Association of ADIPOQ gene variants with adiponectin levels, insulin resistance and non-alcoholic fatty liver disease, in an Iranian population

doi:10.21203/rs.3.rs-3138728/v1

Download PDF

Research Article

Association of ADIPOQ gene variants with adiponectin levels, insulin resistance and non-alcoholic fatty liver disease, in an Iranian population

https://doi.org/10.21203/rs.3.rs-3138728/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Background

Adiponectin hormone is effective in reducing liver inflammation. In this study, the relationship between polymorphisms of the adiponectin gene with adiponectin level biochemical variables and NAFLD has been investigated.

Methods and Results

The case-control study was performed on 80 individuals with NAFLD and 80 healthy individuals. Determination of polymorphisms of rs266729, rs1501299 and rs17300539 from the ADIPOQ gene was performed by PCR- RFLP method. The level of adiponectin and insulin hormones was also measured by ELISA kit. Findings showed that serum triglyceride level, fasting blood sugar, Aspartate Aminotransferase (AST) Alanine Aminotransferase (ALT) and diastolic blood pressure are higher in patients than in healthy individuals. Adiponectin levels and High-density lipoprotein cholesterol (HDL-C) in patients were lower than healthy individuals and body mass index (BMI) was higher in patients (P < 0.05). None of the SNPs were associated with insulin resistance. The results of the investigation of rs17300539 and rs266729 showed that there is no significant difference in the frequencies of alleles and genotypes between the case and control groups. rs1501299 review results showed that there is a significant difference between the frequency of G allele and genotype in healthy and patient groups(P < 0.05). In case (individuals with NAFLD) group of 17300539, BMI was higher in GA carriers than in GG genotype carriers(P < 0.05). There was a relationship between rs17300539 and rs266729 polymorphisms and AST (P < 0.05).

Conclusion

It seems that the G allele of rs17300539 in the adiponectin gene is effective in reducing the complications of NAFLD. The rs1501299 polymorphism is associated with NAFLD.

Non -alcoholic fatty liver

Adiponectin

polymorphism

Fatty tissue

Insulin resistance

Agglomeration of fat in liver cells, when alcohol is not consumed extremely, is the cause of Non-alcoholic fatty liver disease (NAFLD). Individuate histologically, NAFLD may be different from simple non-alcoholic fatty liver steatosis [1]. Due to the fact that the first stage of NAFLD is benign in most cases, 25% of the patients progress towards worsening of the disease [2, 3]. Currently, NAFLD is the second most important cause of chronic liver disease among people who are on the liver transplant list in the United States of America [4]. In Britain and Europe, liver transplants due to NAFLD have increased over the past 10 years [2]. NAFLD is a global epidemic estimated to affect approximately 20–30%population worldwide [5]. NAFLD such as insulin resistance, inflammation, obesity and type 2 diabetes are metabolic syndromes [6, 7, 8]. Therefore, it is important to treat metabolic diseases that are closely related to non-alcoholic fatty liver disease, as well as NAFLD itself [2]. It is a risk factor for the progression of fatty liver to non-alcoholic steatohepatitis (NASH), fibrosis, cirrhosis and liver carcinoma [3, 4]. So far, there has been no licensed drug for the treatment of NAFLD [1]. It seems that fat cells are the main regulator of energy homeostasis in the body. Adiponectin, which is one types of adipokines secreted from adipose tissue, plays an essential role in the adjuster of insulin sensitivity and the pathogenesis of metabolic syndrome [4]. Adiponectin is secreted from adipocytes into the bloodstream as three oligomeric complexes including trimer (67 k Da), hexamer (complex of two trimers, 130 k Da) and a high molecular weight (300 k Da) [8]. Adiponectin as a monomer is undetectable in native status. Polymerization is a fundamental mechanism in compiler the biological movement of the protein [9]. Thus, adiponectin forms trimers (low molecular weight form or LMW) following the establishment of hydrophobic bonds between the globular domains and noncovalent interactions within α-helices of the collagenous domains [4]. Recent studies have shown that, farther to environmental factors, genetics also play a role in the development of non-alcoholic fatty liver disease [6]. Genes related to insulin resistance including those coding adiponectin, resistin leptin, may affect the spread of non-alcoholic fatty liver disease [7]. There is progressive evidence, which shows the fact that the correlation of single nucleotide polymorphisms (SNPs) of the ADIPOQ gene with the serum level of adiponectin in blood serum has been established. Three common SNPs, rs266729 (− 11377 C > G), rs17300539 (11391 G > A) and rs1501299 (+ 276 G > T) in the promoter and intron region of the ADIPOQ gene, correspondingly, have been copiously studied by epidemiological studies. Variant alleles at rs266729, which is related to lower adiponectin levels, has been displayed to be connected with obesity [8]. Research by Trilete and his colleagues in the United States showed that the rs17300539 (-11391 G > A) polymorphism inhibits adiponectin transudation and fall off plasma adiponectin [9]. Studies in different populations on the rs17300539 polymorphism have found that the G allele leads to grow the secretion of the adiponectin gene and its addition to the blood [10]. Different alleles at rs266729, which are associated with low levels of adiponectin, have been shown to be associated with susceptibility to obesity. Another polymorphism, rs1501299, is associated with abated expression of adiponectin, which may lead to weight gain and insulin resistance due to its role. Several studies have investigated the association between adiponectin gene polymorphisms and the risk of NAFLD [8]. Past research in patients with NAFLD has demonstrated the fact that carriers of the G allele of rs266729 have less serum triglyceride (TG), total cholesterol (TC), fasting plasma glucose (FPG) and low-density lipoprotein (LDL) levels compared to participants without G allele [11]. Insulin resistance is necessary for the development of NAFLD (12). NAFLD is also collaborated with IR in tissues other than the liver, such as muscle and adipose tissue [12, 13, 14]. Fernando and colleagues have shown that smooth low accumulation of hepatic TG (between 2 and 5%) coincides with decreased insulin sensitivity in liver, muscle, and adipose tissue [15]; On the other hand, there is no linear increase in inflammation, ballooning or fibrosis with intrahepatic triglyceride content [16]. IR of adipose tissue is a very important risk factor for worsening of liver disease [11, 12]. NAFLD has been shown to be closely related to insulin resistance, as 70–80% of obese and diabetic patients have NAFLD [17, 18]. Immune cells macrophages / Kupffer cells, natural killer cells, and T cells subsidize to the gradation of NASH make strong their quiescent curative goals. Especially, hepatic macrophages, which obtained from bone marrow macrophages are the main immune cells that exude inflammatory mediators, such as tumor necrosis factor (TNF)-α and interleukin (IL)-1β, leading to systemic insulin resistance and NASH [19]. Macrophages can be classified as M1, or “classically activated” pro-inflammatory macrophages, and M2, or “alternatively activated” non-inflammatory macrophages [20, 21, 22]. The bad adjustment and polarization of M1 and M2 macrophages are closely connected to multiple metabolic disorders, among them, obesity, insulin resistance, and NAFLD. Earlier we found that redundant hepatic lipid assemblage creates the activation of macrophages/Kuepfer cells to aggravate insulin resistance, as well as hepatic inflammation and fibro genesis [23]. In this study, the frequency of rs266729, rs1501299 and rs17300539 polymorphism and their relationship with biochemical, anthropometric parameters and NAFLD in an Iranian population have been investigated.

Study design and anthropometric parameters

This research was conducted in a case-control method. In this study, among the participants referred to Bo Ali and Amirul Mominin Hospitals in Tehran (between the period of 15 April 2016 to 20 October 2016), whose diagnosis of non-alcoholic fatty liver was confirmed by ultrasound, 80 people were selected as patient cases. It was normal, 80 people were selected as controls. The sample size was determined using MedCalc (version 14.8.1) Software. Based on α = 0.05 and power = 80% and difference of mean 0.8 mg/l (main analyze = Adiponectin) SD 1.8 mg/l, Ratio 1:1, in each group 80 participants calculated. Current diagnostic methods for NAFLD include ultrasound, computed tomography (CT), magnetic resonance imaging (MRI), liver biopsy, and laboratory tests. In this research, sonography and MRI were used to definitively diagnose non-alcoholic fatty liver disease under the supervision of a gastroenterology and liver specialist [24]. The study protocol was in accordance with the Helsinki declaration and was approved by the research ethics committee of Islamic Azad University, Tehran Medical Branch. Written informed consent was obtained from all the participants that take part in the study with full information about the aim of study.

Biochemical assessment

The measurement of biochemical variables and determination of polymorphism were carried out in ̎ Endocrine and Metabolism Research Institute of Shahid Beheshti University ̎ of Iran. All selected individuals were Iranians. The condition for inclusion in the study was non-consumption of alcohol and metabolic drugs, because drugs such as metformin (MET can modulate several signaling pathways including AMP-activated protein kinase signaling), which are prescribed for the treatment of Non-alcoholic fatty liver disease, cause changes in the level of the hormone adiponectin [25,26]. In order to comply with ethical standards, information about the research and goals were given to individuals and if they had full consent, they were included in this study. A general and medical questionnaire including medical history, drug use, etc. was completed for each person [15]. Then the quantity of 10 ml blood sample was taken from participants. Five ml of the sample was poured into a tube containing EDTA and the remaining 5 ml into a tube without anticoagulant. After blood clotting in the anticoagulant tube, the serum was separated by centrifugation (10 minutes at 3000 RPM) and stored at -80 ° C. Genomic DNA was extracted from whole blood tubes containing anticoagulants by salting out method [14] and stored at -20 ° C. Adiponectin and insulin levels were determined using Mercodia ELISA kit. In this study, fasting blood glucose, total cholesterol, triglyceride, LDL- C, HDL-C, ALT and AST were measured using Pars Azmoon test kit and by Biotechnica model BT3500.

PCR amplification

PCR-RFLP technique was used to determine the genotype of rs266729, rs1501299 and rs17300539 polymorphisms in adiponectin gene. This required two primers for each polymorphism, which was designed by Gene runner and Oligo software, and its sequence is shown in (Table 1).

Table 1

Primers used for PCR
Polymorphisms	Length of part	Forward primer (5'→3') Reverse Primer (5'→3')
rs17300539 (-11391 G/A) rs266729 (-11377 G/C) rs1501299 (+ 276G/T)	(GG 167bp,296bp) (GA198bp,167bp,296bp) (AA296bp) (GG 183bp,113b) (CG 113bp, 183bp,296bp) (CC 296bp) (GT 196bp,148b) (GG 148bp, 48bp) (TT 196bp)	AGGCTCTGTGTGGACT GTGGA CCTGGAGAACTGGAA GCTGC AGGCTCTGTGTGGACT GTGGA CCTGGAGAACTGGAA GCTGC GGCCTCTTTCATCACAGACC AGATGCAGCAAAGCCAAAGT

The specific performance of the primers was confirmed by the Blast database. To determine polymorphisms, PCR first performed a sequence of 296 bp carrying the polymorphisms rs17300539 and rs266729 of the adiponectin gene (these two polymorphisms are both located in the promoter region and almost adjacent to each other). Thereby, one primer was designed for both polymorphisms. The DNA fragment containing rs1501299 polymorphism of adiponectin gene with 196 bp was amplified by PCR. (Table 1). For PCR reaction, a reaction mixture with a final volume of 25 µl including mix Master (dNTP, Taq polymerase, MgCl2), 1 µl of genomic DNA, 1 µl of each primer with a concentration of 10 picomol / µl and distilled water was prepared. All PCR required materials were obtained from Sinagen Company. The program was set for the thermocycler for better primer performance in two stages, and thus was the initial denaturation step for 10 minutes at 94 ° C, then 10 cycles per cycle, denaturation at 94 ° C for 45 seconds binding of the primers at 65 ° C for 45 seconds and spread at 72 ° C for one minute. Then 20 cycles including denaturation at 94 ° C for 45 seconds, annealing of primers at 60 ° C for 45 seconds, expansion at 72 ° C for one minute and at the end of 20 cycles final expansion at 72 for 5 min. The amplification accuracy of the desired part was investigated by electrophoresis on 8% acrylamide gel and the gel was stained using silver nitrate. For rs1501299 in the ADIPOQ gene, 10 min at 93°C, followed by 35 cycles of 45 seconds at 93°C, 30 s at 58°C, 45 s at 72°C and final extension step was carried out at 72 ºC for 5 min. Then the PCR products were digested by MSPI, HhaI and BsmI restriction enzymes, which were detected to be rs17300539, rs266729 and rs1501299, respectively.

Statistical analysis

statistical analysis was performed using spss 21.0 software (SPSS, Chicago, IL, USA), descriptive and inferential tests including Kolmogorov-Smirnov test (to distribute the studied variables), Mann-Whitney test (for comparison between case and control groups in case of non-normal condition (independent t-test, Chi-square or Fisher test) For qualitative factors and logistic regression to investigate the relationship between disease risk and genotypes. The level of significance was P < 0.05. Normal quantitative variables ± as mean standard deviation and other quantitative variables that had skew distribution as mediocre quarterly amplitude and qualitative variables were expressed as percentages.

In this study, 80 people as a patient group and 80 people as the title of the control group was included in the study. Mean age of patients was 44.32 and healthy subjects was 35.42 years old. 46 healthy women (57. 5%), 34 healthy men (42.5%), 37 sick women (46.3%) and 43 male patients (53.7%) were included in the study with a difference of two the groups were not significant in terms of gender. (Table 2).

Table 2

**Distribution of demographic variables and biochemical profiles in the study groups**.
Characteristics	Control (N = 80)	Case (N = 80) p-value
Male (%)	34.46	43.37 NS
Age(years)	35.42 ± 8.5	6 NS.9 ± 33.44
(Kg/M²) BMI	61.23 ± 9.2	28.74 ± 4.6 P < 0.0001
(Mg/Dl) FPG	8.03 ± 92.08	91.98 ± 13.8 P < 0.0001
Cholesterol (Mg / DL)	105.68 ± 25.01	152.01 ± 69.9 NS
Triglyceride (Mg / DL)	97.5 ± 42.9	170.30 ± 43.2 P < 0.0001
Mg /DL)) LDL	89.06 ± 22.5	94.16 ± 30.6 NS
HDL (Mg/ DL)	48.42 ± 12.1	35.15 ± 12.6 P < 0.0001
(IU/ L) AST	16.55 ± 4.4	26.44 ± 8.3 P < 0.0001
( IU/ L) ALT	17.91 ± 7.8	35.33 ± 17.2 P < 0.0001
(Mm/L) Insulin	11.57 ± 11.4	22.45 ± 33 NS
Adiponectin (Mm/L)	71.43 ± 30.4	53.89 ± 25.6 P < 0.0001
Dystolic Pressure(mmHg)	7.95 ± 0.35	8.09 ± 0.67 P < 0.0001
Systolic Pressure(mmHg)	11.48 ± 1.3	12.2 ± 1.8 NS

BMI Body mass index, lipoprotein, LDL low-density lipoprotein, HDL higher -density lipoprotein,

FPG fasting plasma glucose AST aspartate aminotransferase ALT alanine aminotransferase.

Result of electrophoresis of PCR products of rs17300539, rs266729 and rs1501299 polymorphism was performed using RFLP technique which is shown in Fig. 1,2&3. In rs17300539 polymorphism, GA genotype consists of three bands with lengths of 296, 167 and 129 bp, GG genotype consists of two bands with lengths of 129 and 167 bp and AA genotype contains one fragment with a length of 296 bp which was not observed in the present study (Fig. 1).

The frequency of GG genotype in rs17300539 polymorphism in healthy and sick individuals was 96.3% and 90% respectively, and the frequency of GA genotype was 3.8% and 10%, respectively. Regression analysis in rs17300539 showed no relationship between GG and GA genotypes and Non-alcoholic fatty liver disease. The frequency of G allele in the healthy and diseased groups was 98% and 95%, respectively. Regression analysis of G allele showed that there was no significant difference in frequency of G allele between healthy and patient groups (P > 0.05). The relationship between GG and GA genotypes of rs17300539 of adiponectin gene polymorphism with biochemical and anthropometric variables was investigated in both healthy and sick groups. The results showed that the body mass index and diastolic blood pressure in patients carrying the GA genotype are higher than those carrying the GG genotype. In the healthy group, no significant relationship was observed between biochemical and anthropometric variables with GG and GA genotypes (Table 4). The level of triglyceride and AST enzyme in women with GA genotype is higher than women with GG (P < 0.05). Sick men who carriers GA genotype had higher diastolic pressure than carriers of GG genotype (Table 5).

Table 5 does not provide information about rs1501300 polymorphism due to the lack of significant differences between genotypes in the amount of parameters.

In rs266729 polymorphism, CG genotype consists of three bands with lengths of 296, 183 and 113 bp, GG genotype consists of two bands with lengths of 183 and 113 bp and CC genotype consists of one fragment with length of 296 bp (Fig. 2).

Regression analysis on rs266729 indicated that there was no association between CC and CG genotypes with Non-alcoholic fatty liver disease. The frequency of C allele in healthy and patient groups was 96.95% and 95.35%, respectively. C-allele regression analysis showed that there was no significant difference between C-allele frequency in healthy and patient groups (P < 0.05) (Table 3).

Table 3

Regression analysis of polymorphism genotypes rs1501299, rs266729, rs17300539
Polymorphism	Genotype	Control (N = 80)	Case (N = 80)	OR(CI=%95)	P- value Insulin -sensitive Insulin resistant OR (95%CI) p-value
rs17300539	GG GA G A	72(%90) 8(%10) 152(%95) 8(%0.5)	77(%96.3) 3(%3.8) 157(%98) 3(%2)	2.85(0.2–23.4) 0.35(0.09–1.37) 2.75(0.72–10.58) 0.36(0.09–1.39)	NS 87(96.7) 62(88.6) 0.27(0.07–1.05) 0.058 NS 3(3.3) 8(11.4) 0.27(0.07–1.05) 0.058 NS NS
rs266729	CC CG GG G C	50(%62.5) 30(37.5) 0(0) 30(%3.15) 130(%96.95)	48(%60.0) 30(37.5) 2(2.5) 34(%4.65) 126(%95.35)	0.90(0.48–1.70) 1.0(0.53–1.90) 1.73(0.4–1.3) 2.86(0.64–19.58)	NS 52(57.8) 46 (65.7) 1.40 (0.73–2.67) 0.3.7 NS 36(40) 24(34.3) 0.78(0.41–1.50) 0.459 NS 2(2.2) 0 (0) - - NS NS
rs1501299	TT GT GG T G	3(%3.8) 40(%50) 37(%46.2) 38(%47.5) 20(%36)	1(%1.3) 54(%69.2) 23(%29.5) 34(%30) 29 (%52)	0.33(0.03–3.28) 2.25(1.17–4.31) 0.49(0.25–0.94) 0.47(0.25–0.91) 0.47(0.25–0.88)	2(2.9) 1.33(0.18–9.71) 0.459 2(2.2) NS . 0001 54(60) 40(58.8) 0.95(0.50–1.81) 0.881 0/>P 0001 34(37.8) 26 (38.2) 1.02(0.53–1.95) 0.953 /0 > P 0001 /0 > P 0001 /0 > P

The relationship of CG, GG and CC genotypes of ADIPOQ gene of rs266729 with biochemical and anthropometric variables was investigated in both healthy and patient groups. CG genotypes of ADIPOQ gene rs266729 showed a decrease in adiponectin level in women (P < 0.05). There was a relationship between rs266729 polymorphism and AST in men (P < 0.05) (Table 5). In rs1501299 polymorphism, GT genotype with three bands with lengths of 196bp 148bp, 48bp and GG genotype with two bands with lengths of 148bp, 48bp and TT genotype with one band with 196bp length are identified (Fig. 3).

The frequency of GG genotype in rs1501299 polymorphism in healthy and sick individuals was 50% and 69.5%, respectively, and the frequency of GT genotype in patients was 29.5% and healthy individuals was 49.2%. Regression analysis in rs1501299 indicated that there was association between TG and GG genotypes with Non-alcoholic fatty liver disease. The frequency of G allele in the healthy and diseased groups was 74.1% and 84%, respectively. Regression analysis of G allele showed that there is a significant difference between the frequency of G allele in healthy and patient groups (P < 0.05) (Table 3). In the regression analysis performed between sick and healthy individuals, the results were as follows: the number of carriers of GT genotype was higher in patients and the number of carriers of GG genotype was higher in healthy individuals (Table 3, Table 4). In a study conducted on rs1501299 polymorphism, a significant difference was observed in BMI level between patients who carried GG and GT genotypes. The level of BMI was reported to be higher in patients who carried GT genotype than GG genotype (P < 0.05) (Table 4).

Table 4: Relationship between rs1501299, rs266729 and rs17300539 polymorphisms with Biochemical and Anthropometric variables

Table 4 does not mention TT, CC and AA genotypes due to their small number

Serum triglyceride levels, fasting blood sugar, HDL, AST, ALT and diastolic blood pressure were higher in patients than in healthy individuals. Adiponectin levels in patients were lower than healthy individuals and body mass index (BMI) was higher in patients (P < 0.05) (Table 2).

Table 5 Investigation of biochemical parameters and body mass index in rs17300539 and rs266729 polymorphisms according to gender

There was no difference in haplotype frequencies from ADIPQ SNPs (rs17300539, rs266729, rs1501299) so the table was omitted (Table 2). We investigated the distribution of ADIPOQ gene polymorphisms among insulin-resistant (HOMA-IR < 2.6) and non-insulin-resistant subjects (HOMA-IR ≥ 2.6). Results showed that there was no significant difference in the distribution of allele and genotype frequencies between the insulin-resistant and non-insulin-resistant groups (Table 3).

In the present study, the frequency of polymorphisms rs17300539, rs266729 and rs1501299 of adiponectin gene and its relationship with biochemical variables, Insulin resistant, body mass index and NAFLD were investigated. Many studies have shown that Non-alcoholic fatty liver disease increases the chances of developing metabolic diseases [26]. In the study of rs17300539 polymorphism of adiponectin gene and its relationship with biochemical variables and body mass index, there was a significant difference in the mean of triglyceride AST and body mass index in carriers of GG genotype compared to GA genotype. In rs17300539 polymorphism, the triglyceride level was showed to be higher in woman with GA genotype compared to the woman with GG genotype, and this difference was also significant. Diastolic blood pressure in men with GA at rs17300539 polymorphism was higher than in GG carriers. In the present study, the insulin level of GA and GG carriers, were not statistically significant. The AST serum level in women who carriers GA genotype of rs17300539 of adiponectin gene, was higher than those who carries GG genotype. Moreover, the rate of diastolic blood pressure in men with GA genotype was higher than that of GG carriers. In the studied population, analysis of the data did not show a significant difference in the frequency of genotypes between healthy and sick groups; means there was no association between the genotypes of this polymorphism and Non-alcoholic fatty liver disease. Contrary to our findings, Hivert and his cooperator have shown that the G allele in the rs17300539 polymorphism of the adiponectin gene is associated with an increased risk of metabolic syndrome and an increased risk of type 2 diabetes [27]. A study done by Henneman P and his cooperator on 1285, women and 967 men in the United States showed that rs17300539 polymorphism acts as an inhibitor of adiponectin secretion, reducing plasma adiponectin and its function [28]. A study done by Wassel and his cooperator, in a population with cardiovascular disease also confirmed the association of rs17300539 polymorphism with an increase in serum adiponectin levels [29]. Vasseur and his cooperator, also observed a significant relationship between alleles and increased serum adiponectin levels in the population of French Caucasians [30]. Also, Morandi and his cooperator In the Italian population showed that adiponectin and insulin levels were lower in carriers of GG genotypes of rs17300539 polymorphism, there is a relationship between this polymorphism with serum levels of adiponectin, fasting blood sugar, fasting insulin levels, high density lipoprotein, cholesterol and triglycerides [30]. Contrary to these studies, in our study, no correlation was found between polymorphism genotypes and insulin and adiponectin levels, but a significant relationship was observed between genotypes of rs17300539 and body mass index and diastolic blood pressure. Also, a significant relationship was found between triglyceride levels and genotypes in sick women. In the present study, result shows that the presence of G allele is not effective on insulin levels. In women with Non-alcoholic fatty liver disease, serum AST levels in GA genotype carriers of rs17300539 of adiponectin gene were higher than GG genotype carriers. As well as this, Diastolic blood pressure in men with NAFLD who carries GA genotype, was higher than GG genotype. According to the results of a study conducted by Menzaghi and his cooperator, on a Caucasian population in central Italy, the carriers of A allele of rs17300539 polymorphism had lower weight and BMI than GG carriers [32]. Besides this, research conducted by Morandi and his cooperator on a genuine European population showed that allele A carriers had lower BMIs than GG carriers [30]. In research conducted by Jun Wang and his colleagues showed that the G allele of rs17300539 increases the likelihood of NAFLD that is in contrast to our result [33]. According to a study conducted by Henneman P and his cooperator on patients with Non-alcoholic fatty liver disease, the BMI of GA carriers was higher than that of GG carriers [27] that was in a same way with our result. In a research conducted by Morandi and his cooperator, the carriers of AA and GA genotypes of rs17300539 polymorphism, who had obesity, were high insulin resistant, but this association was not significant [30]. In our study population, rs266729 polymorphism was also studied. Statistical analysis did not show a significant difference in the frequency of genotypes between healthy and patient groups, there was no association between these genotypes and increased risk of Non-alcoholic fatty liver disease. In the current study, in rs266729 polymorphism, AST level was higher in men who carriers CG than CC genotype and adiponectin level was higher in women carrying CC genotype. Hashemi and his colleagues have shown that carriers of the CG genotype in rs266729 polymorphism of the adiponectin gene, the level of adiponectin decreases, and the probability of non-alcoholic fatty liver disease increases in the carriers of the G allele [34]. In a study consist of 150 people with non-alcoholic fatty liver disease in Egypt, Moshira Zaki found that the carriers of the G allele increased the risk of developing non-alcoholic fatty liver disease compared to carriers of the C allele. Likewise, serum adiponectin levels are increased in CC genotype carriers, which is similar to our results [35]. In a study conducted on people with NAFLD who carried the G allele of the rs266729 polymorphism, Rosa Divella and his cooperator came to this conclusion that these people are more likely to be obese and have insulin resistance [36]. The research that was done in Pakistan was similar to our result. A study conducted by Amina Nadeem and his cooperator on people with diabetes found no link between rs266729 polymorphism and diabetes [37]. In a study conducted by Moushira Zaki in patients with fatty liver, the increase of insulin resistance in GG and GC genotypes were higher than CC genotype carriers in rs266729 polymorphism [35]. In our study, increasing of insulin level in case group with CC genotype was not significant. In the study done by Rosa Divella and her colleagues, insulin resistance was increased in the carriers of rs266729 polymorphism with liver metastasis, these changes were not significant in our studies [36]. We examined the rs1501299 polymorphism in the present study. In our study population, the frequency of the T allele in the rs1501299 polymorphism in healthy individuals was significantly different, the frequency of the G allele in the patient population and in the healthy population was significantly different, based on statistical analysis. There was a significant different between GG genotype in healthy group and the patient group. There was a significant difference in the frequency of GT genotype between the patient group and the healthy group. According to our study, GG genotype carriers are less likely to suffer from Non-alcoholic fatty liver disease. Carriers of the GT genotype are also more likely to develop NAFLD, so we conclude that the presence of the G allele reduces the risk of developing nonalcoholic fatty liver disease. In contrast to our research, Hashemi and his colleagues did not find a relationship between the presence or absence of different alleles of the rs1501299 polymorphism and the susceptibility to Non-alcoholic fatty liver disease in their study [33]. Jiaxing Liu and his colleagues concluded that the risk of Non-alcoholic fatty liver disease increases in carriers of different genotypes of rs1501299 polymorphism. [38]. Mengwei Liu and his colleagues concluded that carriers of rs1501299 polymorphism genotypes are susceptible to Non-alcoholic fatty liver disease [38]. In the present study among people with Non-alcoholic fatty liver disease, BMI in GT genotype carriers was higher than GG carriers, which was also statistically significant. In a study conducted by Hashemi and his cooperator on rs1501299 polymorphism, body mass index, waist circumference and systolic blood pressure were reported to be higher in people with Non-alcoholic fatty liver disease [34]. This is according to our research in terms of body mass index. Hong-Jue Li and his colleagues gained result in patients with Non-alcoholic fatty liver disease, which carries polymorphism of rs1501299 insulin resistance was high, in our study, these changes were not significant [40]. Mohammadzadeh and his colleagues showed that there was not a significant relationship between rs1501299 and HOMA -IR, similar to our research [41]. Prakash and his colleagues showed that there is a significant relationship between the carriers of rs1501299 of the adiponectin gene and HOMA IR, which is in contrary to our research [42]. Jung and his colleagues showed insulin resistance in hepatocellular carcinoma, especially in people with metabolic diseases which is in contrary to our research [43]. Reyhane Ebrahimi and Mavilia showed that the level of adiponectin in obese people with non-alcoholic fatty liver disease was lower than the control group, this finding is similar to our research [44, 45, 46]. Some of adipokines have important effects, including the modulation of injury and fibrosis [47]. Non-alcoholic fatty liver disease (NAFLD) is defined as the most prevalent liver diseases [48] that inflammation and subsequent fibrosis and cirrhosis are critical steps in NAFLD pathology [49]. Differences between the results of our research and some other studies in this field can be due to differences in sample size, the effect of environmental factors, age, race of participants, the effects of other polymorphisms and genes and gene overlap. The limitations of this study were the incidence of fatty liver in old age and non-consumption of alcohol and metabolic drugs in patients. Healthy people and patients with Non-alcoholic fatty liver disease who participated in this project had no history of taking metabolic drugs for treatment, which is one of the most important features of this project.

In general, in rs17300539 polymorphism, the presence of G allele is effective in reducing the complications of Non-alcoholic fatty liver disease. In rs1501299 polymorphism, the presence of G allele increases the risk of Non-alcoholic fatty liver disease and rs1501299 polymorphism was associated with NAFLD. In rs266729 polymorphism, the presence of allele G does not affect the risk of increasing non -alcoholic fatty liver disease.

SNPs

Single nucleotide polymorphisms

NAFLD

Non-alcoholic fatty liver disease

PCR- RFLP

Polymerase chain reaction–restriction fragment length polymorphism

ELISA

Enzyme-linked immunosorbent assay

AST

Aspartate Aminotransferase

ALT

Alanine Aminotransferase

HDL-C

High-density lipoprotein cholesterol

BMI

Body mass index

Triglyceride

Total cholesterol

FPG

Fasting plasma glucose

LDL

Low-density lipoprotein

TNF

Tumor necrosis factor

Interleukin.

Acknowledgments

We declare our fully gratitude and appreciation from all the people who participated in this research and dear friends who helps us in the Endocrine Research Institute of Shahid Beheshti University.

Author contributions

F.R. wrote the draft paper, M.N. and M.H. revised the manuscript and improved the language, H.K. and L.A.M. analyzed the data, and J.R.M. designed the study. All authors have approved the final article.

Funding

This work was supported by the Research Institute for Endocrine Sciences, Shahid Beheshti University of Medical Sciences, Tehran, Iran. funders had no role in study design, data analysis, interpretation of the results, the decision to publish, or preparation of the manuscript.

Availability of data and materials

All data generated or analyzed during this study are available from the corresponding author on reasonable request.

Competing interests

The authors declare no competing financial interest.

Ethics approval and consent to participate

The study was approved by the ethics Committee of Islamic Azad University, Tehran medical branch (IR.IAU.TMU.REC.1396.271. The study protocol was also in accordance with the Helsinki declaration. Written informed consent was obtained from all the participants that take part in the study with full information about the aim of study.

Consent for publication

Not applicable.

Yki-Järvinen H, Luukkonen PK, Hodson L, et al. (2021) Dietary carbohydrates and fats in nonalcoholic fatty liver disease. Nat Rev Gastroenterol Hepatol 18(11):770-86.
Mazzolini G, Sowa JP, Atorrasagasti C, et al. (2020) Significance of simple steatosis: an update on the clinical and molecular evidence. Cells 9(11):2458.
Farrell GC, Wong VW, Chitturi S (2013) NAFLD in Asia—as common and important as in the West. Nat Rev Gastroenterol Hepatol 10(5):307-18.
Barbe A, Bongrani A, Mellouk N, et al. (2019) Mechanisms of adiponectin action in fertility: an overview from gametogenesis to gestation in humans and animal models in normal and pathological conditions. Int J Mol Sci 20(7):1526.
Møhlenberg M, Terczynska-Dyla E, Thomsen KL, et al. (2019) The role of IFN in the development of NAFLD and NASH. Cytokine 124:154519.
Rezaei, F., Nezhadali, M., & Hedayati, M, (2018) Association of adiponectin rs17300539 gene polymorphism with a non-alcoholic fatty liver disease in an Iranian population. KAUMS Journal (FEYZ) 22(4), 379-386.
Kitade H, Chen G, Ni Y, Ota T, (2017) Nonalcoholic fatty liver disease and insulin resistance: new insights and potential new treatments. Nutrients 9(4):387.
Abenavoli L, Milic N, Di Renzo L, et al. (2016) Metabolic aspects of adult patients with nonalcoholic fatty liver disease. World J. Gastroenterol 22(31):7006.
Almeda-Valdes P, Aguilar-Olivos N, Uribe M, et al. (2014) Common features of the metabolic syndrome and nonalcoholic fatty liver disease. Rev Recent Clin Trials 9(3):148-58.
Machado MV, Cortez-Pinto H, (2016) Diet, microbiota, obesity, and NAFLD: a dangerous quartet. Int. J. Mol. Sci 17(4):481.
Matsuzawa N, Takamura T, Kurita S, et al. (2007) Lipid-induced oxidative stress causes steatohepatitis in mice fed an atherogenic diet. J Hepatol 46: 1392–1403.
Marchesini G, Brizi M, Morselli-Labate AM, et al. (1999) Association of nonalcoholic fatty liver disease with insulin resistance. Am J Med 107(5):450-5.
Ide T, Shimano H, Yahagi N, et al. (2004) SREBPs suppress IRS-2-mediated insulin signalling in the liver. Nat cell biol 6(4):351-7.
Gastaldelli A, Sabatini S, Carli F, et al. (2021) PPAR‐γ‐induced changes in visceral fat and adiponectin levels are associated with improvement of steatohepatitis in patients with NASH. Liver 41(11):2659-70.
Sanyal AJ, Brunt EM, Kleiner DE, et al. (2011) Endpoints and clinical trial design for nonalcoholic steatohepatitis. J Hepatol 54:344-353.
Bril F, Barb D, Portillo‐Sanchez P, et al. (2017) Metabolic and histological implications of intrahepatic triglyceride content in nonalcoholic fatty liver disease. J Hepatol65(4):1132-44.
Loomba R, Abraham M, Unalp A, et al. (2012) Nonalcoholic Steatohepatitis Clinical Research Network. Association between diabetes, family history of diabetes, and risk of nonalcoholic steatohepatitis and fibrosis. J Hepatol 56(3):943-51.
Williams CD, Stengel J, Asike MI, et al. (2011) Prevalence of nonalcoholic fatty liver disease and nonalcoholic steatohepatitis among a largely middle-aged population utilizing ultrasound and liver biopsy: a prospective study. J Gastroenterol 140(1):124-31.
Odegaard JI, Ricardo-Gonzalez RR, Eagle AR, et al. (2008) Alternative M2 activation of Kupffer cells by PPARδ ameliorates obesity-induced insulin resistance. Cell metab 7(6):496-507.
Martinez FO, Gordon S, (2014) The M1 and M2 paradigm of macrophage activation: time for reassessment. F1000prime rep 6:13.
Sica A, Mantovani A, (2012) Macrophage plasticity and polarization: in vivo veritas. J Clin Invest 122(3):787-95.
Haas JT, Francque S, Staels B, (2016) Pathophysiology and mechanisms of nonalcoholic fatty liver disease. Annu Rev Physiol,78:181-205.
Chen J, Deng X, Liu Y, et al. (2020) Kupffer cells in non-alcoholic fatty liver disease: friend or foe? Int J Biol Sci, 16(13):2367.
Fu, Y., Zhou, Y., Shen, L., et al. (2022). Diagnostic and therapeutic strategies for non-alcoholic fatty liver disease. Frontiers in Pharmacology 13, 973366.
Nezhadali M, Mesbah-Namin SA, Hedayati M, et al. (2022) Serum adiponectin and cortisol levels are not affected by studied ADIPOQ gene variants: Tehran lipid and glucose study. BMC EndocrDisord 22(1):1-0.
Li B, Po SS, Zhang B, et al. (2020) Metformin regulates adiponectin signalling in epicardial adipose tissue and reduces atrial fibrillation vulnerability. J Cell Mol Med 24(14):7751-66.
Wei Z, Li-Qun Z, Xiao-Ling H, et al. (2016) Association of adiponectin gene polymorphisms and additional gene-gene interaction with nonalcoholic fatty liver disease in the Chinese Han population. Hepatol Int 10:511-7.
Henneman P, Aulchenko YS, Frants RR, et al. (2010) Genetic Architecture of Plasma Adiponectin Overlaps with the Genetics of Metabolic Syndrome–Related Traits. Diabetes care 33(4):908-13.
Hivert MF, Manning AK, McAteer JB, et al. (2008) Common variants in the adiponectin gene (ADIPOQ) associated with plasma adiponectin levels, type 2 diabetes, and diabetes-related quantitative traits: the Framingham Offspring Study. Diabetes 57(12):3353-9.
Wassel CL, Pankow JS, Jacobs Jr DR, et al. (2010) Variants in the adiponectin gene and serum adiponectin: the Coronary Artery Development in Young Adults (CARDIA) Study. Obesity 18(12):2333-8.
Vasseur F, Helbecque N, Lobbens S, et al. (2005) Hypoadiponectinaemia and high risk of type 2 diabetes are associated with adiponectin-encoding (ACDC) gene promoter variants in morbid obesity: evidence for a role of ACDC in diabesity. Diabetologia 48:892-9.
Morandi A, Maffeis C, Lobbens S, et al. (2010) Early detrimental metabolic outcomes of rs17300539‐A allele of ADIPOQ gene despite higher adiponectinemia. Obesity18(7):1469-73.
Menzaghi C, Ercolino T, Salvemini L, et al. (2004) Multigenic control of serum adiponectin levels: evidence for a role of the APM1 gene and a locus on 14q13. Physiol genomics19(2):170-4.
Wang J, Guo XF, Yu SJ, et al. (2014) Adiponectin polymorphisms and non‐alcoholic fatty liver disease risk: a meta‐analysis. J Gastroenterol Hepatol 29(7):1396-405.
Hashemi M, Bojd HH, Nasab EE, et al. (2013) Association of adiponectin rs1501299 and rs266729 gene polymorphisms with nonalcoholic fatty liver disease. Hepat mont 13(5).
Zaki M, (2020) Association of Adiponectin− 11377 C/G (rs266729) Gene Polymorphism with Nonalcoholic Fatty Liver Disease and Metabolic Features in Egyptian Women. Al-Azhar University Journal of Virus Researches and Studies 2(1):1-0.
Divella R, Daniele A, De Luca R, et al. (2019) Synergism of adipocytokine profile and ADIPOQ/TNF-α polymorphisms in NAFLD-associated MetS predict colorectal liver metastases outgrowth. Cancer Genom. Proteom 16(6):519-30.
Khalifa AS, Elshebiny A, Eed EM, et al. (2020) Genetic variations of tumor necrosis factor-α and prostaglandin-endoperoxide synthase 2 genes among Egyptian patients with type 2 diabetes mellitus and diabetic nephropathy. Gene Rep 29:101678.
Liu J, Xing J, Wang B, et al. (2019) Correlation between adiponectin gene rs1501299 polymorphism and nonalcoholic fatty liver disease susceptibility: a systematic review and meta-analysis. Med sci monit 25:1078.
Liu M, Liu S, Shang M, et al. (2019) Association between ADIPOQ G276T and C11377G polymorphisms and the risk of non‐alcoholic fatty liver disease: An updated meta‐analysis. Mol Genet Genomic Med 7(5):e624.
Li HJ, Li CP, Zhang C, et al. (2015) Association of Adiponectin gene polymorphisms and nonalcoholic fatty liver disease. Int J Clin Exp Med 8(9):16676.
Mohammadzadeh G, Ghaffari MA, Heibar H, et al. (2016) Association of two common single nucleotide polymorphisms (+ 45T/G and+ 276G/T) of ADIPOQ gene with coronary artery disease in type 2 diabetic patients. Iran Biomed J 20(3):152.
Prakash J, Mittal B, Awasthi S, et al. (2015) Association of adiponectin gene polymorphism with adiponectin levels and risk for insulin resistance syndrome. Int J Prev Med 2015;6.
Kim JH, Sinn DH, Gwak GY, et al. (2017) Insulin resistance and the risk of hepatocellular carcinoma in chronic hepatitis B patients. J gastroenterol Hepatol 32(5):1100-6.
Ebrahimi R, Shanaki M, Mohassel Azadi S, et al. (2022) Low level of adiponectin predicts the development of Nonalcoholic fatty liver disease: is it irrespective to visceral adiposity index, visceral adipose tissue thickness and other obesity indices?Arch. Physiol. Biochem 128(1):24-31.
Mavilia MG, Wu GY, (2021) Liver and serum adiponectin levels in non‐alcoholic fatty liver disease. J Dig Dis 22(4):214-21.
Nezhadali M, Mesbah-Namin SA, Hedayati M, et al. (2022) Serum adiponectin and cortisol levels are not affected by studied ADIPOQ gene variants: Tehran lipid and glucose study. BMC Endocrine Disorders 2022;22(1):1-0.
Wang J, Brymora, George J, (2008) Roles of adipokines in liver injury and fibrosis. Expert Rev Gastroenterol Hepatol 2(1):47-57.
Vakili, O., Borji, M., Saffari-Chaleshtori, J., et al. (2023) Ameliorative effects of bilirubin on cell culture model of non-alcoholic fatty liver disease. Molecular Biology Reports 50(5), 4411-4422.
Montefusco DJ, Allegood JC, Spiegel S, et al. (2018) Non-alcoholic fatty liver disease: insights from sphingolipidomics. Biochem. Biophys. Res. Commun 504(3): 608-16.

Download PDF

Editorial decision: Returned Without Review
12 Sep, 2023
Reviewers invited by journal
13 Jul, 2023
Editor assigned by journal
10 Jul, 2023
First submitted to journal
08 Jul, 2023

You are reading this latest preprint version

Association of ADIPOQ gene variants with adiponectin levels, insulin resistance and non-alcoholic fatty liver disease, in an Iranian population

Status:

Version 1

Abstract

Background

Methods and Results

Conclusion

Figures

Introduction

Method and material

Study design and anthropometric parameters

Biochemical assessment

PCR amplification

Statistical analysis

Results

Discussion

Conclusion

Abbreviations

Declarations

References

Status:

Version 1