP-13 (Abcam, 1:200, ab39012) and Osterix (Abcam,1:200, ab22552) overnight at 4 °C. For
immunohistochemical staining, a horse radish peroxidase-strep-tavidin detection system (Dako, Carpinteria, CA, USA) was used according to manufacturer’s instruction. Photographs of the selected areas were taken under a light microscope (Leica, Wetzlar, Germany). We counted the number of positively stained cells and repeated in triplicate in three randomly selected sections at the area of interest in each specimen, and the numbers of cells were statistically analyzed.