2.1. Online database analysis
RNA sequencing (RNA-seq) expression profiles and clinical data for 613 renal clear cell carcinoma (KIRC) tissues along with 72 paracancerous tissues were downloaded from the database of The Cancer Genome Atlas (TCGA). Besides, the GSE53757 set of data as a supplement to the TCGA-KIRC data was downloaded from the Gene Expression Omnibus (GEO) database (https://www.ncbi.nlm.nih.gov/geo/). The R program 3.6.3 was used to analyze the expression of CTHRC1 in KIRC,based on HTSeq-fragment per kilobase per million (FPKM) data downloaded from TCGA. RNA-seq data in FPKM format were converted to transcripts per million reads (TPM) with the purpose of analyzing the expression profiles. Used to compare unpaired samples was the Mann-Whitney U test . The paired samples t-test was used to compare paired samples. Then, protein expression of CTHRC1 was studied with the help of the online tool (Human Protein Atlas (HPA) ).
With the purpose of performing a survival analysis, a large number of CTHRC1 data were downloaded from the TCGA. The cutoff values for high and low CTHRC1 expression were the median expression values. Several clinical features, including the grade of pathological , T and histological, were studied.
The KIRC data were divided into two groups based on the median CTHRC1 expression. Used the "limma" package to distinguish differentially expressed genes (DEGs) [8]. The thresholds chose for differential mRNA expression were |Fold Change (FC)| > 1.0, and p < 0.05. In order to study oncological features associated with CTHRC1, functional enrichment analyses of DEGs were performed, including Gene Ontology (GO), Kyoto Encyclopedia of Genes and Genomes (KEGG), and gene set enrichment (GSEA) analyses. The R packages clusterProfiler [9] and ggplot2 were used.
2.2. Cell culture
One normal cell line HK2 and five cancer cell lines including OSRC2, Caki-1 (ProCell, China), 786-O, A498 and 769-P, were cultured with the medium of RPMI-1640 (Gibco, Billings, MT ,US) containing ten percent concentration of fetal bovine serum (FBS) in a 5 percent carbon dioxide cell culture incubator (37℃).
2.3. Transfection in vitro
The siRNA interference sequence was designed by Tsingke Biotechnology Co., Ltd. (Beijing, China). with the following specified sequences: #1 (GUGGACCUGUAUAAUGGA), #2(GCUGUCAGCGUUGGUAUUU), and #3 (UCGCACUUCUUCUGUGGAAA). When seeded OSRC2 and 786-O cells densities reached 70%‒80%, a mixture of siRNA was used to transfect cells. The plates were incubated and the medium of the six-well plates was changed 6 hours later. The efficiency of the CTHRC1 knockdown was validated by western blotting (WB) after 96 h and real-time quantitative PCR (RT-qPCR) forty eight hours later.
2.4. qRT-PCR
Total RNA from 786-O and OSRC2 cells which were transfected with siRNA was extracted using SteadyPure Rapid RNA Extraction Kit (AgBio, China) and its concentration was determined using a NanoDrop2000 spectrophotometer (Thermo Scientific, Waltham, MA, USA). The PrimeScript™ RT Kit (Kusatsu, JPN) was used to complete RT-PCR experiment. The CFX Connect System (Bio-Rad, Hercules, CA, USA) was used to amplify previously reversed transcription products with the help of SYBR Green™ Premix Ex Taq™ II (Takara). .
Tsingke Biotechnology Co., Ltd. (Beijing, China) was chosen to synthesize the primers for CTHRC1 and β-actin. The data obtained by RT-qPCR experiments were statistically analyzed by the 2^-ΔΔCt method. The sequences of the CTHRC1 and internal reference primers were chosen as follows:
CTHRC1:
F, GTGGCTCACTTCGGCTAAAAT;
R, CACTAATCCAGCACCAATTCCTT
β-actin:
F, ACAACTTTGGTATCGTGGAAGG;
R, GCCATCACGCCACAGTTTC.
2.5. Western blotting
The total protein from cell samples was extracted with the extraction solution, which was prepared using RIPA lysis buffer in a 100:1:1 ratio with phenylmethylsulfonyl fluoride (PMSF) as the protease and phosphatase inhibitor. After using the BCA Protein Assay Kit (Solarbio, Beijing), the absorbance of the samples was measured, and the concentration of the total protein was calculated using a bovine serum albumin (BSA) standard curve. A polyvinylidene difluoride (PVDF) membrane was soaked in an appropriate amount of primary antibody and incubated 24 h at 4 °C. The membranes were washed three times. Then the secondary antibody was incubated with the PVDF membranes for 1 h. Information on antibodies was provided in the attached table(Tab. S1, Supplemental Information). After the membrane was washed three times and the reagent used for washing was TBST ,the CLINX ChemiScope S6 ( Shanghai) was used to observe the protein bands with enhanced chemiluminescence(ECL) (SS1701,Zhongguan, ).
2.6. Cell proliferation assays
CCK8 and EdU assays were chosen to determine whether CTHRC1 expression could have a positive effect on improving the proliferation capacity of ccRCC. Briefly, a 96-well plate was seeded with 3000 OSRC2 or 786-O cells per well, and when the cell density reached about 90%, the CCk8 assay was performed following the protocol for the CCK-8 reagent (APExBIO, Houston, TX, USA). The Varioskan LUX Multimode microplate reader (Thermo, USA) was chosen to measure the absorbance at 450nm.
EdU staining was performed with the Cell-Light EdU Apollo Kit (RiboBio, Guangzhou) followed by the manufacturer’ s instructions. The fluorescence of OSRC2 and 786-O cells pictures were gained using an inverted fluorescence microscope (Nikon ECLIPSE Ti, Tokyo, Japan) with EdU (Cy5) and nuclear (DAPI) fluorescent stains.
2.7. Wound healing assay
OSRC2 and 786-O cells seeded onto a six-well plate were divided into negative control (NC) and knockdown (KD) groups. Once the cell density reached approximately 90%, the monolayer was scraped using a suction tip with a volume of 200 μL. PBS as a reagent for washing was then used to wash away residual medium and floating cells. The basal medium was used to replace the medium and to continue cell culture. At two time points, 0h and 24h, an inverted microscope was used to photograph cell scratch healing. The scratch area was calculated by using ImageJ and GraphPad Prism 8 was chosen for statistical analyses .
2.8. Migration and invasion assay
For migration experiments, a 24-well plate with 500 μL of complete medium per well was selected followed by 200 μL of basal RPMI1640 medium mixed with 5 × 104 tumor cells were added to each well of a 24-well plate filled with an 8-μm Transwell chamber (Jet Biofil, Guangzhou, China) and cultured for 12 h. The chambers were removed after incubation for 12 h. The 4% paraformaldehyde and 0.5% crystal violet were used for fixation and staining, respectively. After wiping off the cells inside the chambers, the chambers were placed under a microscope, and the migrating and invading cells in three fields of view selected at random were counted.
For invasion experiments, matrigel (Corning, USA) was homogeneously layered within the chambers (50 μL per chamber) and cultured for 2 h , and then 5 × 104 tumor cells were inoculated in the Transwell chamber and cultured for 12 h. Then, the next steps were consistent with the migration experiments.
2.9. In vivo experiments
All animal experiments have passed ethical review. The female NU/NU nude murines, which were four weeks old, were produced by the Charles River Lab. . What’s more, the animals were evenly fallen into NC and KD experiment groups. Tumor cells from ccRCCs were injected subcutaneously into nude mice in the NC and KD groups. A nude mouse transplant tumor model was established, and tumors in the KD group were locally injected with CTHRC1 siRNA for observation. The length and width of medium-sized tumors were measured and recorded during each observation. Four weeks later, tumors collection was conducted after the mice was euthanized.
2.10. Data analysis
All results were obtained through multiple independent repeated experiments and presented as the mean ± standard deviation (SD), and the principle of independent and three-replicate experiments was observed in this article. Selected students t-test for difference analysis of experimental data between groups.P<0.05 was selected as a statistically significant criterion for judgment (ns, p ≥ 0.05, *, p < 0.05, **, p < 0.01, ***, p < 0.001).