Gene Editing of ZmGA20ox3 improves plant architecture and drought tolerance in maize

doi:10.21203/rs.3.rs-3176812/v1

Download PDF

Research Article

Gene Editing of ZmGA20ox3 improves plant architecture and drought tolerance in maize

https://doi.org/10.21203/rs.3.rs-3176812/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 26 Dec, 2023

Read the published version in Plant Cell Reports →

You are reading this latest preprint version

Drought stress, a major plant abiotic stress, is capable of suppressing crop yield performance severely. However, the trade-off between crop drought tolerance and yield performance turns out to be significantly challenging in drought-resistant crop breeding. Several phytohormones (e.g., gibberellin (GA)) have been reported to play a certain role in plant drought response, which also take on critical significance in plant growth and development. In this study, the loss-of-function mutations of GA biosynthesis enzyme ZmGA20ox3 were produced using the CRISPR-Cas9 system in maize. As indicated by the result of two-year field trials, the above-mentioned mutants displayed semi-dwarfing phenotype with the decrease of GA₁, and almost no yield loss was generated compared with wild-type (WT) plants. Interestingly, as revealed by the transcriptome analysis, differential expressed genes (DEGs) were notably enriched in abiotic stress progresses, and biochemical tests indicated the significantly increased ABA, JA, and DIMBOA levels in mutants, suggesting that ZmGA20ox3 may take on vital significance in stress response in maize. The in-depth analysis suggested that the loss function of ZmGA20ox3 can enhance drought tolerance in maize seedling, reduce Anthesis-Silking Interval (ASI) delay while decreasing the yield loss significantly in the field under drought conditions. The results of this study supported that regulating ZmGA20ox3 can improve plant height while enhancing drought resistance in maize, thus serving as a novel method for drought-resistant genetic improvement in maize.

maize

drought stress

gibberellin

yield

GA20-oxidase

Editing ZmGA20ox3 can achieve the effect similar to applying Cycocel, which can reduce maize plant height and enhance stress resistance.

Drought, a major plant abiotic stress, has resulted in nearly 180 million Mg yield loss from 1964 to 2007, equivalent to the total global maize and wheat production in 2013 (Lesk et al., 2016). Accordingly, crop yield performance under drought stress should be urgently enhanced. Although hundreds of drought responsive genes have been validated, they cannot apply to practical production. Among the major crops, only one transgenic maize cultivar with drought resistance trait has been commercialized thus far (Zhang et al., 2020a). In general, a plant drought response system triggers growth inhibition. A serious challenge in drought-resistant crop breeding refers to resolving the trade-off between drought resistance and yield performance. Phytohormones are naturally occurring small organic molecules or substances that can affect physiological processes in plants at significantly low concentrations. As revealed by extensive research, the cross-talk between phytohormones is critical in balancing plant growth and stress response (Hou et al., 2013; Shu et al., 2018; Wang et al., 2020). Thus, improving the phytohormones cross-talk network is promising to enhance crop drought resistance while minimizing the effect on yield traits.

Gibberellin (GA) has been reported as a well-known phytohormone that plays major roles in plant development and environmental response. Although over 130 GA species, i.e., a class of diterpenoid-derived plant hormones, have been reported, most of them are biologically inactive. The above-described inactive GAs usually serve as precursors of bioactive GAs (e.g., GA₁, GA₃, GA_4, and GA₇) (Cheng et al., 2022). Plant GA biosynthesis falls into three main steps. First, the ent-kaurene is produced in proplastids. Subsequently, ent-kaurene will be transformed to GA₁₂ by microsomal cytochrome P450 monooxygenases. lastly, in the cytoplasm, GA₁₂ can be further catalyzed by GA20-oxidase (GA20ox) and GA3-oxidase (GA3ox) and transformed to bioactive GA₄ (GA12→GA9→GA4), or firstly transformed to inactive GA₅₃ by GA13-oxidase (GA13ox), and then converted to bioactive GA₁ by GA20ox and GA3ox (GA₁₂→GA₅₃→GA₂₀→GA₁) (Yamaguchi, 2008).

As GA takes on critical significance in regulating plant growth and development, remodeling GA metabolic pathway can effectively optimize crop morphology. The Green Revolution gene sd1 in rice is a GA20-oxidase gene (OsGA20ox2) involved in gibberellin biosynthesis. The mutation of OsGA20ox2 resulted in a reduced bioactive GA content in the stem (Monna et al., 2002; Sasaki et al., 2002; Spielmeyer et al., 2002). There are four GA20ox genes in rice, and due to the functional redundancy of OsGA20ox genes, mutations of OsGA20ox2 only resulted in a semi-dwarf phenotype rather than extreme dwarfism in rice. Moreover, the expression of OsGA20ox genes also shows strong spatiotemporal specificity. For instance, OsGA20ox1 is mainly expressed in reproductive organs (young spikelets), therefore sufficient active GAs could be supplied to reproductive organs to ensure the yield performance of OsGA20ox2 mutants when plant height is reduced (Monna et al., 2002; Sasaki et al., 2002). Existing research has suggested that decreased GA content and activity can improve plant drought tolerance. Several genes involved in GA biosynthesis and signaling pathways have been reported to affect crop drought resistance. For instance, the cytochrome P450 gene CYP71D8L in rice can reduce endogenous GA and enhance plant drought tolerance (Zhou et al., 2020); Ectopic expression of specific GA2ox6 in rice also reduces the active GA content of mutant rice and enhances its stress resistance (Lo et al., 2017). In addition, mutations in SlGA20ox1 and SlGA20ox2 in tomatoes do not affect stomatal closure, but can lead to a smaller canopy area of the mutant, thereby reducing water loss (Shohat et al., 2021). According to the study above, regulating GA biosynthesis may become effective in drought-resistant crop breeding.

As revealed by a previous study, five GA20ox genes exist in the maize genome (named ZmGA20ox1-5, respectively) (Song et al., 2011). In this study, we attempted to enhance maize drought resistance and minimize the effect to yield traits by regulating GA biosynthesis. By using CRISPR technology, several loss-function mutants of ZmGA20ox3 (Zm00001d042611) were constructed. All the above-mentioned mutants exhibited a lower plant height and ear height in the normal planting state, while the yield traits were almost not affected. Transcriptome analysis shows that genes affected by ZmGA20ox3 are enriched in signal transduction and stress response processes. Besides the decrease of GA level, a significant increase of JA and ABA level were detected in ZmGA20ox3 mutants, which suggest a potential role of ZmGA20ox3 in maize drought response. Through seedling-stage phenotyping experiments and field phenotyping investigations, we found that the loss function of ZmGA20ox3 could significantly enhance maize drought tolerance and yield trait performance under drought conditions, while the yield trait was not affected under normal growth conditions. Under drought conditions, ASI of ZmGA20ox3 mutant plants were significantly shorter than wild-type plants. The results of this study reveal that regulating GA biosynthesis is an applicable way for drought-resistant genetic improvement in maize.

Construction of the sgRNA-Cas9 Expression Vector

The knockout mutants of ZmGA20ox3 were produced from a high-throughput genome-editing system (Liu et al., 2020). A double sgRNAs pool approach was used for vector construction. Two target sites were designed in the first exon of ZmGA20ox3 using CRISPR-P (http://crispr.hzau.edu.cn/CRISPR2/) (Lei et al., 2014).

Target 1: 5’- AGGCACGTCAGGTCGATCAAGGG − 3’;

Target 2: 5’- ACTATGACGTGACCAAACAGTGG − 3’.

The vectors (pCXB053 and Psg-ZMU6) used in this study came from Wimi Biotechnology with modifications. The PCR fragments were amplified from Psg-ZMU6 by the primers (F:5’-CAATGGTCTCAATTGCCCGCTGCTTCTCAGCCAGGTTTTAGAGCTAGAAATAG-3’; R:5’-TTGGGGTCTCTAAACTCGTGGAAGCCGAAGGACACAATTCGGTGCTTGCGGCT-3’, digested by BsaI restriction endonuclease, and then inserted into pCXB053 to construct CRISPR/Cas9 vector p180310.

Agrobacterium-Mediated Pooled Transformation

The p180310 vector was electroporated into Agrobacterium tumefaciens strain EHA105. Immature embryos from the maize inbred line KN5855 were transformed according to the described method (Liu et al., 2020). In brief, 1.5–1.8 mm immature embryos (IEs) were isolated and infected with Agrobacterium suspension. Immature embryos were incubated in the dark at 23℃ for 48 to 72 h of cocultivation. After cocultivation, immature embryos were transferred to the resting medium and cultured for 5 to 7 d. Calluses were then transferred to the selection medium (glufosinate-ammonium 10 mg/L), incubated in the dark at 28℃ for two weeks, and transferred to a fresh selection medium for another two weeks. Resistant calluses obtained were placed on the regeneration medium, and incubated under 5000 lux at 25℃ for 14 to 21 d. Regenerated shoots were transferred to a rooting medium under 5000 lux at 25°C for 14 d. Leaves were sampled for PCR analysis before the plantlets were planted into the greenhouse. The transformation experiments were conducted by Wimi Biotechnology.

PCR Analysis of the Transgenic Plants

Fragments flanking the target site were amplified through PCR with genomic DNA as the template to determine the mutations in the target gene. The primers were GAp180310-F1: 5’-ACGGGTTCTTCCAGGTGTG-3’ and GAp180310-R1: 5’-GCGCTTTCGTTCGTTACCAT-3’. For the transgenic T₀ generation plants, PCR products were directly sequenced by Comate Bioscience Co. Ltd. To determine transgenic plants, the fragment from the Cas9 sequence was amplified through PCR with genomic DNA as the template. The primers comprised Cas9-F: 5’-AGATGATCGCCAAGAGCGAG-3’ and Cas9-R: 5’-CGATCCGTGTCTCGTACAGG-3’. In accordance with the PCR results, T₀ plants containing the Cas9 gene and mutating in the target gene were screened to obtain T₁ by crossing with KN5585. The T₂ plants were further determined through PCR and sequencing to screen out transgene-free plants with mutations in the target gene. The screened T₁ plants were self-crossed to produce T₂ progenies.

Paraffin sections for light microscopy

The paraffin sections were prepared as described (Lena and John, 2008). The middle part of the lowest stem node was harvested when the plants had grown to the eight-leaf stage. Cross-sections and longitudinal sections were prepared and then fixed in FAA solution 90 mL ethanol (70%, v/v), 5 mL acetic, and 5 mL formalin] for 24 h. Subsequently, the samples were vacuum infiltrated (30 Pa for 30–60 min) to remove air and then stored in FAA solution until analysis. Fixed samples were dehydrated with an ethanol series of 75%, 85%, 95%, and 100% (v/v) at 4℃. Samples were transferred into mixtures of ethanol– xylene of the following ratios, 3: 1, 1: 1, and 1: 3 (v/v) for 60 min for the respective step, and then to melting paraffin for 12 h at 60℃. The samples were embedded individually in paraffin. The paraffin blocks were sectioned into 7-lm sections, spread on a hot plate at 60℃, and baked in an oven at 40℃ overnight. The sections were rehydrated through xylene, xylene–ethanol (1: 1, v/v), and an ethanol series of 100%, 95%, 85%, and 75% (v/v) for 5 min for the respective step. Lastly, the sections were stained with Fe-haematoxylin and observed under a light microscope. The images were recorded following the above description at 600· magnification.

Determination of endogenous plant hormone (GA, ABA) and DIMBOA

The shoot tips of 7-week-old homozygous mutant and WT control planted in the greenhouse were collected, and 10 individual plants were mixed as one biological replicate. The above-described Endogenous hormone contents were detected using MetWare (http://www.metware.cn) on the AB Sciex QTRAP 6500 LC-MS/MS platform. The method is elucidated as follows: for endogenous GAs determination, please refer to the described method (Chen et al., 2012); for ABA determination, please refer to the described method (Izumi et al., 2009); for JA determination, please refer to the described method (Qi et al., 2016); for DIMBOA content determination, please refer to the described method (Niu et al., 2023).

Agronomic trait assessment

The transgenic plants, separated negative control and wild-type control (KN5855) were planted in the greenhouse, GMO-fields located in Jilin province (2020–2021&2021–2022; China; E125°, N44°), and GMO-fields located in Hainan province (2020–2021&2021–2022; China; E109°, N18°). At least two repeated blocks for ZmGA20ox3-KO plants and WT plants, 40 plants in each block with a layout of 2 rows × 20 plants, and the space for each plant is 25 cm × 30 cm, were designed for field tests. The plant height and ear height were examined and analyzed. The agronomic traits assessment under water-limiting conditions was performed in the GM-fields of Hainan province. We divided all materials into two groups. Each group had a special planting area, which was not adjacent to each other. The normal watering group would not affect the dry group. We have a whole area set aside for drought treatment. The drought treatment group was administrated with water saving for 15 days, during which no natural precipitation occurred and the surrounding land was not artificially watered. The water supply was stopped 50d after sowing (DAS) at V10 stage for the drought block plot, and watering was resumed to allow plants to recover at the maturing stage. The plant architecture traits (Plant height, PH; Ear height, EH), flowering time traits (Days to Tassel (days), DTT; Days to Anthesis (days), DTA; Days to Silking (days), DTS; Tassel-Anthesis Interval, TAI; Tassel-Silking Interval, TSI, Anthesis-Silking Interval, ASI), and yield traits (Ear Weight, EW; Ear Length, EL; Ear Diameter, ED; Cob Diameter, CD; and Row Number Per Ear, RNPE) were collected. Then, we evaluated the drought tolerance of different lines by comparing yield-related data.

RNA-seq analysis

To construct RNA libraries, leaves collected from WT, and GA20ox3-KO1 plants at V8 stage were subjected to RNA isolation with three biological replications. Total RNA was isolated using RNAiso Plus reagent (TaKaRa). The concentration and quality of RNA were evaluated by electrophoresis and Nanodrop2000c (Thermo Scientific, USA). Solexa/Illumina sequencing was carried out by Biomarker Biotechnology Co. Ltd., China. The technology details are consistent with the described method (Kakumanu et al., 2012), For processing mRNA reads, clean data were used to calculate the expression levels of genes using RSEM software (Li and Dewey, 2011). Besides indexes set by bowtie2, all parameters used in RSEM were default settings. Gene expression levels are reported as transcripts per million. Differential Expressed genes are further identified by R package DESeq2 under the control of |Fold change| >1.5, FDR < 0.05 threshold.

Exogenous GA₃ treatment

The wild-type plants and GA20ox3 mutants were grown in a greenhouse, and the seedlings with consistent growth at V2 stage were selected for GA₃ spraying treatment. The treatment group will be administrated with GA₃ solution (100 mg/L, 20% ethanol) once a day, spraying 50 mL each time; The control group will be sprayed with an equal amount of 20% ethanol every day for a week. After one week, the leaves of the WT plants and the GA20ox3 mutant, sprayed with exogenous GA₃ and the 20% ethanol control, were sampled and tested for expression of the relevant GA/ABA/JA pathway genes.

qRT-qPCR Analysis

The WT plants and GA20ox3 mutants (sprayed with exogenous GA3 and the 20% ethanol control) total RNAs were extracted from the leaf at V3 stage with EasyPure® Plant RNA Kit (Tran, Beijing, China), and cDNA was made using a kit TransScript® One-Step gDNA Removal and cDNA Synthesis SuperMix (Tran, Beijing, China), according to the manufacturer’s instructions. qRT-PCR was conducted using TransStart® Tip Green qPCR SuperMix (+ Dye I) (Tran, Beijing, China). The primers sequences were shown in Supplementary Table 1. Relative gene expression levels were assessed by the 2^−∆∆Ct method, with 18sRNA as an internal reference gene (LIVAK et al., 2010).

Stress treatments

Seeds were surface sterilized with 70% alcohol for 1 min and then 3% NaClO for 10 min, thoroughly rinsed with distilled water, and germinated on filter paper wetted with distilled water in plates at 26℃ for three days. Germinated seeds were transplanted into pots containing 200 g of thoroughly dried soil, and then the water content of the soil was maintained at 50%. The seedlings were grown under controlled conditions (light/dark cycles: 14h/10h; light intensity: 70 mmol/m²s; temperature: 28℃/22℃; relative humidity: 60 ± 5%) to the 3-leaf stage. Then, half of the seedlings were exposed to drought stress that water was withheld from the seedlings for five days, while the rest seedlings were still grown under the well-watered conditions.

Loss-of-function of ZmGA20ox3 product semi-dwarf phenotype in maize

The CRISPR system was adapted to generate loss-of-function mutations in maize inbred line KN5585 (Supplementary Fig. 1a, b), with the aim of determining the function of the ZmGA20ox3. 15 independent T0 transgenic plants were generated. There are four types of homozygous transgene-free mutations, which are named ZmGA20ox3-KO1, ZmGA20ox3-KO2, ZmGA20ox3-KO3, and ZmGA20ox3-KO4, were selected for further experiments. The ZmGA20ox3-KO1 presented an adenine insertion at the first target site and two nucleotides (a cytosine and an adenine) deletion at the second target site; The ZmGA20ox3-KO2, ZmGA20ox3-KO3, and ZmGA20ox3-KO4 exhibited more than 100 nucleotide deletions. All the above-mentioned mutations produce premature translation termination or protein mistranslation resulting in non-enzymatic activity GA20ox3 proteins (Fig. 1a; Supplementary Fig. 1c). While observing the plant architecture of the ZmGA20ox-KO plants, we found that all ZmGA20ox-KO plants showed the semi-dwarf phenotype both in greenhouse field. Figure 1b (planted in the greenhouse) and Fig. 1c (planted in the field) present the plant phenotype of the typically event, ZmGA20ox3-KO1. The semi-dwarf phenotype of ZmGA20ox3-KO2, ZmGA20ox3-KO3, and ZmGA20ox3-KO4 is also presented in Supplementary Fig. 2. In the field trial, mutants KO1, KO2, KO3, and KO4 achieved 24.25%, 23.09%, 21.83%, and 19.90% reduction in plant height, 27.38%, 25.33%, 30.00%, and 14.52% reduction in ear height, respectively, compared with the wild type in the year 2020 (Fig. 1d). Similar results were also reproduced in the year 2021 (Supplementary Fig. 3a). Moreover, interestingly, we found that the plant height improvement effect of ZmGA20ox3-KO1 (KN5585) F1 hybrids was intermediate compared with the parents, suggesting incomplete dominance or a dose-response effect of a reduced height. In the case of ZmGA20ox3-KO1 (KN5585) × PH6WC F1 hybrids, the plant height decreased by 2.8–15.9%; In the case of ZmGA20ox3-KO1 (KN5585) × PH4CV F1 hybrids, the plant height decreased by 4.1–6.7% (Supplementary Fig. 3b). As revealed by the above-described results, it is possible to obtain moderate improvement in hybrid plant height by knockout ZmGA20ox3 in a single parent.

Furthermore, the yield trait between ZmGA20ox-KO and WT was investigated. Compared with the WT, ZmGA20ox-KO plants achieved a significant decrease in ear length, increase in ear weight, ear diameter, row number per ear, grain weight, and cob diameter (Table 1). The results of this study indicated that the knockout of the ZmGA20ox gene would not reduce the yield of maize, similar to an existing field study by ZmGA20ox-RNAi (Paciorek et al., 2022).

Table 1

The agronomic characters in 2020 and 2021 of ZmGA20ox-KO and WT plants in Jilin
Year	Sample	Ear Weight (g)	Ear Length (cm)	Ear Diameter (cm)	Row Number per Ear (n)	100-Grain Weight (g)	Grain Weight (g)	Cob Diameter (cm)
2020	WT	78.75 ± 5.45	13.69 ± 0.78	40.93 ± 2.74	14.31 ± 1.11	26.25 ± 1.69	59.08 ± 4.58	25.75 ± 1.25
	KO1	82.99 ± 6.36	12.80 ± 0.91*	45.30 ± 2.25*	15.40 ± 1.89	29.47 ± 1.21*	62.97 ± 5.41	29.69 ± 1.15*
	KO2	82.31 ± 5.91	12.45 ± 0.96*	45.44 ± 1.56*	15.40 ± 1.35	30.00 ± 1.13*	63.51 ± 5.13	28.69 ± 1.11*
2021	WT	78.96 ± 6.98	13.30 ± 0.95	40.64 ± 1.46	14.80 ± 1.01	24.15 ± 3.79	57.54 ± 1.52	27.22 ± 5.67
	KO1	91.61 ± 6.79*	13.175 ± 0.55	45.59 ± 1.15*	16.10 ± 1.02*	26.41 ± 2.24	65.92 ± 1.63*	31.55 ± 6.16*
	KO2	84.88 ± 5.07*	11.81.45 ± 0.94*	44.03 ± 1.32*	16.10 ± 1.51*	27.43 ± 2.43	64.96 ± 1.55*	29.46 ± 4.19*
Note: Means (± SD) within a column followed by different letters are significantly different (t-test, *P ≤ 0.01), n ≥ 20.

ZmGA20ox3-KO deceased inter-node length by reduce bioactive GA content

The paraffin section morphology of the internodes at the lowest stem nod in the eight-leaf-stage plants grown in a greenhouse was observed under a light microscope to explain the cytological basis of semi-dwarf phenotype in the ZmGA20ox-KO plant in depth. Comparing the transverse sections of the stems, no significant differences were identified between ZmGA20ox-KO1 and WT materials. While comparing the longitudinal sections of the stems, ZmGA20ox-KO1 material had smaller cells and more cells per unit area (Fig. 2a). To further determine whether the deceased inter-node length of the ZmGA20ox-KO plant arose from blocked gibberellin synthesis, the contents of endogenous gibberellins (GA₁, GA₄, GA₂₀, and GA₅₃) in homozygous ZmGA20ox-KO plants and WT plants grown in a greenhouse were examined by nano-LC–ESI-Q-TOF-MS method (Fig. 2b). The content of GA₁, the main bioactive gibberellin in maize, was significantly lower in the ZmGA20ox-KO plant material than in WT, whereas the content of its precursor, GA₅₃, was significantly higher in the mutant. This suggested that the synthesis reaction after GA₅₃ was affected. Furthermore, the content of GA₂₀ was notably lower in the ZmGA20ox-KO plant than in the WT, suggesting that the synthesis reaction catalyzed by GA20oxs was affected. In addition, very low levels of GA₄ were also detected in the edited material and WT, but no significant differences were identified in the ZmGA20ox-KO plants and WT plants. In general, as indicated by the above-mentioned results, the semi-dwarf phenotype of the edited material was mainly caused by the loss-function of ZmGA20ox3 that affected the biosynthesis of GA₁.

Moreover, the result of this study supported that the dwarf phenotype of ZmGA20ox-KO could be restored by exogenous GA₃ treatment, suggesting that ZmGA20ox-KO is a GA-deficient mutant (Fig. 3). The above-described revealed that ZmGA20ox-KO produces a GA-deficient phenotype through catalyzing deactivation of bioactive GA pathway.

Differential transcriptome analysis suggests ZmGA20ox3 regulates maize stress response progresses

Transcriptome comparison analysis for WT and ZmGA20ox3-KO1 mutant plants was performed to dissect the function of the ZmGA20ox3 in depth. Totally 3762 differentially expressed genes (DEGs) were identified. To be specific, 2348 genes were up-regulated, and 1414 genes were down-regulated in mutant plants. A total of 13 genes, including 12 up-regulated genes and 1 down-regulated gene, were selected (Supplementary Table 1), and the expression was validated by qRT-PCR, to verify the transcriptomic data. The expression patterns of the above-mentioned 13 genes were consistent with the trend of differential transcriptome data, proving that the transcriptome data was accurate (Supplementary Fig. 7). GO enrichment result showed that DEGs were significantly enriched in abiotic stress (adjusted P = 1.25x10^− 8) and signal transduction (adjusted P = 1.48x10^− 9) progresses (Fig. 4a, b; Supplementary Table 2). We found that several validated positive regulators of drought response were significantly up-regulated in mutant plants, including several known transcription factors such as ZmMYBR3, ZmNAC49, ZmNAC55, and ZmWRKY40, protein kinase ZmCPK4, and S-type anion channel ZmSLAC1 (Fig. 4c). Next, the qPCR validation for ZmMYBR3, ZmNAC49, ZmNAC55 and ZmCPK4 were performed. Compared with WT, all the above-described four genes were significantly up-regulated in mutants. The above-mentioned drought response marker genes could restore their expression by treatment with active gibberellin GA₃ (Supplementary Fig. 7). Moreover, we found that the expression of ZmGA20ox3 was also repressed under drought stress (Supplementary Fig. 4). The above-described results suggested that ZmGA20ox3 can regulate the expression of several drought response genes by controlling endogenous GA content, and it may negatively regulate maize drought response.

Consistent with the antagonistic relationship between the GA and JA/ABA signal pathways in previous studies, we found DEGs were enriched in the ABA and JA signal transduction pathways. Several genes participated in ABA and JA biosynthesis significantly up-regulated in mutant plants (Fig. 5a, b; Fig. 6a, b; Supplementary Table 2). The above-mentioned results suggested that ZmGA20ox3 may not only regulate ABA and JA signal transduction but also affect ABA and JA biosynthesis. To confirm this hypothesis, we test ABA and JA content in both mutant and WT plants. The result showed that compared with wild-type plants, the content of ABA and JA was significantly increased in mutant plants (Fig. 5c; Fig. 6c). Besides a significant enrichment in stress response progress, we find DEGs are also enriched in secondary metabolic progress. For instance, benzoxazinoids are a class of indole-derived plant metabolites that defend against numerous pests and pathogens (Zhou et al., 2018). Several genes involved in benzoxazinoid metabolic progress were significantly up-regulated in mutant plants (Fig. 7a, b). To confirm the effect of ZmGA20ox3 on benzoxazinoid metabolic progress, the content of DIMBOA, a well-known benzoxazinoid in maize, was examined in both WT and ZmGA20ox3 mutant plants. Compared with WT plants, the DIMBOA content in mutant plants was significantly increased by 22%.

GA content regulates maize JA / ABA/ BXs signal pathways

To test whether the active GA-deficient impact multiple stress response, we further performed qRT-PCR of the key point genes involving in JA / ABA / BXs pathways in ZmGA20ox-KO (untreated), and ZmGA20ox-KO (administrated with GA₃). Compare with WT, the expression levels of NCED3 and NCED9 in ABA metabolic pathways were up-regulated in GA₃₋untreated mutants and decreased significantly after GA₃ treatment. A similar phenomenon was found in JA and BXs pathways. The expression levels of AOC1, AOS1, AOS2 and AOS5 in the JA metabolism pathway were all up-regulated in untreated mutants, and decreased after being administrated with GA₃. In benzoxazinoid metabolic progress, two critical genes encoding benzoxazinone synthesis, Bx11 and Bx12, were up-regulated in untreated mutants, and Bx12 decreased after GA₃ treatment (Supplementary Fig. 7).

Taken together, the results of this study supported that the differential expression patterns between WT and ZmGA20ox-KO in JA / ABA/ benzoxazinoids signal pathways were caused by the lack of active GA. Since JA and ABA are widely involved in plant drought response, we speculated ZmGA20ox3 may negatively regulate maize drought response by depressing ABA and JA biosynthesis and signal transduction. Considering DIMBOA has been reported to play an important role in maize microbial defense and insect defense progress (Gleńsk et al., 2016; Zhang et al., 2021), we further hypothesize that ZmGA20ox3 may also take participate in maize biotic stress.

ZmGA20ox3-KO enhances maize field performance under drought stress

To test whether ZmGA20ox3-KO improve drought tolerance, we investigated the growth and yield trait performance of mutant plants under Well-Watered (WW) Drought-Stressed (DS) conditions. At the seedling stage, although mutant plants were smaller than WT plants under well-watered conditions, the growth inhibition of mutant plants was more slightly than WT plants under drought stress (Fig. 8a). In the field trial, compared with the well-watered conditions, the plant height and ear height of WT plants decreased by 29.0% and 23.5% respectively under the drought condition. However, less than 5% of plant height decreased and no significant ear height decrease was observed in mutant plants under drought condition, which was similar to the results at the seedling stage (Fig. 8b; Supplementary Fig. 5a; Supplementary Fig. 6). Meanwhile, the mutant plants showed no significant reduction in grains weight per spike compared to the WT plants under the well-watered condition, while under the drought condition, only a 38.5% reduction in grains weight per spike was observed in mutant plants when a 77.0% reduction ear weight was observed in WT plants (Fig. 8c).

As is well known, Anthesis silking interval (ASI) is an important index to measure the stress tolerance of maize. When maize suffers from drought, ASI will be severely delayed, leading to abnormal pollination and serious yield loss. In previous study, the GA signaling pathway was reported to be involved in plant flowering (Bao et al., 2020). To test the effect of ZmGA20ox3-KO on maize ASI, flowering data of WT and mutant plants under both well-watered and drought-stressed were also collected. Compared with WT plants, flowering time showed no significant difference in mutant plants under well-watered conditions. However, the flowering time of WT plants was delayed significantly, and ASI increased dramatically than mutant plants under drought conditions (Fig. 8d; Supplementary Fig. 5b-d). In summary, the results of this study suggested that the loss-of-function of ZmGA20ox3 provides a new method for drought-resistant genetic improvement in maize.

The severe loss of crop yield due to drought stress has made breeding for drought-resistant crops a very urgent issue. Plants under drought stress often show obvious growth inhibition, which is mainly achieved by regulating the content of hormones, especially gibberellin, in the body. It has been shown that regulation of gibberellin in plants can improve the drought resistance of plants, which indicates the potential application of regulation of gibberellin synthesis in drought resistance breeding (Sasaki et al., 2002; Lo et al., 2017; Chen et al., 2019). In this study, the maize GA20ox3 gene was edited using CRISPR/Cas9 technology, and semi-dwarf maize plants without transgenic components and with moderately reduced plant height were obtained. The target gene selected for gene editing, ZmGA20ox3, was highly identical to the rice SD1 gene and should serve as a vital enzyme catalyzing bioactive GA synthesis in maize, involved in the sequential oxidation step from GA₅₃ to GA₂₀ during GA₁ biosynthesis (Yamaguchi, 2008). Assays of GA₁ and its precursors (GA₅₃ and GA₂₀) confirmed the accumulation of GA₅₃ and reduction of GA₂₀ and GA₁ in ZmGA20ox3 edited plants compared with WT plants. The deficiency of bioactive gibberellins should critically account for the reduced plant height. Nevertheless, the editing of this gene led to the generation of a semi-dwarf phenotype with a moderate reduction in plant height rather than an extreme dwarf phenotype, it could be due to the functional redundancy of GA20-oxidase in maize. Because nine GA20-oxidase genes have been identified in the maize genome (Nelissen et al., 2012; Song et al., 2011; Paciorek et al., 2022), mutations in ga20ox5 also exhibit a semi-dwarf phenotype (Zhang et al., 2020b; Paciorek et al., 2022). Besides, an earlier study in Arabidopsis identified functional redundancy of GA20ox-like genes (Rieu et al., 2008).

Since GA serves as a vital hormone for regulating plant growth and development. Editing the ZmGA20ox3 gene resulted in a decrease in bioactive GA content, which in turn triggered a series of transcription changes. Through transcriptome analysis of mutants and controls, we found that functional enrichment analysis showed that the above-described differentially expressed genes were significantly enriched during abiotic stress and signal transduction. Lower endogenous GA levels can reduce the degradation of DELLAs (Sun, 2008), and DELLAs can directly or indirectly induce a range of transcription factors associated with abiotic stress (Gallego-Bartolomé et al., 2011; Sun, 2010; Van De Velde et al., 2017). RNA-seq results showed that genes such as MYB, WRKY, NAC, RBOHC, CPK and SLAC did show significant expression changes in the edited plants. The above-mentioned genes are all correlated with drought tolerance (Xiang et al.,2021; Wu et al.,2019; Jiang et al.,2013; Mao et al.,2016; Gao et al.,2022; Li et al.,2022). Jasmonic acid (JA) and gibberellic acid (GA) serve as vital plant hormones mediating defense and growth respectively. Plants are capable of achieving mutual antagonism of JA and GA pathways through mutual inhibition of JAZ and DELLA of the gibberellin pathway (Cheng H, et al., 2009; Yang et al., 2012). In ZmGA20ox3 knockout materials, the differentially expressed genes are enriched in the JA signal transduction pathway and the JA synthesis pathway (e.g., AOC1, AOS1, AOS2, AOS5, LOX7, LOX8, OPR1 and OPR2), suggesting that GA defects will affect the JA signal transduction and synthesis process. Some research has suggested that GA antagonizes JA-mediated defense. GA signals are negatively regulated by DELLAs coordinate growth and defense against biological stress through strong interaction with JA pathway (Cheng et al. 2009; Hou et al. 2010; Navarro et al. 2008; Wild et al. 2012; Yang et al. 2012). In the absence of GA, stable DELLAs compete with MYC2 to bind JAZs, such that MYC2 is released, and the expression of JA-responsive genes is activated through MYC2 binding to the G-box motif. Up-regulated GA levels can trigger the degradation of DELLAs and the release of JAZs to bind to MYC2, such that MYC2 activity can be inhibited, and JA signaling can be weakened (Hou et al. 2013). In this study, some MYC family members were up-reregulated in the transcriptome data (Supplementary Table 2), similar to the results of existing research, again confirming that the JA pathway can be affected by regulating GA content. Moreover, as revealed by existing evidence, GA treatment does not exert any significant effect on the expression of JA gene (Hou et al. 2010; Navarro et al. 2008). Besides, similar expression patterns were found after GA₃ was applied to GA20ox3 mutations, and slight changes in the expression of genes were correlated with the JA pathway (Fig. 6), whereas no significant changes were reported compared with GA20ox3 mutants without GA₃. As indicated by the above result, under adverse conditions, crosstalk between DELLAs and JAZs allowed plants to quickly regulate stress responses in a manner appropriate to the growth state as indicated by GA levels (Hou et al. 2013).

In this study, altered gene expression patterns were also identified in several GA and ABA pathways in the transcriptome data. For instance, for the expression of GA2ox family member genes in GA pathway, GA2ox6 and GA2ox13 was up-regulated, GA2ox9 was down-regulated. Moreover, genes were enriched in ABA synthesis and the signal transduction pathway. To be specific, NCED1, NCED3, NCED3, NCED9, and AAO3 were up-regulated, consistent with the antagonistic relationship between GA and ABA signal pathway in existing research (Shu et al., 2018). In tomato, the expression of GA20ox1 and GA20ox2 biosynthetic genes in leaf tissues and protective cells was down-regulated, and GA2ox7 inactivated by water deficit achieved the up-regulated expression via ABA-dependent and ABA-independent pathways (Shohat et al., 2021). Drought and ABA up-regulation of GA2ox7 can be mediated by the transcription factor DREB-TINY1 (Shohat et al., 2021). The above-described molecular changes led to the down-regulated levels of bioactive GAs and accumulation of DELLA. In turn, DELLA inhibited leaf growth early in soil dehydration while promoting ABA-induced stomatal closure. In leaf tissues, GA20ox1 and GA20ox2 expression levels took on critical significance in growth regulation. In protective cells, however, GA2ox7 plays a major role in stomatal closure. Inhibition of leaf growth and early closure of stomata can reduce transpiration while promoting "drought avoidance" (Shohat et al., 2021). ABA and GA antagonistically regulate a considerable number of developmental processes and responses to biological or abiotic stresses in higher plants. Existing research has confirmed that the loss of function te (Tiller Enhancer, TE) mutant in rice serves as an activator of the APC/CTE complex, resulting in hypersensitivity and hyposensitivity to ABA and GA, respectively (Lin et al., 2015). TE interacted with ABA receptors OsPYL/RCARs while facilitating their proteasome degradation. Moreover, OsPYL/RCARs act downstream of TE in regulating ABA response. Conversely, ABA inhibits APC/CTE activity by activating SNF1-associated protein kinases (SnRK2s) to phosphorylate TE, which may interrupt the interaction between TE and OsPYL/RCARs and subsequently stabilize OsPYL/RCARs. In contrast, GA is capable of reducing SnRK2s levels, and it is likely to facilitate APC/CTE-mediated OsPYL/RCARs degradation (Lin et al., 2015). NCED family genes have been reported as vital enzymes in ABA biosynthesis under drought stress (Iuch et al., 2001; Lee et al., 2021). Furthermore, NCED9 adversely affects GA biosynthesis. The germination rate of nced9 mutants administrated with GA biosynthesis inhibitors was higher than that of the wild type, suggesting that ABA biosynthesis regulates the GA synthesis pathway in seeds (Seo et al., 2016). In this study, the absence of GA led to the up-regulated expression in nced family.

Since JA and ABA signal pathways are reported to be widely involved in drought resistance response of plants (Feng et al., 2022; Fang et al., 2016), this study suggested that ZmGA20ox3 may regulate synthesis and signal transduction of JA and ABA in response to drought response by affecting GA synthesis. As indicated by the analysis of the field traits, compared with wild-type plants, KO plants reduced plant height and ear height under normal conditions without affecting yield. The above trait can contribute to the resistance of maize to overturning. Moreover, under drought conditions, the agronomic traits of KO plants were significantly better than those of wild-type plants (e.g., shorter spatting-pollen dispersal interval and nearly three-fold increase in yield).

In brief, this study confirmed that editing ZmGA20ox3 is capable of modulating endogenous GA levels, which led to semi-dwarf Phenotype without reducing yield. Moreover, the above-mentioned manipulations resulted in enhanced tolerance to drought stress. This advanced version of the Green Revolution can apply to the optimization of plant architecture and abiotic stress resistance, such that more excellent varieties requiring less water but with higher yields can be produced.

Funding

This work was supported by

Agricultural Science and Technology Innovation Program of Jilin Province (CXGC2020RCG007)
Jilin Scientific and Technological Development Program (20230101245JC)
Industrial Technology Research and development Project of Jilin Province (2022C037-3)
The Basic Research Funds of JAAS (KYJF2021JQ002)
Changchun Science and Technology planning Project (21ZY13)

Data Availability

Data will be made available on request.

Competing Interests

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest

Author contribution

Xiangguo Liu, Yidan Li and Xiaopeng Sun designed the research;

Yang Liu, Chuang Zhang, Bingyang Li, Jia Guo, Ziqi Chen, Qing Liu, Yuejia Yin, Yang Hu and Hanchao Xia performed experiments;

Yang Liu, Ziqi Chen, Xiaopeng Sun and Yidan Li performed data analysis;

Yidan Li, Yang Liu, Ziqi Chen, Xiaopeng Sun and Xiangguo Liu wrote the manuscript. All authors participated in discussion and revision of the manuscript.

These authors contributed equally: Yang Liu and Ziqi Chen.

Corresponding authors: Xiangguo Liu: [email protected]; Yidan Li: [email protected]; Xiaopeng Sun: [email protected]

Bao, S., Hua, C., Shen, L., & Yu, H. (2020). New insights into gibberellin signaling in regulating flowering in Arabidopsis. Journal of Integrative Plant Biology, 62(1), 118–131.
Chen, M. L., Fu, X. M., Liu, J. Q., Ye, T. T., Hou, S. Y., Huang, Y. Q., Yuan, B. F., Wu, Y., & Feng, Y. Q. (2012). Highly sensitive and quantitative profiling of acidic phytohormones using derivatization approach coupled with nano-LC-ESI-Q-TOF-MS analysis. Journal of Chromatography. B, Analytical Technologies in the Biomedical and Life Sciences, 905, 67–74.
Chen, Z., Liu, Y., Yin, Y., Liu, Q., Li, N., Li, X., He, W., Hao, D., Liu, X., Guo, C. (2019). Expression of AtGA2ox1 enhances drought tolerance in maize. Plant Growth Regul, 89, 203–215.
Cheng, H., Song, S., Xiao, L., Soo, H. M., Cheng, Z., Xie, D., & Peng, J. (2009). Gibberellin acts through jasmonate to control the expression of MYB21, MYB24, and MYB57 to promote stamen filament growth in Arabidopsis. PLoS Genetics, 5(3), e1000440.
Cheng, J., Hill, C. B., Shabala, S., Li, C., & Zhou, M. (2022). Manipulating GA-Related Genes for Cereal Crop Improvement. International Journal of Molecular Sciences, 23(22), 14046.
Fang, L., Su, L., Sun, X., Li, X., Sun, M., Karungo, S. K., Fang, S., Chu, J., Li, S., & Xin, H. (2016). Expression of Vitis amurensis NAC26 in Arabidopsis enhances drought tolerance by modulating jasmonic acid synthesis. Journal of Experimental Botany, 67(9), 2829–2845.
Feng, X., Jia, L., Cai, Y., Guan, H., Zheng, D., Zhang, W., Xiong, H., Zhou, H., Wen, Y., Hu, Y., Zhang, X., Wang, Q., Wu, F., Xu, J., & Lu, Y. (2022). ABA-inducible DEEPER ROOTING 1 improves adaptation of maize to water deficiency. Plant Biotechnology Journal, 20(11), 2077–2088.
Gallego-Bartolomé, J., Alabadí, D., & Blázquez, M. A. (2011). DELLA-induced early transcriptional changes during etiolated development in Arabidopsis thaliana. PloS One, 6(8), e23918.
Gao, H., Cui, J., Liu, S., Wang, S., Lian, Y., Bai, Y., Zhu, T., Wu, H., Wang, Y., Yang, S., Li, X., Zhuang, J., Chen, L., Gong, Z., & Qin, F. (2022). Natural variations of ZmSRO1d modulate the trade-off between drought resistance and yield by affecting ZmRBOHC-mediated stomatal ROS production in maize. Molecular Plant, 15(10), 1558–1574.
Gleńsk, M., Gajda, B., Franiczek, R., Krzyżanowska, B., Biskup, I., & Włodarczyk, M. (2016). In vitro evaluation of the antioxidant and antimicrobial activity of DIMBOA [2,4-dihydroxy-7-methoxy-2H-1,4-benzoxazin-3(4H)-one]. Natural Product Research, 30(11), 1305–1308.
Hou, X., Ding, L., & Yu, H. (2013). Crosstalk between GA and JA signaling mediates plant growth and defense. Plant Cell Reports, 32(7), 1067–1074.
Hou X, Lee LY, Xia K, Yan Y, Yu H. (2010). DELLAs modulate jasmonate signaling via competitive binding to JAZs. Dev Cell, 19:884–894
Hou, X. L., Ding, L. H., & Yu, H. (2013). Crosstalk between GA and JA signaling mediates plant growth and defense. (special issue: plant hormone signaling (volume ii).). Plant Cell Reports, (7), 32.
Izumi Y, Okazawa A, Bamba T, Kobayashi A, Fukusaki E (2009) Development of a method for comprehensive and quantitative analysis of plant hormones by highly sensitive nanoflow liquid chromatography–electrospray ionization–ion trap mass spectrometry. Anal Chim Acta, 648: 215–225.
Iuch, S.; Kobayashi, M.; Taji, T.; Naramoto, M.; Seki, M.; Kato, T.; Tabata, S.; Kakubari, Y.; Yamaguchi-Shinozaki, K.; Shinozaki, K. (2001). Regulation of drought tolerance by gene manipulation of 9-cis-epoxycarotenoid dioxygenase, a key enzyme in abscisic acid biosynthesis in Arabidopsis. Plant J, 27, 325–333.
Jiang, S., Zhang, D., Wang, L., Pan, J., Liu, Y., Kong, X., Zhou, Y., & Li, D. (2013). A maize calcium-dependent protein kinase gene, ZmCPK4, positively regulated abscisic acid signaling and enhanced drought stress tolerance in transgenic Arabidopsis. Plant Physiology and Biochemistry, 71, 112–120.
Kakumanu, A., Ambavaram, M. M., Klumas, C., Krishnan, A., Batlang, U., Myers, E., Grene, R., & Pereira, A. (2012). Effects of drought on gene expression in maize reproductive and leaf meristem tissue revealed by RNA-Seq. Plant Physiology, 160(2), 846–867.
Lei, Y., Lu, L., Liu, H. Y., Li, S., Xing, F., & Chen, L. L. (2014). CRISPR-P: a web tool for synthetic single-guide RNA design of CRISPR-system in plants. Molecular Plant, 7(9), 1494–1496.
Lee S-U, Mun B-G, Bae E-K, Kim J-Y, Kim H-H, Shahid M, Choi Y-I, Hussain A and Yun B-W (2021) Drought Stress-Mediated Transcriptome Profile Reveals NCED as a Key Player Modulating Drought Tolerance in Populus davidiana. Front. Plant Sci. 12:755539.
Lena T. Spencer, John D. Bancroft. (2008). Microtomy: Paraffin and Frozen, Editor(s): John D. Bancroft, Marilyn Gamble, Theory and Practice of Histological Techniques (Sixth Edition), Churchill Livingstone, Pages 93-104, ISBN 9780443102790.
Lesk, C., Rowhani, P., & Ramankutty, N. (2016). Influence of extreme weather disasters on global crop production. Nature, 529(7584), 84–87.
Li, B., & Dewey, C. N. (2011). RSEM: accurate transcript quantification from RNA-Seq data with or without a reference genome. BMC Bioinformatics, 12, 323.
Li, X. D., Gao, Y. Q., Wu, W. H., Chen, L. M., & Wang, Y. (2022). Two calcium-dependent protein kinases enhance maize drought tolerance by activating anion channel ZmSLAC1 in guard cells. Plant Biotechnology Journal, 20(1), 143–157.
Lin, Q., Wu, F., Sheng, P., Zhang, Z., Zhang, X., Guo, X., Wang, J., Cheng, Z., Wang, J., Wang, H., Wan, J. (2015). The snrk2-apc/cte regulatory module mediates the antagonistic action of gibberellic acid and abscisic acid pathways. Nature Communications, 6, 7981.
Liu, B., Zhang, B., Yang, Z., Liu, Y., Yang, S., Shi, Y., Jiang, C., & Qin, F. (2021). Manipulating ZmEXPA4 expression ameliorates the drought-induced prolonged anthesis and silking interval in maize. The Plant Cell, 33(6), 2058–2071.
Liu, H. J., Jian, L., Xu, J., Zhang, Q., Zhang, M., Jin, M., Peng, Y., Yan, J., Han, B., Liu, J., Gao, F., Liu, X., Huang, L., Wei, W., Ding, Y., Yang, X., Li, Z., Zhang, M., Sun, J., Bai, M., … Yan, J. (2020). High-Throughput CRISPR/Cas9 Mutagenesis Streamlines Trait Gene Identification in Maize. The Plant Cell, 32(5), 1397–1413.
Livak KJ, Schmittgen TD. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods, 25(4):402–8.
Lo, S. F., Ho, T. D., Liu, Y. L., Jiang, M. J., Hsieh, K. T., Chen, K. T., Yu, L. C., Lee, M. H., Chen, C. Y., Huang, T. P., Kojima, M., Sakakibara, H., Chen, L. J., & Yu, S. M. (2017). Ectopic expression of specific GA2 oxidase mutants promotes yield and stress tolerance in rice. Plant biotechnology journal, 15(7), 850–864.
Mao, H., Yu, L., Han, R., Li, Z., & Liu, H. (2016). ZmNAC55, a maize stress-responsive NAC transcription factor, confers drought resistance in transgenic Arabidopsis. Plant Physiology and Biochemistry, 105, 55–66.
Monna, L., Kitazawa, N., Yoshino, R., Suzuki, J., Masuda, H., Maehara, Y., Tanji, M., Sato, M., Nasu, S., & Minobe, Y. (2002). Positional cloning of rice semidwarfing gene, sd-1: rice "green revolution gene" encodes a mutant enzyme involved in gibberellin synthesis. DNA Research, 9(1), 11–17.
Navarro L, Bari R, Achard P, Lison P, Nemri A, Harberd NP, Jones JD. (2008). DELLAs control plant immune responses by modulating the balance of jasmonic acid and salicylic acid signaling. Curr Biol, 18:650–655
Nelissen, H., Rymen, B., Jikumaru, Y., Demuynck, K., Van Lijsebettens, M., Kamiya, Y., Inzé, D., & Beemster, G. T. (2012). A local maximum in gibberellin levels regulates maize leaf growth by spatial control of cell division. Current Biology, 22(13), 1183–1187.
Niu Y, Zhao X, Chao W, Lu P, Bai X, Mao T. (2023). Genetic Variation, DIMBOA Accumulation, and Candidate Gene Identification in Maize Multiple Insect-Resistance. International Journal of Molecular Sciences, 24(3):2138.
Paciorek, T., Chiapelli, B. J., Wang, J. Y., Paciorek, M., Yang, H., Sant, A., Val, D. L., Boddu, J., Liu, K., Gu, C., Brzostowski, L. F., Wang, H., Allen, E. M., Dietrich, C. R., Gillespie, K. M., Edwards, J., Goldshmidt, A., Neelam, A., & Slewinski, T. L. (2022). Targeted suppression of gibberellin biosynthetic genes ZmGA20ox3 and ZmGA20ox5 produces a short stature maize ideotype. Plant Biotechnology Journal, 20(6), 1140– 1153.
Qi J, Li J, Han X, Li R, Wu J, Yu H, Hu L, Xiao Y, Lu J, Lou Y. (2016). Jasmonic acid carboxyl methyltransferase regulates development and herbivory-induced defense response in rice. J Integr Plant Biol, 58(6):564-76.
Rieu, I., Ruiz-Rivero, O., Fernandez-Garcia, N., Griffiths, J., Powers, S. J., Gong, F., Linhartova, T., Eriksson, S., Nilsson, O., Thomas, S. G., Phillips, A. L., & Hedden, P. (2008). The gibberellin biosynthetic genes AtGA20ox1 and AtGA20ox2 act, partially redundantly, to promote growth and development throughout the Arabidopsis life cycle. Plant Journal, 53(3), 488–504.
Sasaki, A., Ashikari, M., Ueguchi-Tanaka, M., Itoh, H., Nishimura, A., Swapan, D., Ishiyama, K., Saito, T., Kobayashi, M., Khush, G. S., Kitano, H., & Matsuoka, M. (2002). Green revolution: a mutant gibberellin-synthesis gene in rice. Nature, 416(6882), 701–702.
Seo M, Kanno Y,FreyA,NorthHM, Marion-poll A. (2016). Dissectionof Arabidopsis NCED9 promoter regulatory regions reveals a role for ABA synthesized in embryos in the regulation of GA-dependent seed germination. Plant Sci, 246:91–97.
Shohat, H., Cheriker, H., Kilambi, H. V., Illouz Eliaz, N., Blum, S., Amsellem, Z., Tarkowská, D., Aharoni, A., Eshed, Y., & Weiss, D. (2021). Inhibition of gibberellin accumulation by water deficiency promotes fast and long-term 'drought avoidance' responses in tomato. New Phytologist, 232(5), 1985–1998.
Shu, K., Zhou, W., Chen, F., Luo, X., & Yang, W. (2018). Abscisic Acid and Gibberellins Antagonistically Mediate Plant Development and Abiotic Stress Responses. Frontiers in Plant Science, 9, 416.
Shu, K., Zhou, W., & Yang, W. (2018). APETALA 2-domain-containing transcription factors: focusing on abscisic acid and gibberellins antagonism. New Phytologist, 217(3), 977–983.
Song, J., Guo, B., Song, F., Peng, H., Yao, Y., Zhang, Y., Sun, Q., & Ni, Z. (2011). Genome-wide identification of gibberellins metabolic enzyme genes and expression profiling analysis during seed germination in maize. Gene, 482(1-2), 34–42.
Spielmeyer, W., Ellis, M. H., & Chandler, P. M. (2002). Semidwarf (sd-1), "green revolution" rice, contains a defective gibberellin 20-oxidase gene. Proceedings of the National Academy of Sciences of the United States of America, 99(13), 9043–9048.
Sun T. P. (2008). Gibberellin metabolism, perception and signaling pathways in Arabidopsis. The Arabidopsis Book, 6, e0103.
Sun T. P. (2010). Gibberellin-GID1-DELLA: a pivotal regulatory module for plant growth and development. Plant Physiology, 154(2), 567–570.
Van De Velde, K., Ruelens, P., Geuten, K., Rohde, A., & Van Der Straeten, D. (2017). Exploiting DELLA signaling in cereals. Trends in Plant Science, 22(10), 880–893.
Wild M, Daviere JM, Cheminant S, Regnault T, Baumberger N, Heintz D, Baltz R, Genschik P, Achard P. (2012). The Arabidopsis DELLA RGA-LIKE3 is a direct target of MYC2 and modulates jasmonate signaling responses. Plant Cell, 24: 3307–3319
Wang, Q., Yu, F., & Xie, Q. (2020). Balancing growth and adaptation to stress: Crosstalk between brassinosteroid and abscisic acid signaling. Plant, Cell & Environment, 43(10), 2325–2335.
Wu, J., Jiang, Y., Liang, Y., Chen, L., Chen, W., & Cheng, B. (2019). Expression of the maize MYB transcription factor ZmMYB3R enhances drought and salt stress tolerance in transgenic plants. Plant Physiology and Biochemistry, 137, 179–188.
Xiang, Y., Sun, X., Bian, X., Wei, T., Han, T., Yan, J., & Zhang, A. (2021). The transcription factor ZmNAC49 reduces stomatal density and improves drought tolerance in maize. Journal of Experimental Botany, 72(4), 1399–1410.
Yamaguchi S. (2008). Gibberellin metabolism and its regulation. Annual Review of Plant Biology, 59, 225–251.
Yang, D. L., Yao, J., Mei, C. S., Tong, X. H., Zeng, L. J., Li, Q., Xiao, L. T., Sun, T. P., Li, J., Deng, X. W., Lee, C. M., Thomashow, M. F., Yang, Y., He, Z., & He, S. Y. (2012). Plant hormone jasmonate prioritizes defense over growth by interfering with gibberellin signaling cascade. Proceedings of the National Academy of Sciences of the United States of America, 109(19), E1192–E1200.
Zhang, C., Li, J., Li, S., Ma, C., Liu, H., Wang, L., Qi, J., & Wu, J. (2021). ZmMPK6 and ethylene signalling negatively regulate the accumulation of anti-insect metabolites DIMBOA and DIMBOA-Glc in maize inbred line A188. New phytologist, 229(4), 2273–2287.
Zhang, H., Zhao, Y., & Zhu, J. K. (2020a). Thriving under Stress: How Plants Balance Growth and the Stress Response. Developmental Cell, 55(5), 529–543.
Zhang, J., Zhang, X., Chen, R., Yang, L., Fan, K., Liu, Y., Wang, G., Ren, Z., & Liu, Y. (2020b). Generation of transgene-free semidwarf maize plants by gene editing of Gibberellin-Oxidase20-3 using CRISPR/Cas9. Frontiers in Plant Science, 11, 1048.
Zhang, P., Fan, Y., Sun, X., Chen, L., Terzaghi, W., Bucher, E., Li, L., & Dai, M. (2019). A large-scale circular RNA profiling reveals universal molecular mechanisms responsive to drought stress in maize and Arabidopsis. Plant Journal, 98(4), 697–713.
Zhou, J., Li, Z., Xiao, G., Zhai, M., Pan, X., Huang, R., & Zhang, H. (2020). CYP71D8L is a key regulator involved in growth and stress responses by mediating gibberellin homeostasis in rice. Journal of Experimental Botany, 71(3), 1160–1170.
Zhou, S., Richter, A., & Jander, G. (2018). Beyond Defense: Multiple functions of benzoxazinoids in maize metabolism. Plant & Cell Physiology, 59(8), 1528–1537.

Download PDF

Journal Publication

published 26 Dec, 2023

Read the published version in Plant Cell Reports →

Editorial decision: Minor revisions
05 Sep, 2023
Reviewers agreed at journal
06 Aug, 2023
Reviewers invited by journal
21 Jul, 2023
Editor assigned by journal
17 Jul, 2023
First submitted to journal
16 Jul, 2023

You are reading this latest preprint version

Gene Editing of ZmGA20ox3 improves plant architecture and drought tolerance in maize

Status:

Journal Publication

Version 1

Abstract

Figures

Key Message

Introduction

Materials and methods

Construction of the sgRNA-Cas9 Expression Vector

Agrobacterium-Mediated Pooled Transformation

PCR Analysis of the Transgenic Plants

Paraffin sections for light microscopy

Determination of endogenous plant hormone (GA, ABA) and DIMBOA

Agronomic trait assessment

RNA-seq analysis

Exogenous GA₃ treatment

qRT-qPCR Analysis

Stress treatments

Results

Loss-of-function of ZmGA20ox3 product semi-dwarf phenotype in maize

ZmGA20ox3-KO deceased inter-node length by reduce bioactive GA content

GA content regulates maize JA / ABA/ BXs signal pathways

Discussion

Declarations

References

Supplementary Files

Status:

Journal Publication

Version 1

Gene Editing of ZmGA20ox3 improves plant architecture and drought tolerance in maize

Status:

Journal Publication

Version 1

Abstract

Figures

Key Message

Introduction

Materials and methods

Construction of the sgRNA-Cas9 Expression Vector

Agrobacterium-Mediated Pooled Transformation

PCR Analysis of the Transgenic Plants

Paraffin sections for light microscopy

Determination of endogenous plant hormone (GA, ABA) and DIMBOA

Agronomic trait assessment

RNA-seq analysis

Exogenous GA3 treatment

qRT-qPCR Analysis

Stress treatments

Results

Loss-of-function of ZmGA20ox3 product semi-dwarf phenotype in maize

ZmGA20ox3-KO deceased inter-node length by reduce bioactive GA content

GA content regulates maize JA / ABA/ BXs signal pathways

Discussion

Declarations

References

Supplementary Files

Status:

Journal Publication

Version 1

Exogenous GA₃ treatment