Cell Culture
A549 and HCT116 cell lines were obtained from Hospital del Mar Research Institute and authenticated using Short Tandem Repeat profiling (CSIC-UAM, Madrid, Spain). mKLC cells43 were grown in DMEM (L0102, Biowest) containing 10% Fetal Bovine Serum (FBS, S181BH, Biowest) and 100 µg/ml penicillin/ streptomycin (15140122, Gibco). 3KT (HBEC3-KT) immortalized normal human bronchial cell lines62 were cultured in KSFM media (17005042, Gibco) containing 50 µg/mL of Bovine Pituitary Extract (BPE, 13028014, Gibco) and 5 ng/mL of human epidermal growth factor (hEGF, E9644, Gibco). 3KT cells expressing KrasG12D and sgRNA knockout populations were also cultured in RPMI-1640 (L0500, Biowest) media supplemented with 10% FBS and 100 µg/ml penicillin/ streptomycin. Mouse embryonic fibroblasts (MEFs) were generated from E13.5 C57BL/6J embryos. MEFs were grown in DMEM containing 10% FBS, 100 µg/ml penicillin/ streptomycin, 100µM asparagine (A4159, Sigma) and 50 µM Betamercaptoethanol (63689, Sigma). Cells were grown in 5% CO2 at 37ºC. All cell lines were regularly tested for Mycoplasma contamination and were negative.
Virus production and transduction
To generate CRISPR knockout bulk populations or clones, cell lines were transduced with a two-construct lentiviral pFUGW derived system: a constitutive vector with an mCherry-labeled Cas963 and a sgRNA expression vector21 expressing CFP. sgRNAs sequences were cloned after BsmbI (R0580S, NEB) digestion. sgRNAs targeting human genes were the following: For human Tp53: 5’-GGCAGCTACGGTTTCCGTCT-3’, and for human Rnf144b: 5’-TGACATGGTGTGCCTAAACC-3’. A non-targeting control sgRNA was used (sgCTRL: 5’-CCAGTTGCTCTGGGGGAACA-3’).
shRNAs GFP-labeled targeting mouse RNF144B (shRNF144B: 5’-TGCTGTTGACAGTGAGCGCCAGGTTATTTACATACTTTCATAGTGAAGCCACAGATGTATGAAAGTATGTAAATAACCTGATGCCTACTGCCTCGGA-3’), TRP53 (5’-TGCTGTTGACAGTGAGCGCCCACTACAAGTACATGTGTAATAGTGAAGCCACAGATGTATTACACATGTACTTGTAGTGGATGCCTACTGCCTCGGA-3’) or the shRenilla control(5’TGCTGTTGACAGTGAGCGCAGGAATTATAATGCTTATCTATAGTGAAGCCACAGATGTATAGATAAGCATTATAATTCCTATGCCTACTGCCTCGGA-3’) were generated into LMS (LTR/MCSV/SV40-puro-IRES-GFP) retroviral vector21. 3KT cells were infected with a Lenti-CMV-KrasG12D construct62. To immortalize MEFs cell cultures, retroviral vectors expressing E1a and HrasG12V were used21. For the in vivo competition assay, control MEFs were transduced with a lentiviral plex-Renilla-mCherry (Dr A. Celià-Terrassa laboratory, Hospital del Mar Research Institute, Barcelona, Spain). To perform drug response analysis of live cells, a construct expressing a nuclear localization signal (NLS) coupled to GFP was used: pTRIP-SFFV-EGFP-NLS was a gift from Nicolas Manel (Addgene plasmid # 86677). For the overexpression studies, RNF144B cDNA construct (NM_182757.4) was generated in a pcDNA3.1(+)-C-6His vector (Genscript, Netherlands).
Lentiviral supernatant was generated by transient transfection of HEK293T (ATCC) cells with the following packaging constructs: pMDL (5 µg), pRSV-rev (2.5 µg) and pVSV-G (3 µg)21. For retroviral particle production GAG (4.8 µg), and pENV (2.4 µg) constructs were used21. 10µg of vector DNA was transfected using calcium phosphate precipitation. Viral supernatant from HEK293T cells was collected after 48h, filtered, transferred to cell cultures and centrifuged at 2200 rpm at 32ºC during 2h. After 48-72h, cells were FACS-sorted for the corresponding fluorescence using a BD Influx cell sorter (BD Biosciences). If needed, CRISPR single cell clones were seeded in 96 well plates and expanded to generate isogenic populations. MEFs infected with E1a and HrasG12V were selected with Puromycin (3 µg/ml, P7255, Sigma) and Hygromycin (200 µg/ml, 400052, Sigma) for 72h. MEF immortalized cell lines were used at low passage (passage 6–14) to avoid phenotypes arising from prolonged passaging.
Animal experiments
All animal experiments are compliant with ethical regulations regarding animal research and were conducted under the approval of the Ethics Committee for Animal Experiments (CEEA-PRBB, Barcelona, Spain). Subcutaneous tumour models were performed by injection of 1 million cells suspended in 100 µl of PBS in both flanks of 7–10-week-old female Athymic Nude-Foxn1nu mice (Envigo). Tumours were grown for approximately 3 weeks and harvested at the endpoint. For in vivo competition assay, MEF cells were infected with the plex-Renilla-mCherry lentiviral construct or with GFP-labeled shRNA targeting RNF144B or TRP53. Cells were mixed 1:1, evaluated by FACS (LSR Fortessa, BD Biosciences) and 1 million cells were injected subcutaneously into the flanks. After 3 weeks tumours were harvested, minced and digested in a solution of DMEM, 0,3 mg/ml Collagenase I (C1-BIOC, Sigma) and 10 µg/ml DNAse I (DN25, Sigma) at 37ºC while shaking during 2 hours. Digested tumours were filtered through a 45 µM mesh, cleaned of red blood cells with Red Blood Lysis Buffer (11814389001, Roche) and analyzed by cytometry (Fortessa). Subcutaneous tumour growth was followed by caliper measurements and the following formula applied to measure tumour volume: volume = 1/2(length × width2). In the case that tumours did not grow in the flank, measurement was excluded from the comparative analysis.
Intercostal intrapulmonary model (iPul) was performed by injecting 200.000 A549 cells suspended in 10 µl of PBS through the ribcage into the left lung with a 29G insulin needle and a depth of 4-4.5mm. 10–12-week-old female Athymic Nude-Foxn1nu mice were used for this study. Weight was monitored biweekly and animals were euthanized at 6 weeks post-inoculation. Only mice with localized intrapulmonar tumours were taken into account for tumour burden analysis.
3KT experiments were performed by injecting 1 million cells in 100ul PBS intravenously in the tail vein and after 5 months, animals were euthanized to study lung lesions.
Lungs were inflated with 4% paraformaldehyde (PFA, sc-281692, SCBT) through the trachea and fixed overnight for histological evaluation. Lung sections were performed and scanned with an Aperio ScanScope (Leica) at the Anatomy Department (Hospital del Mar). Tumour area and lung area were measured with ImageJ to calculate tumour burden. Those mice that didn’t present any tumour growth, or that had tumoural growth outside the lung and into the thoracic space were excluded from the analysis. Mice were housed in groups of 5 per cage and irradiated chow and water were provided ad libitum.
Proliferation analysis
50.000 3KT cells were seeded in 6 well plates in triplicates and after 6 days of growth, cells were counted using Trypan Blue staining and a Countess 3 Automatic cell counter (Thermofisher).
Colony formation assay
3.000 3KT cells were seeded in 6 well plates and after 8 days of growth, cells were fixed using 4% PFA for 10 minutes and stained with 0.5% crystal violet solution (V5265, Sigma-Aldrich) for 1 hour. Plates were scanned with an Amersham Typhoon™ (Cytiva). Crystal violet was dissolved with 10% acetic acid and absorbance was read at 590 nm in a Biotek Synergy HTXmachine (Agilent).
Spheroid cultures
1.000 3KT cells were resuspended in 50 µl of cold Matrigel GFR (354230, Corning) and seeded as a drop in the wells of a 24 well plate. Soon after seeding the Matrigel domes, the plate was turned upside down and placed in the incubator for 30 min. Afterwards, 1 ml of KSFM media with 20% FBS and 1% penicillin/ streptomycin was added. Spheroids were monitored for 7 days and pictures were taken using a brightfield Olympus CKX53 microscope and an Olympus EP50 camera. Pictures were taken of 4–5 random fields per well with a 10x objective. Spheroid diameter was analyzed by ImageJ. The number of spheroids quantified was between 180 and 410 depending on the cell line. Experiment was repeated twice and performed in three technical replicates each time.
Immunoblotting
Cells were lysed in RIPA buffer containing protease inhibitors (cOmplete protease inhibitor cocktail, 11836170001, Roche). Protein extracts were quantified using the Protein Assay Dye Reagent (5000006, BioRad) and 20 µg were separated by SDS-PAGE and transferred onto nitrocellulose membranes (Cytiva Amersham). Membranes were blocked for 1h in 5% milk in PBS-T (PBS with 0.1% Tween 20) and incubated overnight with the corresponding primary antibody in PBS-T 5% milk. Antibodies were the following: mouse TRP53 (NCL-L-p53-CM5p, Leica Biosystems), human TP53 (sc-126, SCBT), βACTIN (sc-47778, SCBT), His-Tag (66005-1-Ig, ThermoFisher). Next day, membranes were washed and incubated with corresponding secondary antibodies (anti-rabbit, sc2357, or anti-mouse, sc-516102, SCBT). A549, HCT116 and MEF cells were treated with 20 µM Nutlin-3a (HY-10029, Medchemexpress) during 6 hours. 3KT cells and mKLC cells were treated with 0,2 µg/ml Doxorubicin (N31815, Sigma) and pellets were obtained at 6 and 24h. Membranes were developed using the ECL Prime system (RPN2232, Cytiva) and imaged using a ChemiDoc MP (BioRad).
Overexpression analysis
250.000 A549 or 500.000 3KT cells were seeded in 6 well plates and the following day were transfected with 1500 ng of the empty vector (pcDNA3.1 + C-6His) or the OE-RNF144B vector (RNF144B_OHu07981C_pcDNA3.1(+)-C-6His) using Lipofectamine 2000 reagent (11668027, ThermoFisher) following manufacturer instructions. Cells were counted after 72h using Trypan Blue staining and the automatic cell counter Countess 3. A pellet of cells was collected to perform western blot and confirm overexpression. Experiment was repeated thrice and performed in triplicates.
Immunohistochemistry
Tissues were collected and fixed in 4% PFA overnight and processed for paraffin-embedding. Slides were stained for Hematoxylin and Eosin (H&E) using standard protocols. Immunohistochemistry was performed with antibodies against Ki67 (12202s, CST) and pH3 (3377T, CST). Briefly, paraffin sections were re-hydrated and antigen retrieval was performed in a pressure cooker with Sodium Citrate Buffer pH6 for 20 min. 3% H2O2 was used to quench the peroxidase for 15 min and blocking was done with PBS / BSA 1% (A9647, Sigma) / 0,3 Triton-X (11332481001, Sigma) for 30min. Slides were incubated overnight at 4ºC in a humid chamber with primary antibody. The next day, sections were incubated with the 2º antibody (Impress HRP Goat Anti-Rabbit, MP-7451-15, Vector Laboratories) for 1.30h and afterwards incubated with DAB peroxidase kit (K346711-2, Agilent) and hematoxylin. Slides were mounted with DPX mounting media (06522 Sigma). A Cell Observer (Zeiss) microscope was used for imaging. Images were analyzed and quantified using Qupath64 (v0.3.2).
Amplicon sequencing of sgRNA Target Sites
A549 (isogenic clones) and 3KT cells (bulk population) carrying Cas9 and sgNT or sgRNF144B were evaluated by amplicon sequencing to detect INDELs in the sgRNA target site. Genomic DNA was extracted from the cells using the DNeasy Blood and Tissue kit (69504, Qiagen). The sgRNA target sites were PCR amplified using primers flanking the site of interest with recommended overhangs (Fwd:5’-ACACTCTTTCCCTACACGACGCTCTT CCGATCTGTGGCTGAAATGTGTGAGCA-3’ and Rev: 5’-GACTGGAGTTCAGACGTG TGCTCTTCCGATCTCTGTATTTTCTTGCTAGACTCC-3’). PCR was performed to ensure a single band was amplified and PCR products were purified using the QIAquick PCR Purification Kit (28104, Qiagen) and sent to Genewiz (Leipzig, Germany) using Amplicon-EZ service, able to read from 150-500bp.
qRT-PCR
Cells were treated with Nutlin-3a for 6h to stimulate TP53 activation or left untreated, depending on experiment. Total RNA was isolated from cells using TRIzol reagent (15596018, ThermoFisher) and reverse transcribed using SuperScript III Reverse Transcriptase (18080400, ThermoFisher) and Oligo-d(T) primers. qRT–PCR was performed using Taqman Gene Expression assays (ThermoFisher): Human TP53 (Hs01034249_m1), mouse TRP53 (Mm01731287_m1), human CDKN1A (Hs00355782_m1), mouse CDKN1A (Mm00432448_m1), human RNF144B (Hs00403456_m1), mouse RNF144B (Mm00461356_m1), housekeeping human HMBS (Hs00609297_m1) and mouse HMBS (Mm01143545_m1). Samples were analyzed in QuantStudio 12K equipment (Applied Biosystems). The mRNA expression levels of TP53 target genes of interest were standardized with HMBS housekeeping gene and normalized to the untreated control.
Metaphase spread
1,5 million cells were seeded in 10cm2 plates and treated the following day with 0.3 mg/ml of colcemid (10295892001, Roche) for 3 hours. Cells were collected and resuspended dropwise with KCL 0.056M and incubated during 20 min at RT. Cells were then fixed in cold methanol:glacial acetic acid solution (3:1) and washed 3 more times with the fixative solution. Cells were dropped on glass slides from 1,5m height, dried and stained with 3% Giemsa (GS500, Sigma). After washing, coverslips were mounted and pictures were captured using a brightfield Olympus CKX53 microscope and an Olympus EP50 camera, using a 40x objective. Chromosomes were counted manually with ImageJ Software. At least 25 cells were analyzed per cell line.
Cell cycle assay
450.000 cells were seeded in 6 well plates and the next day, cells were trypsinized, washed with PBS and fixed with cold ethanol (70%) in a dropwise manner while vortexing. After 2h of fixation, cells were pelleted, washed twice with PBS and resuspended in working solution, containing 15 µg/ml of Propidium Iodide (00-6990-50, ThermoFisher) and 300 µg/ml RNAse A (10109142001, Sigma). Cells were incubated for 2 hours at RT and cell cycle distribution was analyzed by flow cytometry using a BD LSRII-B cytometer (BD Biosciences). Data was analyzed using FlowJo software.
Edu incorporation
Edu incorporation was performed using the Click-iT EdU Alexa Fluor 647 Flow Cytometry Assay Kit (C10424, ThermoFisher). Between 250.000-350.000 cells were seeded in 12 well plates and pulsed with 10 µM EdU for 2 hours. Next, cells were harvested, fixed, permeabilized and stained using the Click-iT EdU Alexa Fluor 647 Flow Cytometry Assay Kit following manufacturer’s instructions. Cells were co-stained with a solution containing Propidium Iodide (15 µg/ml) and RNAse (300 µg/ml) to measure DNA content. Samples were analyzed using BD LSRII-B cytometer and FlowJo Software.
DNA repair quantification by immunofluorescence
15.000 cells were seeded in Phenoplate (6055302, PerkinElmer) black well plates and the following day cells were gamma-irradiated at 5Gy with an IBL-437C (CIS Biointernational). Control plate was left untreated. Cells were fixed at different timepoints with 4% PFA. Afterwards, blocking and permeabilization was performed with PBS/5% BSA/0,3% Triton-X during 1h at RT. Staining with the primary antibody p-γH2AX (9718T, CST) dissolved in PBS/1% BSA/0,3% Triton-X was performed overnight at 4ºC. The following day, cells were washed x3 with PBS and secondary anti-rabbit Alexa Fluor 647 (A21244, Invitrogen) was added during 2h at RT in the dark. Cells were washed again x2 with PBS and incubated with 1 µg/ml DAPI (D9542, Sigma) for 10 min. After washing, cells were imaged with the Opera or Operetta High Content Screening System (Perkin Elmer), using the 40x objective. Segmentation of the nuclei using the DAPI signal and quantification of the number of p-γH2AX foci per cell was done using Harmony® High-Content Imaging and Analysis Software.
Apoptosis assay
100.000 MEF cells were seeded in a 24-well plate and treated the following day with 10 µM Nutlin-3a. 24h after media and cells were collected, washed, and processed using the APC Annexin V kit (640920, Biolegend) following manufacturer’s instructions. Cells were co-stained with 1 µg/ml DAPI and analyzed with an BD LSRII-B cytometer and FlowJo Software.
Immunofluorescence imaging of mitotic cells
Between 120.000 and 150.000 cells were grown in 24-well plates. The day after cells were treated or not with 15 µM RO-3306 for 18 h at 37°C, 5% CO2. Cells were washed with PBS, fixed with 4% PFA for 10 min at RT and permeabilized with PBS / 0.1% Triton X-100 for 5 min at RT. Blocking (RT, 20 min) and incubations with antibodies (RT, 1 h) were performed with 10% FBS in PBS 0.1% / Triton X-100 and washes were done with PBS 0.1% / Triton X-100 at RT for 3 × 5 min. The antibodies targeted α-tubulin (T9026, Sigma) and γ-tubulin (T6557, Sigma). An Alexa 555 Goat anti-Mouse antibody (A-21424, Invitrogen) was used as a secondary antibody. Nuclei were counterstained with 1 µg/mL DAPI for 2 min at RT and cells were mounted using the ProLong Gold antifade reagent (P10144, Thermofisher). Confocal microscopy pictures were taken with a Leica STELLARIS microscope. For counting lagging chromosomes, DNA bridges, multipolar mitosis or centrosome numbers, at least 200 cells were analyzed for each condition.
Micronuclei assay
150.000 cells were grown in 24-well plates. The day after, cells were washed with PBS and fixed in freshly prepared 4% PFA for 10 min at RT. Nuclei were counterstained with 1 µg/mL DAPI in PBS for 2 min at RT and cells were mounted using the ProLong Gold antifade reagent. Confocal microscopy pictures were acquired in a z-stack mode with a Leica STELLARIS microscope. Micronuclei analysis has been made with Fiji software and for each field (45 random field/sample) the number of micronuclei were divided by the number of nuclei.
Live cell imaging of mitotic cells
100.000 cells were grown on 4-well chambered coverslips (80426, Ibidi). The day after, cells were treated with 15 µM RO-3306 for 18h. One hour before imaging, siR-Hoechst (SC007, Spirochrome) was added to the media at 1µM and cells were incubated at 37°C and 5% CO2. Just before imaging, media was replaced by FluoroBrite DMEM (A1896701, ThermoFisher) supplemented with 10% FBS and siR-Hoechst. Time-lapse live-cell imaging was performed using a Leica STELLARIS confocal system with white light laser inverted microscope maintaining temperature at 37°C and CO2 at 5%. Images were taken every 4 minutes with a x64 objective. Exposure time was optimized so that no phototoxicity or photobleaching was observed in cells. Image processing was performed using FIJI software.
Live cell drug survival assay
A549 cells expressing Cas9 and sgNT, sgRNF144B or sgTP53 were infected with the NLS-GFP construct and sorted for GFP positive cells. 5.000 cells were seeded in 96 Phenoplate black well plates and the following day cells were treated with increasing doses of the following drugs: Palbociclib, Abemaciclib, Paclitaxel, Docetaxel, Etoposide, Doxorubicin, RO-3306, Carboplatin and Nutlin-3a. Imaging was performed with the Operetta High Content Screening System using the x20 magnification. Cell number represented by the sum of the GFP intensity/well was quantified with the Harmony Software at day 0 (before drug treatment) and after 72h. Cell confluency was normalized to that of day 0 of the same well and compared with the untreated respective control.
LC-MS/MS Proteomics and analysis
MEFs were infected with the corresponding shRNAs in three independent biological replicas and sorted for GFP by flow cytometry using a BD Influx cell sorter (BD Biosciences). Afterwards, cells were washed with PBS, scrapped with 6M Urea and 200 mM Ammonium Bicarbonate and sonicated at 4ºC. 10 µl of each sample at 1 mg/ml was submitted for analysis. The samples were digested with Trypsin and LysC and 2 µg were analyzed by LC-MS/MS using a 90 min gradient in the Orbitrap Eclipse. Raw MS files were processed in Proteome Discoverer version 2.3.0.523 (Thermo Scientific, Waltham, MA,)65. Samples have been searched against SP_Mouse database (June 2020), using the search algorithm Mascot v2.6 (http://www.matrixscience.com/). Peptides have been filtered based on FDR and only peptides showing an FDR lower than 5% have been retained. Normalized protein abundances with “Total Peptide Amount” from Proteome Discoverer were used as input for the analysis with the DEP R package66.
6513 quantified proteins profiles were expressed on 9 samples. We only kept proteins that were based at least in two unique peptides, leading to a final protein quantification data matrix of 5388 proteins. Proteins with missing values showed a lower expression in reference to those without missing values. A full normalized matrix of protein expression values was obtained by imputing missing quantifications with a mixed methodology. Proteins with missing at random (MAR) values were imputed with k-nearest neighbors (knn) algorithm and missing not at random (MNAR) values were imputed with random draws from a Gaussian distribution centered around a minimal value (MinProb). We conducted a protein differential expression analysis based on protein-wise linear models and empirical Bayes statistics using limma67. Proteins with p-value < 0.05 and a minimum fold-change of 50% were considered as statistically significant.
Functional enrichment analysis of the biological processes was conducted with the Gene Ontology (GO) database using the clusterProfiler package68. Significant GO terms are shown with an associated p-adjusted value (determined by circle color) and GeneRatio (Number of differentially abundant proteins associated with the GO terms / number of input differentially abundant proteins). The circle size is given by the count of proteins detected that are involved in each GO term.
RNA-Seq analysis
MEFs were infected with the corresponding shRNAs in three independent biological replicas and sorted for GFP with a BD Influx cell sorter. After, cells were trypsinized and the pellet was snap frozen. RNA from 1 million cells was extracted using the Purelink RNA kit (10307963, Invitrogen) and submitted for analysis. Libraries were prepared using the TruSeq stranded mRNA Library Prep (20020594, Illumina) according to the manufacturer's protocol. Briefly, 1000 − 500 ng of total RNA were used for poly(A)-mRNA selection using poly-T oligo attached magnetic beads using two rounds of purification. RNA was fragmented under elevated temperature and primed with random hexamers for cDNA synthesis. Then, cDNA was synthesized using reverse transcriptase (SuperScript II, 18064-014, Invitrogen) and random primers. The addition of Actinomycin D to the First Strand Synthesis Act D mix (FSA) prevents spurious DNA-dependent synthesis, improving strand specificity. After that, second strand cDNA was synthesized, incorporating dUTP in place of dTTP to generate ds cDNA using DNA Polymerase I and RNase H. A corresponding single T nucleotide on the 3’ end of the adapter provided a complementary overhang for ligating the adapter to the fragments. It was followed by subsequent ligation of the multiple indexing adapter to the ends of the ds cDNA. Finally, PCR was performed with a PCR Primer Cocktail. Final libraries were analyzed using Bioanalyzer DNA 1000 or Fragment Analyzer Standard Sensitivity (DNF-473, Agilent), and were then quantified by qPCR using the KAPA Library Quantification Kit KK4835 (07960204001, Roche) prior to the amplification with Illumina’s cBot. Libraries were sequenced 1 * 50 + 8 bp on Illumina's HiSeq2500.
We performed a quality control on the 9 raw single-end reads samples using the nf-core/rnaseq (v. 3.10.1)69,70. Raw FASTQ files were aligned to the GRCm38.p6 version of the reference mouse genome using STAR (v. 2.7.6a)71 with default parameters except for --sjdbOverhang 49, producing a set of 9 BAM files. Aligned reads in BAM files were reduced to a table of 55487 genes by 9 samples. Genes were annotated using the GENCODE vM25 GTF file. Following previously established recommendations72,73, we filtered out lowly expressed genes by discarding those that did not show a minimum reliable level of expression of 20 counts per million reads of the smallest library size, in at least all the samples of the smallest group, which was 3. After the filtering, we ended up with a final table of counts of 14668 genes by 9 samples. The DESeq2 package (v. 1.40.0)72,74 was used for the differential expression analysis. Surrogate variables were calculated with SVA 75. Genes with adjusted p-value < 0.05 (5% FDR) and absolute log2FC > 1 were considered as statistically significant.
Integrative transcriptomics vs proteomics analysis was conducted to show the expression relationship patterns of differentially expressed genes vs differentially abundant proteins. Results are represented with Log2 expression ratio. The cut-offs are a minimum fold-change of 50% for the proteomics expression profile and minimum fold-change of 100% for the transcriptomics expression profile.
TCGA data analysis
To access comprehensive data on TCGA Pan-Cancer normalized gene expression, phenotypic information, and somatic mutations, we utilized the XenaBrowser76 to extract publicly available data from The Cancer Genome Atlas (TCGA) (https://www.cancer.gov/tcga). The combined cohort of TCGA, TARGET (https://www.cancer.gov/ccg/research/genome-sequencing/target), and GTEx77 samples were employed to investigate gene expression differences between normal and tumour samples. The data used for this analysis are available at the Genomic Data Commons (https://portal.gdc.cancer.gov). “Somatic mutation (SNP and INDEL)” datasets were used to determine the samples TP53 status. We employed specific criteria: if no mutation was detected or if the identified mutation was categorized as silent or located within the intronic, 5' UTR, or 3' UTR regions, Tp53 was considered wild type. Conversely, Tp53 was considered mutated if a non-silent mutation was identified. Specifically, we focused on cancer types within TCGA that contained a minimum of 20 samples, with both Tp53 wild type and Tp53 mutated entries present in the gene expression matrix.
GDC-Pancan datasets were analyzed with www.xenabrowser.net for Kaplan Meyer analysis. Samples were stratified by TP53 status, and by the gene expression levels of RNF144B (being high expression those samples with normalized expression values equal or above the median value and low expression the lower half). Samples containing null data were excluded. Kaplan Meier plots for 10-year overall survival were plotted for remaining samples. For PANCAN analyses, 5856 samples were present in the Tp53 wild type subset and 3385 samples for the mutant subset. For LUAD cancer, 252 and 244 were evaluated for Tp53 wild type and mutant subsets, respectively. Comparison between groups was evaluated with a log rank test.
RNF144B differential expression study
A pairwise two-tailed t-test was conducted to evaluate the statistical differences in log-normalized read counts of RNF144B between primary tumors and unrelated healthy solid tissue samples for each cancer type. In order to facilitate visual comparison across TCGA datasets with wild type or mutant Tp53, the expression of RNF144B was mean centered to zero prior to plotting. Analysis of RNF144B as a TP53 target gene in different mouse and human databases was performed using the TargetGeneRegulation database39.
CERES effect
RNF144B dependencies in human lung cancer cell lines were analyzed using the Achilles DepMap dataset (DepMap Public 22Q4 + Score, Chronos)36. Cell lines were categorized in Tp53 mutant or Tp53 wild type and the CERES dependency score was plotted for each of them.
ChIP-sequencing data analysis
To perform the analysis of ChIP-seq data, the FASTQ files were acquired from the Sequence Read Archive (SRA) within the Gene Expression Omnibus (GEO) public repository. The specific accession numbers GSE7117537 and GSE5572738 were utilized to retrieve the FASTQ files corresponding to mouse and human cells, respectively. We used the nf-core/chipseq pipeline (v. 1.2.2)69,70. FASTQ reads were aligned to the GRCm38.p6 reference genome. MACS2 78 was used to call peaks in the narrowPeak mode. Peaks with a q-value < 10e-5 were considered statistically significant. The resulting data was visualized using the Gviz R package79.
Aneuploidy scores analysis
RNF144B log-normalized read counts were stratified in high and low expression using the median as cut-off. For each cancer type, we conducted a two-tailed unpaired t-test between the aneuploidy scores of high and low expression samples. A comparison was also conducted stratifying by TP53 status. The term "PANCAN" denotes the analysis across all cancer types together. For the assessment of aneuploidy scores, we utilized the gene expression dataset from the TCGA Pan-Cancer (PANCAN) cohort. Aneuploidy scores were directly obtained from Supplementary Table 2 of the reference80.
GSEA analysis
GSEA81 was carried out in R using the fgsea package v1.24.082, using as a gene set the list of 70 genes (CIN70) with the highest levels of consistent correlation with ‘total functional aneuploidy’ (tFA) from the Supplementary Table 1 of the publication46. GSEA was used to test for enrichment of specific gene sets within a ranked list based on p-value and log2FC to define whether the chromosomal instability profile is enriched among the overexpressed proteins of our analysis.