Comparison of Paenibacillus polymyxa wild-type and Nif− mutant in colonization, plant-growth promotion and nitrogen fixation contribution

doi:10.21203/rs.3.rs-314624/v1

Download PDF

Research Article

Comparison of Paenibacillus polymyxa wild-type and Nif⁻mutant in colonization, plant-growth promotion and nitrogen fixation contribution

https://doi.org/10.21203/rs.3.rs-314624/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Aims

This study aimed to compare the effect on colonization, plant-growth promotion and nitrogen fixation contribution by inoculation with Paenibacillus polymyxa wild-type and Nif⁻mutant.

Methods

Paenibacillus polymyxa wild-type and Nif⁻ mutant was labeled with GFP and then the GFP-labeled bacteria were used to inoculate cucumber. The colonization patterns of P. polymyxa WLY78 in these plants were observed under the confocal laser scanning microscope. The effects of plant-growth promotion were investigated by greenhouse experiments. The nitrogen fixation contribution was estimated by ¹⁵N isotope dilution experiments.

Results

Observation by laser confocal microscopy revealed that both P. polymyxa WLY78 and ΔnifB-V mutant can effectively colonize cucumber root, stem and leaf tissues. Greenhouse experiments showed that inoculation with P. polymyxa WLY78 can significantly enhance the lengths and fresh wights of cucumber roots and shoots, but inoculation with ΔnifB-V mutant can not. ¹⁵N isotope dilution experiments showed that cucumber plants derive 25.93% nitrogen from nitrogen fixation performed by P. polymyxa WLY78, but the ΔnifB-V mutant nearly can not provide nitrogen for plant.

Conclusions

This present study demonstrates that nitrogen fixation plays an import role in promoting plant growth.

Plant Physiology and Morphology

Biotechnology and Bioengineering

Paenibacillus

promoting plant growth

colonization

biological nitrogen fixation

15N isotope dilution

Nitrogen is the most important nutrient in plant growth, but plants can not directly use nitrogen in the atmosphere. Biological nitrogen fixation (BNF) is a process in which nitrogen-fixing microorganisms reduce nitrogen in the air to ammonia through nitrogenases. Biological nitrogen fixation is an important part of the natural nitrogen cycle (Dart 1986) and it plays an important role in the sustainable development of agriculture (Raymond et al. 2004). Nitrogen-fixing microorganisms include symbiotic nitrogen-fixing bacteria, autogenous nitrogen-fixing bacteria and associative nitrogen-fixing bacteria. Associative nitrogen-fixing bacteria can colonize root surface cells, invade plant roots, and form close contact with plants, thereby promoting plant growth (Baldani et al. 1997). Associative nitrogen-fixing bacteria promote the absorption of nitrogen by non-legume plants (Geddes et al. 2015). Biological nitrogen fixation can not only reduce the use of nitrogen fertilizer, but also improve soil fertility and the absorption of nutrients by crops (Farrar et al. 2014).

It has been reported that the associative nitrogen-fixing bacteria play an important role in promoting growth of non-legumes by fixing nitrogen and producing phytohormone (Chalk 1991). ¹⁵N isotope and N balance studies have shown that several sugarcane varieties obtain over 60% of their nitrogen (< 150 kg N ha^− 1 year^− 1) from biological nitrogen fixation performed mainly by Acetobacter diazotrophicus and Herbaspirillum spp. (Boddey et al. 1995). Diazotrophic bacteria present in the mucilage of aerial roots contribute 29–82% of the N nutrition of Sierra Mixe maize (Van Deynze et al. 2018). Inoculation with nitrogen-fixing Klebsiella pneumoniae 342 (Kp342) increased total N and N concentration in the wheat plant (Iniguez et al. 2004). Inoculation of the rhizobacteria including Azospirillum brasilense and Azospirillum lipoferum contributed up to 20–50% of the total nitrogen requirement of the oil palm seedlings through nitrogen fixation (Amir et al. 2003). Diazotrophic Paenibacillus beijingensis BJ-18 provides nitrogen for wheat, maize and cucumber plants and promotes plant growth, nitrogen uptake and metabolism (Li et al. 2019). A recombinant nitrogen-fixing Pseudomonas protegens Pf-5 X940 was constructed by introducing the nif genes of Pseudomonas stutzeri A1501 via the X940 cosmid to the beneficial rhizobacterium Pseudomonas protegens Pf-5, and inoculation of Arabidopsis, alfalfa, tall fescue and maize with Pf-5 X940 increased the ammonium concentration in soil and plant productivity under nitrogen-deficient conditions (Fox et al. 2016; Setten et al. 2013). Inoculation with Azospirillum brasilense Ab-V5 cells enriched with exopolysaccharides and polyhydroxybutyrate enhances the productivity of maize under low N fertilizer input (Oliveira et al. 2017;)

Paenibacillus polymyxa WLY78 is a nitrogen-fixing bacterium containing a compact nif gene cluster consisting of 9 genes (nifBHDKENXhesAnifV) (Wang et al. 2013;Xie et al. 2014). In addition to nitrogen fixation, this bacterium has the ability of phosphate solubilization and IAA production (Xie et al. 2016). Also, this bacterium can produce furaricidins that are a class of cyclic lipopeptide antibiotics to inhibit plant pathogenic fungi (Li et al. 2019). These specific traits suggest that P. polymyxa WLY78 is a member of plant growth-promoting bacteria (PGPB) and is of great usage as an inoculant in agriculture. However, the nitrogen contribution to plants derived from nitrogen fixation of P. polymyxa WLY78 is unclear. In this study, the nif gene cluster deletion mutant (ΔnifB-V) of P. polymyxa WLY78 is constructed. Comparisons of P. polymyxa wild-type and ΔnifB-V mutant in colonization, plant-growth promotion and nitrogen fixation contribution rate are investigated. Our study will provide foundation for application of P. polymyxa WLY78 as a biofertilzer in agriculture.

Bacteria strains and culture conditions

Paenibacillus polymyxa WLY78, isolated from the rhizosphere of bamboo in Beijing (Wang et al., 2013). This bacterium has multiple antagonistic activities against plant pathogens and produces IAA (Xie et al., 2016). The nitrogen-fixing gene cluster deletion mutant ΔnifB-V of P. polymyxa WLY78 was constructed by a homologous recombination method. Primers 5′ CGGCCACGATGCGTCCGGCGTAGAGGATCCGCGTGGTGGATGTGGA CG 3′ and 5′ AACGCTTTTTCGGTTATCATTCCTTCACATCTATTTTCGTC 3′ were used to amplify a 950 bp-long DNA sequence located upstream of nifB. Primers 5′ GAAGGAATGATAACCGAAAAAGCGTTCCCGT

C 3′ and 5′ GACTGCGCAAAAGACATAATCGATAAGCTTCCTGATAAGGCAGACAAGGCTC 3′ were used to amplify a 1107 bp-long sequence located downstream of nifV. The two fragments were then fused with BamH Ⅰ/Hind III digested pRN5101 vector using Gibson assembly master mix (New England Biolabs), generating the four recombinant plasmids. Then, the recombinant plasmid was transformed into P. polymyxa WLY78 as described by Wang et al., (2018), and the marker-free deletion mutant (the double-crossover transformant) ΔnifB-V was selected for from the initial erythromycin resistance (Em^r) transformants after several rounds of nonselective growth at 39˚C and confirmed by PCR amplification and sequencing analysis.

P. polymyxa WLY78 and ΔnifB-V were inoculated into Luria-Bertani (LB) liquid medium, cultured at 30°C and 180 rpm to logarithmic growth phase, and then centrifuged to collect the bacterial cells and suspend the bacterial cells with physiological saline. The cell concentration was set to 10⁸ cells mL^− 1.

Preparation of soil and seeds

The soil was taken from the Shangzhuang Experimental Station of China Agricultural University. They were all 0–20 cm deep topsoil. The soil was low nitrogen sandy soil. After the soil was air-dried and crushed, the debris were removed with a 2 mm sieve to reduce heterogeneity, and then packed into plastic pots with a diameter of 35 cm and a height of 25 cm. Each pot was filled with 2 kg of soil to grow cucumbers. No trace elements were applied during plant growth.

Cucumber seeds (“Zhongnong 8” of Beijing Shengfeng Garden Agricultural Technology Co., Ltd.) were first disinfected with 10% sodium hypochlorite for 10 minutes, then rinsed with sterile water three times, and spread the seeds in a sterile petri dish with damp filter paper. Leave it in the dark at room temperature (25℃) for 3–5 days until the seeds germinate. During the period, 1–2 mL of sterile water was added dropwise with a pipette to keep the filter paper moist.

Colonization of P. polymyxa and ΔnifB-V on cucumber

The recombinant plasmid pGFP300 carrying the gfp gene (Hao and Chen, 2017) was transferred into P. polymyxa WLY78 and ΔnifB-V to prepare cell suspension of the GFP-tagged strains so that the cell concentration was 10⁸ cells mL^− 1. The sterilized cucumber seeds were sown in sterile glass bottles containing 100 mL of 1/2 MS semi-solid agar medium, and one seed was placed in each bottle. After dark treatment for about a week, the seeds will grow into seedlings, which will be transferred to a light incubator for cultivation. After the seedlings grow 2–3 young leaves, inoculate the cell suspension of GFP-tagged strains at the root of cucumber. Three days later, the colonization of GFP-labeled strains in plant tissues were observed with a laser confocal scanning microscope (CLSM, Olympus FluoViewTM FV1000 confocal microscope), and images were collected with FV10-ASW software.

Greenhouse pot experiment

The research was conducted in the greenhouse of China Agricultural University using greenhouse potting. The experimental design was arranged by random factors, with three inoculation treatments and two nitrogen level treatments. Each treatment was repeated three times, for a total of 18 pots of cucumber plants. Nitrogen level treatment included high nitrogen and low nitrogen levels. Nitrogen fertilizer was applied in the form of ¹⁵N labeled (NH₄)₂SO₄ (10.16% ¹⁵N atom, Shanghai Research Institute of Chemical Industry, China). The high nitrogen level was 250 mg N kg^− 1 soil, and the low nitrogen level was 83 mg N kg^− 1 soil. Nitrogen fertilizer was applied in three times, one-third each time, and the first time was applied as a base fertilizer, followed by 7 and 14 days after transplantation.

The inoculation treatment included three treatments: inoculation of P. polymyxa WLY78 (WT), ΔnifB-V, and equal amount of deionized water (as a control). The germinated cucumber seeds with robust and consistent growth were picked and immersed in the bacterial suspension for 20 minutes. The seeds were immersed in deionized water for 20 minutes as a control group, and then transplanted into plastic pots. Four seeds were planted in each pot, and three repetitions were set for each treatment. In the first and second weeks after planting, the P. polymyxa WLY78 and ΔnifB-V bacterial suspensions were re-inoculated into the roots of the plants, and the control group was added with the same amount of deionized water. Place the flower pots under the best conditions in the greenhouse to obtain suitable light conditions. The seedlings were regularly watered every 3 days until the relative humidity of the soil reached 40%.

Plant sample collection

On 30th day of cucumber planting, the plants were collected by destructive sampling. The whole seedling was first uprooted, and rinsed with deionized water to remove the soil attached to the root system, then the root and shoot samples were separated, and the fresh weight and length of the root and shoot were weighed. The root and shoot samples were killed in an oven at 105°C for 30 minutes, and then dried at 65°C until constant weight for dry weight analysis. The dried sample was ground, sieved with a 1 mm sieve and placed in a bag, and the plant N content and ¹⁵N enrichment determination were performed by an isotope mass spectrometer. The remaining samples were immediately frozen in liquid nitrogen for subsequent analysis.

Contribution of nitrogen by biological nitrogen fixation

The ¹⁵N isotope dilution technique was used to quantitatively determine the contribution of inoculated bacteria to plant biological nitrogen fixation. After inoculation with P. polymyxa WLY78 and ΔnifB-V, the percentage of nitrogen from cucumber biological nitrogen fixation to the nitrogen content in cucumber (% Ndfa) was calculated by the following formula:

Among them, %NdfF is the ¹⁵N enrichment of cucumber stems and leaves of inoculation treatment, and% NdfNF is the ¹⁵N enrichment of cucumber stems and leaves of uninoculated treatment (control group).

Statistical Analysis

Graphs were prepared using GraphPad Prism software v. 8.0 (GraphPad Software Inc., San Diego, CA, USA). Statistical analysis was performed using SPSS software version 20 (SPSS Inc., Chicago, IL, United States). One-way analysis of variance (ANOVA) was employed to check the significant differences between treatments. Means of different treatments were compared using the least significant difference (LSD) at the 0.05 or 0.01 level of probability.

Colonization of P. polymyxa WLY78 and ΔnifB-V mutant in cucumber

P. polymyxa WLY78 contains a compact nif gene cluster consisting of 9 genes (nifB nifH nifD nifK nifE nifN nifX hesA nifV) located in a 10. 5 kb. A nif gene cluster deletion mutant (ΔnifB-V) was constructed by recombination as described in Materials and Methods. The ΔnifB-V mutant does not have nitrogenase activity, no matter this mutant is cultivated in medium containing ammonium or no ammonium.

P. polymyxa WLY78 and the ΔnifB-V mutant were individually labelled with GFP and then the GFP-labelled bacteria were used to inoculate cucumber. After 3 days of inoculation, the samples of the cucumber roots, stems and leaves were observed under laser confocal microscopy. The cells of P. polymyxa WLY78 not only colonized on the surface of cucumber root, but also colonized interior of root, stem and leaf (Fig. 1a-c). The presence of bacterial cells was observed in the vascular bundle of the stem and the leaves. Similarly, cells of the ΔnifB-V mutant were also observed in the primary root cortex of cucumber (Fig. 1d), stem (Fig. 1e) and leaf vein (Fig. 1f). The results indicated that P. polymyxa WLY78 and ΔnifB-V can colonize outside and inside of cucumber tissues. Deletion of the nif gene cluster did not affect the colonization of P. polymyxa WLY78.

Colonization pattern of P. polymyxa WLY78 in root (a), stem (b) and leaf (c). Colonization pattern of ΔnifB-V mutant in root (d), stem (e) and leaf (f). Scale bars (a–f) = 100 µm.

Effects of P. polymyxa WLY78 and ΔnifB-V on the growth of cucumber

Cucumber samples were collected on the 30th day after plantation, and the length and fresh weight of plant shoots and roots were measured to evaluate the effects of inoculation with P. polymyxa WLY78 and ΔnifB-V mutant on plant growth under low and high nitrogen conditions. The un-inoculated plants served as a control. Compared to the un-inoculated control group, cucumber plants inoculated with P. polymyxa WLY78 under low nitrogen conditions showed increase of 63.03% in shoots fresh weight, of 71.20% in root fresh weight, of 53.31% in shoot length and of 97.51% in root length, but they showed a little increase in lengths and weights under high nitrogen conditions (Fig. 2a-d). Compared with the un-inoculated control group, the cucumber plants inoculated with the ΔnifB-V mutant showed a little increase in the fresh weight and length of the shoots and roots under both low and high nitrogen conditions (Fig. 2a-d). Notably, the fresh weight and length of the shoots and roots of cucumbers inoculated with ΔnifB-V mutant under both conditions are similar to those of cucumbers inoculated with P. polymyxa WLY78 under high nitrogen conditions. Figure 3 is an experimental diagram of the greenhouse cultivation. The data indicate that the diazotrophic P. polymyxa WLY78 can effectively promote plant growth under low nitrogen conditions and disruption of nif genes encoding nitrogenase results in almost loss of the ability of promoting plant growth.

Quantification of BNF in P. polymyxa WLY78- and ΔnifB-V mutant-inoculated cucumbers

To estimate the contribution of BNF, ¹⁵N isotope dilution technique was used to analyze the inoculated cucumber grown in soil contain ¹⁵N-labeled (NH₄)₂SO₄ as N fertilizer in greenhouse conditions (Table 1). The nitrogen derived from gaseous nitrogen (%Ndfa) in the P. polymyxa WLY78 inoculated cucumber and the ΔnifB-V strain inoculated cucumber under low N conditions is 25.93% ± 2.32% and 2.93% ± 6.57%, respectively. Whereas, the nitrogen derived from gaseous nitrogen (%Ndfa) in the P. polymyxa WLY78 inoculated cucumber and the ΔnifB-V strain inoculated cucumber under high N conditions is 1.54 ± 0.66% and − 0.22 ± 1.02%, respectively. These results indicate that the cucumber plant has incorporated the nitrogen provided by BNF of P. polymyxa WLY78 under low N conditions and BNF is inhibited by high concentration of available nitrogen in the environment. The ΔnifB-V strain-inoculated cucumbers nearly did not derive nitrogen from BNF, consistent with the ΔnifB-V strain has no nitrogenase. The data also indicate that P. polymyxa WLY78 can be used to provide nitrogen nutrition to plants and reduce the use of nitrogen fertilizers.

Table 1

Quantification of biological nitrogen fixation in the inoculated cucumber plants grown in soils containing high N and low N conditions.
Treatment	%Ndfa
Treatment	Low nitrogen	High nitrogen
Control	-	-
P.polymyxa WLY78	25.93 ± 2.32^a	1.54 ± 0.66^a
ΔnifB-V	2.93 ± 6.57^b	-0.22 ± 1.02^a

The results came from three biological replicates, the error represents SD, lowercase letters a and b indicate that there is a significant difference between the groups (P < 0.05), while the same letter indicates that there is no significant difference.

In this study, both GFP-tagged P. polymyxa WLY78 and GFP-tagged ΔnifB-V mutant are able to colonize the roots, stems, and leaves of cucumber. This result shows that the deletion of the nif gene cluster does not affect the colonization. Similarly, both of wild-type Klebsiella pneumoniae 342 and the nifH⁻ mutant can colonize wheat (Iniguez et al. 2004) and both wild-type Pseudomonas stutzeri A1501 and its nifH ⁻ mutant can colonize maize root (Ke et al. 2019). Wild-type Acetobacter diazotrophicus PAl5 and the nifD⁻ mutant have the same ability of colonization in sugarcane (Sevilla et al. 2001). A difference between our study with other’s is that the ΔnifB-V mutant of P. polymyxa WLY78 has a deletion of a compact nif gene cluster comprising 9 genes (nifBHDKENXhesAnifV) and the nifH⁻ mutant or nifK⁻ mutant or nifD⁻ mutant has a deletion of a single nif gene.

The effects of P. polymyxa WLY78 and ΔnifB-V on cucumber growth under different nitrogen concentrations were further studied through greenhouse cultivation experiments. Compared to the un-inoculated control and the inoculation with the ΔnifB-V mutant, inoculation with P. polymyxa WLY78 significantly increased the fresh weights and lengths of cucumber shoots and roots under low nitrogen conditions, but this effect is not found in the cucumbers inoculated with the ΔnifB-V mutant. Notably, inoculation with P. polymyxa WLY78 under low nitrogen conditions led to the increased levels of root length and wight were much higher than those of shoot length and wight, consistent with the recent results obtained by inoculation with diazotrophic P. beijingensis BJ-18 in maize, wheat and cucumber (Li et al. 2019). It was observed that copy numbers of P. beijingensis BJ-18 are much higher in roots than in shoot, suggesting that the densities of diazotrophs are positively corelated to plant growth traits (Li et al. 2019). These results have revealed that the nitrogen fixation of P. polymyxa WLY78 plays an important role in promoting plant growth. Phosphate solubilization and IAA production of P. polymyxa WLY78 may exhibit a minor role in promoting plant growth. Similarly, inoculation with Pseudomonas stutzeri A1501 strain can increase the root and shoot dry weight of maize, but this effect is not found in the maize inoculated with nifH⁻mutant (Ke et al. 2019). In N₂-deficient conditions, Kallar grass inoculated with Azoarcus sp. BH72 grew better and accumulated more nitrogen than plants inoculated with the nifK⁻ mutant strain (Hurek, et al. 2002.). Inoculation with K. pneumoniae 342 resulted in increased dry weight, chlorophyll content, total N, and N concentration of wheat in comparison with the uninoculated and nifH⁻ mutant-inoculated controls (Iniguez et al. 2004).

The ¹⁵N isotope dilution technique is commonly used to determine the contribution of nitrogen-fixing bacteria to plant nitrogen. In this study, the ¹⁵N isotope dilution technique was used to determine the biological nitrogen fixation of P. polymyxa WLY78 and ΔnifB-V mutant. Cucumber plants derived 25.93% ± 2.32% from the nitrogen fixation of P. polymyxa WLY78 under low nitrogen fixation, but the ΔnifB-V mutant hardly fixed nitrogen. Similar reports are found that nitrogen fixation of P. beijingensis BJ-18 provided 27.8% nitrogen for cucumber under low nitrogen conditions (Li et al. 2019) and Paenibacillus polymyxa P2b-2R provided 15% nitrogen in maize by nitrogen fixation (Padda et al. 2017).

Funding This work was supported by the National Key Research and Development Program of China (No. 2019YFA0904700).

Conflict of interest The authors have no conflicts of interest to declare.

Availability of data and material All data generated or analysed during this study are included in this published article.

Authors' contributions Conceptualization: Chen SF; Experiments: Liu S and Li Q; Methodology: Liu S, Li Q, Li YB, Hao TY and Zhang HW; Writing: Liu S, Li Q and Chen SF; Funding acquisition: Chen SF. All authors read and approved the final manuscript.

Amir HG., Shamsuddin ZH., Halimi MS., Ramlan MF, Marziah M (2003) N₂ fixation, nutrient accumulation and plant growth promotion by rhizobacteria in association with oil palm seedlings. Pak J Biol Sci 6, 1269-1272.

Baldani JI, Caruso L, Baldani VLD, Goi SR, Dobereiner J (1997) Recent advances in BNF with non-legume plants. Soil Biol Biochem 29: 911-922. https://doi.org/10.1016/s0038-0717(96)00218-0.

Boddey RM, Deoliveira OC, Urquiaga S, Reis VM, Deolivares FL, Baldani VLD, Dobereiner J (1995) Biological nitrogen fixation associated with sugar cane and rice: contributions and prospects for improvement. Plant Soil 174: 195-209. https://doi.org/10.1007/bf00032247.

Chalk PM (1991) The contribution of associative and symbiotic nitrogen fixation to the nitrogen nutrition of non-legumes. Plant Soil 132: 29-39. https://doi.org/10.1007/bf00011009.

Dart PJ (1986) Nitrogen fixation associated with non-legumes in agriculture. Plant Soil 90: 303-334. https://doi.org/10.1007/bf02277405.

Farrar K, Bryant D, Cope-Selby N (2014) Understanding and engineering beneficial plant-microbe interactions: plant growth promotion in energy crops. Plant Biotechnol J 12: 1193-1206. https://doi.org/10.1111/pbi.12279.

Fox AR, Soto G, Valverde C, Russo D, Lagares A, Zorreguieta A, Alleva K, Pascuan C, Frare R, Mercado-Blanco J, Dixon R, Ayub ND (2016) Major cereal crops benefit from biological nitrogen fixation when inoculated with the nitrogen-fixing bacterium Pseudomonas protegens Pf-5 X940. Environ Microbiol 18: 3522-3534. https://doi.org/10.1111/1462-2920.13376.

Geddes BA, Ryu MH, Mus F, Costas AG, Peters JW, Voigt CA, Poole P (2015) Use of plant colonizing bacteria as chassis for transfer of N₂-fixation to cereals. Curr Opin Biotechnol 32: 216-222. https://doi.org/10.1016/j.copbio.2015.01.004.

Hao TY, Chen SF (2017) Colonization of wheat, maize and cucumber by Paenibacillus polymyxa WLY78. PLoS One 12: e0169980. https://doi.org/10.1371/journal.pone.0169980.

Hurek T, Handley LL, Reinhold-Hurek B, Piche Y (2002) Azoarcus grass endophytes contribute fixed nitrogen to the plant in an unculturable state. Mol Plant Microbe In 15: 233-242. https://doi.org/10.1094/mpmi.2002.15.3.233.

Iniguez AL, Dong YM, Triplett EW (2004) Nitrogen fixation in wheat provided by Klebsiella pneumoniae 342. Mol Plant Microbe In 17: 1078-1085. https://doi.org/10.1094/mpmi.2004.17.10.1078.

Ke XB, Feng S, Wang J, Lu W, Zhang W, Chen M, Lin M (2019) Effect of inoculation with nitrogen-fixing bacterium Pseudomonas stutzeri A1501 on maize plant growth and the microbiome indigenous to the rhizosphere. Syst Appl Microbiol 42: 248-260. https://doi.org/10.1016/j.syapm.2018.10.010.

Li YB, Li YL, Zhang HW, Wang MY, Chen SF (2019) Diazotrophic Paenibacillus beijingensis BJ-18 provides nitrogen for plant and promotes plant growth, nitrogen uptake and metabolism. Front Microbiol 10: 1119. https://doi.org/10.3389/fmicb.2019.01119.

Li YL, Chen SS (2019) Fusaricidin produced by Paenibacillus polymyxa WLY78 induces systemic resistance against Fusarium wilt of cucumber. Int J Mol Sci 20: 5240. https://doi.org/10.3390/ijms20205240.

Oliveira ALM, Santos OJAP, Marcelino PRF, Milani KML, Zuluaga MYA, Zucareli C, Goncalves LSA (2017) Maize inoculation with Azospirillum brasilense Ab-V5 cells enriched with exopolysaccharides and polyhydroxybutyrate results in high productivity under low N fertilizer input. Front Microbiol 8: 1873. https://doi.org/10.3389/fmicb.2017.01873.

Padda KP, Puri A, Zeng QW, Chanway CP, Wu XQ (2017) Effect of GFP-tagging on nitrogen fixation and plant growth promotion of an endophytic diazotrophic strain of Paenibacillus polymyxa. Botany 95: 933-942. https://doi.org/10.1139/cjb-2017-0056.

Raymond J, Siefert JL, Staples CR, Blankenship RE (2004) The natural history of nitrogen fixation. Mol Biol Evol 21: 541-554. https://doi.org/10.1093/molbev/msh047.

Setten L, Soto G, Mozzicafreddo M, Fox AR, Lisi C, Cuccioloni M, Angeletti M, Pagano E, Diaz-Paleo A, Ayub ND (2013) Engineering Pseudomonas protegens Pf-5 for nitrogen fixation and its application to improve plant growth under nitrogen-deficient conditions. PLoS One 8: e63666. https://doi.org/10.1371/journal.pone.0063666.

Sevilla M, Burris RH, Gunapala N, Kennedy C (2001) Comparison of benefit to sugarcane plant growth and ¹⁵N₂ incorporation following inoculation of sterile plants with Acetobacter diazotrophicus wild-type and Nif⁻ mutant strains. Mol Plant Microbe In 14: 358-366. https://doi.org/10.1094/mpmi.2001.14.3.358.

Van Deynze A, Zamora P, Delaux PM, Heitmann C, Jayaraman D, Rajasekar S, Graham D, Maeda J, Gibson D, Schwartz KD, Berry AM, Bhatnagar S, Jospin G, Darling A, Jeannotte R, Lopez J, Weimer BC, Eisen JA, Shapiro HY, Ane JM, Bennett AB (2018) Nitrogen fixation in a landrace of maize is supported by a mucilage-associated diazotrophic microbiota. PLoS Biol 16: e2006352. https://doi.org/10.1371/journal.pbio.2006352.

Wang LY, Zhang LH, Liu ZZ, Zhao DH, Liu XM, Zhang B, Xie JB, Hong YY, Li PF, Chen SF, Dixon R, Li JL (2013) A minimal nitrogen fixation gene cluster from Paenibacillus sp. WLY78 enables expression of active nitrogenase in Escherichia coli. PLoS Genet 9: e1003865. https://doi.org/10.1371/journal.pgen.1003865.

Wang TS, Zhao XY, Shi HW, Sun L, Li YB, Li Q, Zhang HW, Chen SF, Li JL (2018) Positive and negative regulation of transferred nif genes mediated by indigenous GlnR in Gram-positive Paenibacillus polymyxa. PLoS Genet 14: e1007629. https://doi.org/10.1371/journal.pgen.1007629.

Xie JB, Du ZL, Bai LQ, Tian CF, Zhang YZ, Xie JY, Wang TS, Liu XM, Chen X, Cheng Q, Chen SF, Li JL (2014) Comparative genomic analysis of N₂-fixing and non-N₂-fixing Paenibacillus spp.: organization, evolution and expression of the nitrogen fixation genes. PLoS Genet 10: e1004231. https://doi.org/10.1371/journal.pgen.1004231.

Xie JB, Shi HW, Du ZL, Wang TS, Liu XM, Chen SF (2016) Comparative genomic and functional analysis reveal conservation of plant growth promoting traits in Paenibacillus polymyxa and its closely related species. Sci Rep 6: 21329. https://doi.org/10.1038/srep21329.

Download PDF

Reviewers invited by journal
09 Mar, 2021
Reviews received at journal
09 Mar, 2021
First submitted to journal
09 Mar, 2021
Editor assigned by journal
08 Mar, 2021
Editor invited by journal
08 Mar, 2021

You are reading this latest preprint version

Comparison of Paenibacillus polymyxa wild-type and Nif⁻mutant in colonization, plant-growth promotion and nitrogen fixation contribution

Status:

Version 1

Abstract

Aims

Methods

Results

Conclusions

Figures

Introduction

Materials And Methods

Statistical Analysis

Results

Discussion

Declarations

References

Status:

Version 1