Ethical statement
This study obtained ethical support from Zhengzhou university life science ethics review committee.
Tissues collection, cell lines and mice culture
A tissue microarray (TMA) including 40 breast cancer tissues and 42 normal tissues was employed. All the patients who provided the tissues signed informed consent.
Mammary epithelial cell HBL-100 and three breast cancer cell lines MDA-MB-231, BT-549 and MCF-7 were purchased from American type culture collection (ATCC) (https://www.atcc.org/). HBL-100 and MDA-MB-231 cells were cultured in 1640+10%FBS and Leibovitz’s L-15 (PM151010)+10% FBS (164210-500)+1% P/S (PB180120), respectively. BT-549 and MCF-7 were grown in DMEM+10% FBS. The cells were incubated in a 37℃ incubator with 5% CO2.
The four-week-old female BALB-c nude mice were purchased from Jiangsu Jicui Yaokang Biotechnology Co., Ltd, which were kept in cage (5 mice/cage); temperature: 22‑25˚C; humidity: 50-60%; 12 h light/dark cycle. Adequate water and food supplies ensured that mice could get them freely.
Bioinformatics analysis
In this study, CDC73 mRNA levels in breast cancer and normal tissues were investigated based on TCGA data through GEPIA 2 website (http://gepia2.cancer-pku.cn/#analysis). The ubiquitin E3 ligases of MAPK1 were predicted through the Ubibrowser website (http://ubibrowser.bio-it.cn/ubibrowser/home/index).
Immunohistochemical staining (IHC)
IHC was used to observe the expression of antibodies in the lesion sites. The slides from TMA were deparaffinized with xylene for 3 times. Then, the slides were subjected to antigen repair using EDTA solution and block using 3% H2O2. After that, primary and secondary antibodies were added, subsequent DAB and Hematoxylin were applied to visualize the expression patterns of antibodies in the healthy and lesion sites. IHC scoring included four categories: negative (0), positive (1-4), ++ positive (5-8), or +++ positive (9-12), based on the staining intensity (varied from weak to strong) and staining extent scores. Finally, the high and moderate expression parameters were determined by the median of IHC experimental scores of all tissues. The details of antibodies were listed as follows: CDC73 (1:500, abcam, #ab223840), Ki67 (1:100, abcam, #ab16667), Goat Anti-Rabbit IgG H&L (HRP) (1:400, abcam, #ab97080).
Plasmid construction and lentivirus infection
Using CDC73 and MAPK1 genes as template, the RNA interference target sequence of CDC73 (TAGGTCTTTGTCTGAAGCTAT) and MAPK1 (GTTCGAGTAGCTATCAAGAAA) were designed and corresponding shRNA lentiviral vector was constructed. CDC73 overexpression plasmids (LV-013) were generated through pMD2.G and pSPAX2 vectors.
2×105 MDA-MB-231 and BT-549 cells in logarithmic growth phase were infected under ENI.S+Polybrene using 40 μL 1×108 TU/mL lentivirus, then were maintained in their corresponding medium. The infection efficiencies were evaluated by microscopic fluorescence.
RNA extraction and Real-time quantitative PCR (qRT-PCR)
The total RNA of cells was extracted according to the manufacturer’s instruction of TRIzol reagent (Sigma, St. Louis, MO, USA), which was subsequently synthesis cDNA. 10 μL qRT-PCR system was conducted with SYBR Green Mastermixs Kit (Vazyme, Nanjing, Jiangsu, China). The relative expression of mRNA was calculated based on 2-△△Ct method. The primer sequences (5′-3′) were presented in Table S1.
Western blot assay and co-immunoprecipitation (Co-IP)
The cells were lysed in 1× Lysis Buffer lysis (Cell Signal Technology, Danvers, MA) and the total proteins were segregated by 10% SDS-PAGE. Then the proteins were transferred onto PVDF membranes, the membranes were blocked with TBST solution containing 5% skim milk at room temperature for 1 h and incubated with primary and secondary antibodies. After that, the membranes were washed with TBST for three times, 10 min each time. Finally, the ECL+plusTM Western blot system kit was used for color rendering and X-ray imaging was captured. In terms of Co-IP, the protein of MDA-MB-231 cells were collected and pulled down using IgG or Anti-CBL. Finally, western blot was performed using CBL and CDC73 antibodies. The details of antibodies were listed as follows: CDC73 (1:1000, Abcam, #ab223840), MAPK1 (1:1000, abcam, #ab32537), mTOR (1:2000, Proteintech, #28273-1-AP), p-mTOR (1:1000, Proteintech, #67778-1-Ig), GAPDH (1:3000, Bioworld, AP0063), Goat Anti-Rabbit (1:3000, Beyotime, # A0208), Goat Anti-Mouse (1:3000, Beyotime, A0216).
Celigo cell counting assay
After infection, the cells were inoculated in a 96-well plate at the density of 2000 cells/well. The number of cell was counted for continuous 5 days using Celigo. Finally, the data were statistically analyzed to plot the cell proliferation curve.
CCK8 assay
After infection, the cells were inoculated in a 96-well plate with 5000 cells per well for culturing and then were treated using mTOR inhibitor (AZD8055, 100nm, #SC0042-25mg) for 24 h. Each group contained five plates to determine continuous 5-day cell growth. Before termination of culture, 10 μL CCK-8 reagent was supplemented into the 96-well plate. After 4 h, the 96-well plate was placed on an oscillator and oscillated for 2-5 min. The OD value was detected by microplate reader at 450 nm.
Wound healing assay
After infection, the cells were cultured in a 96-well plate (7×104 cells/well). Then, the cells were incubated in an incubator with 5% CO2 at 37°C. The images were graphed by a microscope at indicated time. The migration rate of cells was evaluated based on the scratch images.
Transwell assay
After infection, the cells were prepared at the density of 4×105 cells/mL and loaded into the upper chamber incubated in serum-free medium. Then, the upper chamber was transferred to the lower chamber containing medium with 30% FBS and incubated for 72 h. After that, 400 µL Giemsa was added for cell staining and the cell migration ability was quantified.
Cell apoptosis
Lentivirus-infected cells were cultured in 6-well plates (2 mL/well) for 5 days. 10 μL Annexin V-APC was added for staining 10-15 min at room temperature in the dark. The cell apoptosis level was measured by using FACSCalibur (BD Biosciences, San Jose, CA, USA).
PrimeView human gene expression array
Total RNA was extracted as described previously. The quality and integrity of RNA were determined by a Nanodrop 2000 (Thremo Fisher Scientific, Waltham, MA, USA) and Agilent 2100 and Agilent RNA 6000 Nano Kits (Agilent, Santa Clara, CA, USA). Referring to the manufacturer’s instructions, RNA sequencing was performed using Affymetrix human GeneChip PrimeView and the data were scanned by an Affymetrix Scanner 3000 (Affymetrix, Santa Clara, CA, USA). The statistical significance of the raw data was completed using a Welch t-test with Benjamini-Hochberg FDR (|fold change| ≥ 1.3 and FDR < 0.05 as significant). A significant difference analysis and functional analysis based on Ingenuity Pathway Analysis (IPA) (Qiagen, Hilden, Germany) were executed, and a |Z - score| > 0 is considered valuable.
Analysis of protein degradation
To analyze protein degradation, CDC73-depleted/CBL-overexpressed MDA-MB-231 and BT-549 cells were treated with 50 μg /mL cycloheximide (CHX) and harvested at indicated time points. The cell lysate was subjected to immunoblotting. To analyze the protein ubiquitination of MAPK1, cells were co-transfected with shCDC73/CBL and ubiquitin. At 24 h after infection, the proteasome inhibitor MG132 (10 μM) was added and the cells were incubated for 6 h. The MAPK1 or IgG antibodies were added to the cell lysate before incubation overnight at 4°C. The ubiquitin was detected using an ubiquitin antibody (1:2000, CST, #3936S).
The construction of tumor xenograft model
1×107 MDA-MB-231 cells infected indicated lentiviruses were subcutaneously injected into the axilla of the animal's right forelimb, each group containing 4 mice. The tumor volume was calculated at indicated time according to the following formula: tumor volume=π/6×L×W×W, where L is tumor length and W is tumor width. After 32 days, the mice were sacrificed and the tumors were removed for weighing and photographing and finally frozen in liquid nitrogen and stored at −80°C.
Statistical analysis
All the experiments were in triplicate. Data in this study were analyzed by GraphPad Prism 8 (San Diego, CA, USA) and SPSS 19.0 (IBM, SPSS, Chicago, IL, USA), and presented as the mean ± SD. Student’s t-test and one-way ANOVA were used to analyze the statistical significance. The Spearman correlation analysis and Mann-Whitney U analysis were used to assess the relationship between the expression of CDC73 and clinicopathological characteristics of breast cancer patients. Kaplan-Meier survival analysis was performed to reveal the relationship between CDC73 expression and breast cancer patients’ overall survival.