In this study, we aimed to find out whether inhibiting the expression of STAT3 in the heart can attenuate the valvular damage caused by RHD. In order to achieve this goal, RHD rat model was established, the expression of STAT3 in the heart was inhibited by STAT3-siRNA, Th17 cell-related inflammatory factors were detected. Then, the degree of inflammation and fibrosis in valve tissues was evaluated to finally verify our conjecture.
2.1 Antigen
First, brain heart infusion fluid medium (Guangdong Huankai Microbial Sci. & Tech. Co., Ltd.) was used to culture the group A streptococci (GAS, ATCC19615; American Type Culture Collection), the temperature during cultivation process was kept constant at 37 °C. After 24 h, the GAS were washed with normal saline (NS), and then transferred into 10% neutral formalin for 12 h for inactivation. Second, NS was used to wash and resuspend the inactivated GAS, and the concentration was simultaneously adjusted to 4.0 × 1011 CFU/ml. Finally, after emulsifying the suspensions by sonication (Sonics & Materials, Inc.), we obtained the antigen.
2.2 In vivo gene therapy
In order to directly inhibit the expression of STAT3 in the heart of Lewis rats, a rat STAT3 small interfering RNA (siRNA) sequence (5’-GGCTGATCATTTATATAAA-3’) with a c-TNT promoter (STAT3-siRNA; Hanbio Biotechnology Co., Ltd.) carried by recombinant adeno-associated viral (AAV, serotype 9) vectors was used. In addition, to determine whether the AAV vector had an effect on the rats, we used an AAV-control as a negative control.
2.3 Animals and groups
We purchased 24 Lewis rats (150–180 g) from Beijing Vital River Animal Technology Co., Ltd. All the rats were female and at 8 weeks of age, and weighing 150–180 g. Our pathogen-free animal laboratory at the Animal Experiment Center of Guangxi Medical University provides a good environment for captive rats: the temperature is constantly set to 23˚C and the fluctuation does not exceed 2˚C; the cycle of day and night is 12 hours; the movement of rats in the cage is completely unrestricted; and we provide convenient drinking conditions and standard rat feed. We allowed all the rats to adapt to the environment for 5 days before the start of the experiment. All animal experimental procedures were conducted according to the ethical guidelines for the care and use of laboratory animals and were approved by the Medical Ethics Committee of the First Affiliated Hospital of Guangxi Medical University (grant no. 2019-KY-E-034). All rats were divided randomly into four groups: control group, STAT3-siRNA group, AAV-control group and RHD group. Each group had 6 rats. The RHD group was the established RHD model. Footpad injection of CFA (Sigma-Aldrich, Merck KGaA) is essential in establishing the RHD rat model. And all rats were maintained on soft bedding and not in wire-bottomed cages. We used 9 weeks to establish the RHD rat model. In the beginning, one hind footpad of the rat was injected with a 100 µl solution of inactivated GAS (4.0 × 1011 CFU/ml) and CFA mixed at a ratio of 1:1 (v/v). Then, after one week, we performed a subcutaneous injection of 500 µl of inactivated GAS (4.0 × 1011 CFU/ml) and CFA mixed at a ratio of 1:1 (v/v) into the abdomen once a week at the same interval for 4 weeks. For the last 4 weeks, we performed subcutaneous abdominal injection once a week at the same interval with an adjustment of the injection solution to 500 µl of inactivated GAS (4.0 × 1011 CFU/ml). Rats in the STAT3-siRNA group were injected with 2.5 × 1011 viral genome particles at one time through the tail vein (AAV-STAT3-siRNA, diluted with 200 µl normal saline) at the beginning of the experiment. Three weeks later, the rats received exactly the same treatment as the RHD group. The rats in the AAV-control group received an injection of 2.5 × 1011 viral genome particles at one time through the tail vein (AAV-control, diluted with 200 µl normal saline) at the beginning of the experiment. Three weeks later, they were injected following the same protocol as that of the RHD group. The rats in the control group were injected using the same protocol as that of the RHD group from the beginning, but the injection solution was the same volume of NS.
2.4 Sacrifice
After the treatments, we collected a total of 1 ml blood via tail veins of rats from each group without anaesthesia, then an intraperitoneal injection of sodium pentobarbital (150 mg/kg) was used to sacrifice the rat. Animal death was determined when there was more than 5 min without breathing or heartbeat. Humane endpoint was defined as animals losing > 15% of their body weight with a decreased ability to consume food and water
2.5 Sample preparation
We collected samples from the valves of every rat. All samples were frozen in liquid nitrogen rapidly and then stored at -80 °C for follow-up experiments. Since no animals died during the modeling process, there were 6 samples in each group, for a total of 24 samples. The next five experimental methods (histochemistry, immunohistochemistry, RT-qPCR, WB, ELISA) were based on the previously mentioned experimental grouping and tested 6 samples in each group.
2.6 Histochemistry
The valve tissues were fixed for 24 h at 4 °C in 4% paraformaldehyde before decalcifying and embedding in paraffin blocks. All blocks were serially sectioned at 5 µm for haematoxylin and eosin (H&E) staining and Sirius red staining. H&E staining was performed at room temperature, the sections were first stained with haematoxylin for 4–10 min and then with eosin for 0.5-2 min. Then, in order to capture the images reflecting the results of H&E staining, a BX43 light microscope (Olympus Corporation) was used. Sirius red staining was also performed at room temperature, the Sirius red solution was used to stain the sections for 1 h. Then, in order to capture the images reflecting the results of Sirius red staining, a BX43 confocal microscope (magnification, × 100; Olympus Corporation) was used.
2.7 Immunohistochemistry
Immunohistochemistry was performed following a previous report [17] to analyse the valve tissues, which were stained for IL-6 (1:65; cat. no. ab9324; Abcam), IL-17 (1:90; cat. no. ab214588; Abcam), S1PR1 (1:80; cat. no. ab77076; Abcam), STAT3 (1:75; cat. no. ab69153; Abcam), p-STAT3 (1:70; cat. no. ab76315; Abcam). And RORγt (1:75; cat. no. 13205-1-AP; Proteintech) which is the key transcription factor that is driving the differentiation of IL-17 producing Th17 cells [18] was also detected. Briefly, the valve tissues were embedded in formalin-fixed paraffin first. Then all blocks were sectioned at 5 µm. After deparaffinization and rehydration, the 5% bovine serum albumin (BSA; Beijing Solarbio Science & Technology Co., Ltd.) solution was used to block the sections at room temperature for 1 h. After deactivation of endogenous peroxidase with hydrogen peroxide, the sections were incubated with the previously mentioned primary antibodies for 12 h at 4 °C. Then, at room temperature, the anti-rabbit horseradish peroxidase (HRP)-conjugated (1:10; cat. no. PV-6001; OriGene Technologies, Inc.) or anti-mouse HRP-conjugated (1:10; cat. no. PV-6002; OriGene Technologies, Inc.) was used as secondary antibodies to incubate the sections for 30 min. After enhancement of colour development by using diaminobenzidine (DAB), the immunostained tissues were examined under a BX43 light microscope (Olympus Corporation), and positive expression was reflected by brownish yellow staining, which was detected by microscopy. Quantitative assessment was performed using the methods provided by Friedrichs et al. in a previous report [19]. The positive cell percentage and immunohistochemical score (IHS) were also used in our experiment to describe the quantitative evaluation results.
2.8 RT-qPCR
First, total RNA was extracted from each sample. We used TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the protocol supplied by the manufacturer to finish this step. Second, the concentration of RNA must be measured for quantitative reverse transcription. We used a NanoDrop™ 2000 spectrophotometer (NanoDrop Technologies; Thermo Fisher Scientific, Inc.) to finish this step. Third, reverse transcription of RNA into cDNA. In this step we reverse transcribed 0.5 µg of total RNA from each sample into cDNA. The kit we used was PrimeScript RT reagent kit (Takara Bio, Inc.). And the entire reverse transcription process is strictly in accordance with the instructions supplied by the manufacturer. Finally, RT-qPCR was performed. In this step, the kit we used was TB Green Premix Ex Taq Ⅱ (Takara Bio, Inc.), the instrument we used was a StepOne system (Applied Biosystems; Thermo Fisher Scientific, Inc.), and the internal reference was set to β-actin, and the entire process was still strictly in accordance with the manufacturer's instructions. In Table 1 we list the sequences of the primer sequences in detail. The final result was expressed by the fold difference between the expression level of each mRNA and that of the internal reference using the 2ΔΔCt method [20]. All samples were measured 3 times.
Table 1
Sequences of primers used in reverse transcription-quantitative PCR.
Gene | Primer sequence (5’-3’) |
STAT3 | Forward: TTTGAGACAGAGGTGTACCACCAAG |
| Reverse: ACCACAGGATTGATGCCCAAG |
S1PR1 | Forward: GCTTCATCACTCACTACCCTAGCA |
| Reverse: TTCTCCCTTCCCTCCCTCTC |
Col3a1 FSP1 | Forward: ACTTCTGGTCCTCCTGGTCTGC Reverse: CGCCTGGCTCACCCTTTTCAC Forward: TGGGGAGAAGGACAGACGAAGC Reverse: TGGCAATGCAGGACAGGAAGAC |
β-actin | Forward: GGAGATTACTGCCCTGGCTCCTA |
| Reverse: GACTCATCGTACTCCTGCTTGCTG |
In Table 1 we list the sequences of the primer sequences in detail. STAT3, signal transducer and activator of transcription 3; S1PR1, sphingosine-1-phosphate receptor 1; Col3a1, collagen type III α1 chain; FSP1, fibroblast-specific protein 1. |
2.9 Western blotting
First, total protein was extracted from each sample. In this step, the kit we used was RIPA lysis buffer (Sangon Biotech Co., Ltd.), and the method used is according to the instruction supplied by the manufacturer. Second, the protein concentration was measured. In this step, the kit we used was a bicinchoninic acid (BCA) protein assay kit (Sangon Biotech Co., Ltd.). Third, the same amounts of protein (30 µg) from each sample were separated. In this step, the material we used to separate the protein was 10% SDS-PAGE. The separation conditions were: 80 V for 30 min and 120 V for 60 min, the equipment we used was a blotting system (Bio-Rad Laboratories, Inc.), and the entire process was still strictly in accordance with the manufacturer's instructions. Third, the separated proteins were electrotransferred to 0.22 µm polyvinylidene fluoride (PVDF) membranes (EMD Millipore), the transfer conditions were: constant 80 V for 80 min. Fourth, we blocked the membranes carrying proteins for 1 h at room temperature with 3% BSA blocking solution (Sangon Biotech Co., Ltd.) and then incubated the membranes overnight at 4 °C with the following antibodies: anti-S1PR1 (1:1,000; cat. no. 55133-1-AP; ProteinTech Group, Inc.), anti-STAT3 (1:1,000; cat. no. ab68153; Abcam), anti-p-STAT3 (1:1,000; cat. no. 9145; Cell Signaling Technology, Inc.) and anti-β-tubulin (1:3,000; cat. no. 10068-1-AP; ProteinTech Group, Inc.). After that, at room temperature, we incubated the membranes in the dark for 1 h with HRP-conjugated secondary antibody (10,000; cat. no. ab6721; Abcam). Finally, the protein bands were scanned by a chemiluminescence imaging system (Alpha FluorChem FC3; Alpha, Inc.) and we used ImageJ software (1.51j, National Institute of Health) to quantify the expression of the proteins, which were normalized to β-tubulin. All samples were measured 3 times.
2.10 Enzyme-linked immunosorbent assay
Enzyme-linked immunosorbent assay (ELISA) kits (cat. nos. E04640r and E07451r; Cusabio) were used to measure the levels of IL-6 and IL-17 in the serum. The entire process was strictly in accordance with the manufacturer's instructions. All samples were measured 3 times.
2.11 Statistics
Results are expressed as the mean ± standard deviation of at least three independent experiments. The software we used for statistical analysis was SPSS software 16.0 (SPSS, Inc.). The method we used to compare the differences between 2 groups is Student’s t-test. The method we used when comparing the differences among 4 groups was one-way ANOVA. We used p < 0.05 as the criterion for identifying significant differences.