Accessory genes in tropical race 4 contributed to the recent resurgence of the devastating disease of Fusarium wilt of banana

doi:10.21203/rs.3.rs-3197485/v1

Download PDF

Article

Accessory genes in tropical race 4 contributed to the recent resurgence of the devastating disease of Fusarium wilt of banana

https://doi.org/10.21203/rs.3.rs-3197485/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 16 Aug, 2024

Read the published version in Nature Microbiology →

Version 1

posted

You are reading this latest preprint version

Fusarium wilt of banana, caused by Fusarium oxysporum f. sp. cubense (Foc), is one of the most damaging plant diseases recorded. Foc race 1 (R1) decimated the Gros Michel–based banana trade. Currently, tropical race 4 (TR4) is threatening the global production of its replacement cultivar, Cavendish banana. Population genomics and phylogenetics revealed that all Cavendish banana–infecting race 4 strains shared an evolutionary origin that is distinct from R1 strains. The TR4 genome lacks accessory or pathogenicity chromosomes, reported in other F. oxysporum genomes. Accessory genes—enriched for virulence and mitochondrial-related functions—are attached to ends of some core chromosomes. Meta-transcriptomics revealed the unique induction of the entire mitochondria-localized nitric oxide (NO) biosynthesis pathway upon TR4 infection. Empirically, we confirmed the unique induction of NO burst in TR4,suggesting the involvement of nitrosative pressure in its virulence. Targeted mutagenesis demonstrated the functional importance of accessory genes SIX1 and SIX4 as virulent factors.

Biological sciences/Microbiology/Fungi/Fungal pathogenesis

Biological sciences/Evolution/Population genetics/Genetic variation

The banana shortage referred to in the 1920s musical hit “Yes! We Have No Bananas” by songwriters Frank Silver and Irving Cohn was caused by Fusarium wilt of banana (FWB), one of the most severe epidemics in agricultural history¹. The pathogen responsible for FWB is a fungus named Fusarium oxysporum f. sp. cubense (Foc), a member of the F. oxysporum species complex (FOSC). During the first half of the 20^th century, Foc race 1 (R1) destroyed millions of Gros Michel banana plants in Central America². To ensure continued banana production, Gros Michel bananas were replaced with R1-resistant Cavendish bananas as the dominant cultivated variety. Yet, at the turn of 21^st century, a resurgence of FWB caused by a different strain, tropical race 4 (TR4), again decimated banana plants, particularly Cavendish bananas. Since its initial report in Taiwan in 1989³, TR4 has spread from its suspected origin of Indonesia and Malaysia to the Northern Territory of Australia, the Philippines and mainland China⁴. Recently, TR4 was detected in the Middle East (Oman, Jordan and Pakistan), Mozambique (2013), India (2015), Vietnam (2016), Laos (2016), Myanmar (2018) and Israel (2018)⁵. Its recent appearance in Columbia (2019)⁶ and Peru (2021)⁷, which together constitute the largest Cavendish banana–exporting region of the world, poses an imminent risk to the global banana supply. Apart from threatening the production of export bananas, TR4 infects locally consumed bananas, including other banana varieties. As bananas are a staple food and one of the main dietary sources of carbohydrates in Africa, Southeast Asia and tropical America, TR4 poses a major threat to both the global banana trade and to the food security of people living in these areas, having the potential to exacerbate poverty in developing nations and create food shortages that intensify world hunger⁴.

Members of the FOSC are responsible for wilt diseases in many economically important crops⁸. Thus, F. oxysporum is listed among the top five most important plant pathogens⁹. Horizontally inherited accessory chromosomes (ACs)—also referred to as pathogenicity, dispensable, or lineage-specific chromosomes—that are deficient in genes associated with housekeeping functions, but enriched in genes related to fungal virulence, determine the host-specific pathogenicity among FOSC members^10-14.

Three Foc races have been distinguished based on their host-specific pathogenicity on certain banana cultivars. Foc strains are further divided into 24 vegetative compatibility groups (VCGs)^15-17, reflecting the ability of strains within the same VCG group to fuse and form heterokaryons. Closely related Foc VCGs are grouped in phylogenetic lineages^15,18. The pathogen that destroyed the Gros Michel banana industry belongs to Foc R1¹⁹. Foc race 2 (R2) affects ‘Bluggoe’ (ABB) bananas and other cooking bananas²⁰. Foc TR4 is a member of Foc race 4 (R4), which also includes Foc subtropical race 4 (STR4) that infects Cavendish bananas grown in subtropical regions under sub-optimal conditions (cool temperatures, water stress or poor soil health). TR4 causes disease in banana plants grown in both the tropics and subtropics even in the absence of predisposition to stress factors²⁰ (Fig. 1a). Most reported TR4 strains belong to the VCG 01213/16 complex. Strains belonging to the distinct VCG 0121 complex also cause disease in Cavendish bananas similar too TR4⁴.

The international research community has generated genomic resources that include the assemblies of UK0001²¹, TR4 58²² and PerS4 (Peru strain)²³ and has re-sequenced Foc TR4 strains from Israel/Middle East²⁴, Colombia⁶, Laos, Vietnam and Myanmar²⁵. However, our understanding of the Foc evolutionary history and of the pathogenesis of TR4 remains limited. Here, we explored the genetic diversity among Foc strains with a focus on understanding the genetic basis of TR4 virulence. By comparing 35 Foc isolates covering 23 VCG groups, we confirmed thepolyphyletic nature of Foc and discovered that all R4 strains—TR4, STR4 and VCG 0121—share a single origin and that VCG 0121 and TR4 01213/16 VCG complexes may represent progenies of a mating population. High-quality TR4 genome assembly lacks independent accessory chromosomes but possesses accessory genes that are attached to the ends of several core chromosomes. The TR4 accessory genes are enriched for virulence and mitochondria-related functions. Based on our genomics, transcriptomics and pathogenicity studies, we established that the mitochondria-localized fungal nitric oxide (NO) biosynthesis pathway is involved in the TR4–banana interaction. Biochemical and molecular characterization as well as reverse genetics confirmed that the acquisition of accessory genes contributes directly to TR4 pathogenesis.

1. Foc strains are diverse and R4 strains form a monophyletic clade.

To trace the evolutionary history of Foc strains, we conducted a comprehensive population genomics study using Foc strains that were collected from banana production locations around the world and represent all three races in the 23 Foc VCG groups (Fig. 1b). The 35 selected Foc genomes comprise 5 TR4, 12 STR4, 2 VCG 0121 and 16 R1 and R2 strains. With the genetic hallmarks of a heterothallic sexual life cycle, a Foc genome has either a MAT1-1 or MAT1-2 gene at the mating locus. Strains within the same VCG shared the same mating-type idiomorph, and MAT1-1 and MAT1-2 were present in all three Foc races (Supplementary Table 1). Pathogenicity tests confirmed that R1 showed limited symptoms in Cavendish bananas, STR4 strains caused mild disease symptoms, and TR4 and VCG 0121 strains induced more severe disease symptoms than the other strains (disease index [DI]: R1 = 0.15; STR4 = 0.2; VCG 0121 = 3.15; TR4 = 3.2) (Fig. 1c and Supplementary Table 2).

We identified 2,021,590 SNPs, accounting for ~4% of the genome, across the 35 Foc isolates when compared to the high-quality reference genome Foc TR4 II5 (NRRL 54006) (https://mycocosm.jgi.doe.gov/FoxII5/FoxII5.home.html). Principal component analysis (PCA) revealed a well-defined structure containing three distinct populations, with all R4 strains—TR4, STR4 and VCG 0121—grouping into one population and strains from R1 and R2 grouping into two populations (Fig. 2a). This structure was independently inferred using STRUCTURE software (Fig. 2b), with Pop1 containing only R4 strains, Pop2 containing six R1 VCGs (VCGs 0123, 01214, 01217, 01218, 01221 and 01224) and Pop3 containing six VCGs from both R1 and R2 (VCGs 0124, 0125, 0128, 01220, 01212 and 01222). Foc diversity was further assessed within the FOSC using 10 conserved single-copy orthologs¹⁰. In agreement with the population genomics results, all Foc strains formed three major clades (Fig. 2c). Pop2 and Pop3 were closely related to strains from other hosts, while all R4 strains of Pop1 formed a monophyletic clade, suggesting that Foc R4 has an independent origin compared to other strains in the FOSC (Fig. 2c).

2. The TR4 reference genome lacks accessory chromosomes.

TheTR4 II5 (NRRL 54006) genome was assembled into 11 core chromosomes. Distinct from other reported plant pathogenic F. oxysporum genomes, which all contain independent ACs^11,26, the II5 genome lacked ACs, but carried a total of 4.84-Mb accessory sequences, primarily located at the ends of chromosome 3 (1.19 Mb) and chromosome 11 (0.97 Mb) (Supplementary Table 3, Fig. 3). This chromosome 3 architecture was preserved among five sequenced Foc TR4 genomes with the exception of the genome of strain UK0001 (Extended Data Fig. 1a)²¹, where we detected a recent chromosomal translocation between chromosomes 3 and 11 facilitated by an active transposable element, Helitron²⁷ (Extended Data Fig. 1a) (Supplementary Table 4).

To trace the evolutionary footprints among Foc strains, we generated high-quality genome assemblies for STR4 (CAV 045), R1 (GD02) and VCG 0121 (CAV 2318) (Table 1), all of which have 11 core chromosomes (Extended Data Fig. 1). Using Benchmarking Universal Single-Copy Orthologs (BUSCO v3.1), we detected 99.3–99.6% of conserved fungal genes in these assemblies and confirmed their completeness (Table 1). Consistent with their phylogenetic relatedness (Fig. 2) and similarity in disease severity (Fig. 1c), the VCG 0121 genome had more II5 accessory sequences (3.36 Mb, 69.4%) than the STR4 (2.16 Mb, 44.6%) and R1 (1.58 Mb, 32.6%) genomes (Supplementary Table 5). The genomes of VCG 0121 and II5 also shared the chromosome 3 architecture, including the almost identical extended accessory sequences with 99.8% sequence identity covering 67% of the 1.1-Mb region (Extended Data Fig. 1c). However, VCG 0121 strains carried the MAT 1-2 idiomorph, whereas the TR4 strains all carried the mating-type locus MAT 1-1 (Supplementary Table 1). These observations suggest that VCG 0121 and the TR4 01213/16 VCG complex may represent progenies of a mating population in which one of the parental strains already carried the chromosome 3 architecture. The distribution of SNPs in VCG 0121 also suggests that a potential mitotic recombination event occurred before the split of the VCGs 01213/16 and 0121 (Extended Data Fig. 2). Collectively, our data indicate that sexual reproduction may have occurred right before the recent TR4 clonal expansion.

3. Nitric oxide (NO) is produced in Foc TR4 mitochondria soon after infection.

To better understand Foc–banana interactions, we compared meta-transcriptomics of Cavendish bananas infected with R1 (GD02) and TR4 (II5). Three infection time points were chosen, i.e., 18, 32, and 56 hours post-inoculation (HPI), representing the three critical biological states of the pathogen penetrating through, spreading within and becoming dominant in the host tissues (Extended Data Fig. 3a) (Supplementary Table 6). The read mapping matrix revealed a steady increase of fungal biomass over time: from 2.04 to 5.84 to 31.10% for R1-infected banana and from 11.82 to 34.68 to 56.85% in TR4-infected banana (Extended Data Fig. 3b), reflecting the increased aggressiveness of the TR4 pathogen (Extended Data Fig. 3b and Supplementary Table 6). The data also suggested that Cavendish bananas are not completely immune to R1.

Using a global hierarchical clustering algorithm, we identified 18 Foc co-expressed gene clusters among 12,235 genes that were expressed in both R1 and TR4 strains (Extended Data Fig. 4). The Pearson’s correlation coefficients (PCCs) comparing banana infected with either R1 or TR4 increased over time, with values of 0.74, 0.83 and 0.9 at 18, 32 and 56 HPI, respectively (Extended Data Fig. 3c), suggesting that the most distinct transcriptional reprogramming occurred at 18 HPI. Focusing on genes that were activated at this time point, we identified three fungal gene clusters, Foc-C5, Foc-C7 and Foc-C14, comprising 2,050 genes, that were significantly induced at 18 HPI in TR4 compared to R1 (Extended Data Fig. 5a). Among these genes, those encoding mitochondrial envelope–localized proteins were significantly enriched (corrected p-value = 0.0005). Specifically, Foc-C5 was enriched for electron transfer activity (corrected p-value = 0.01), Foc-C7 for heme-copper terminal oxidase activity (corrected p-value = 0.03) and Foc-C14 for NADPH quinone reductase activity and regulation of the nitrogen compound metabolic process (corrected p-value = 0.05) (Extended Data Fig. 5b).

All genes functioning in the mitochondria-localized nitrate/nitrite-dependent pathway for fungal NO biosynthesis²⁸ were expressed at significantly higher levels in TR4 strains than in R1 strains (Fig. 4). For example, Gene_2699 (NAD(+)-dependent formate dehydrogenase) and Gene_9725 (nitrite reductase) showed 40-fold and 6-fold higher expression in TR4 compared to R1 at 18 HPI, respectively (Supplementary Table 7). Similarly, the NO detoxification–related genes, which encode proteins such as flavohaemoglobin, cytochrome P450 and GSNO reductases that help pathogens protect themselves against nitrosative stress, were also uniquely induced in TR4-infected banana plants (Fig. 4, Supplementary Table 7).

The involvement of a potential NO burst was also supported by the significantly up-regulated banana phytoglobin genes, which are regulated by NO level and serve as active scavengers of NO. One of them, Ma02_g10610, was detected among top 20 most significantly induced genes upon TR4 inoculation (Supplementary Table 8). qRT-PCR analysis confirmed that all three banana phytoglobin homologs were highly induced at 18 HPI upon TR4 inoculation (Supplementary Table 8, Extended Data Fig. 6). These up-regulated phytoglobin genes belong to banana transcriptional expression cluster plant-C22, which contains 1,022 genes with similar expression patterns (Supplementary Table 9, Extended Data Fig. 7). Interestingly, plant-C22 also included two jasmonic acid (JA) biosynthesis-related genes, OPR2 (Ma03_g02640) and OPR3 (Ma07_g02270) (Supplemental Table 10), encoding the 12-oxo-phytodienoic acid reductases (OPRs).

JA is a primary defense hormone and is involved in F. oxysporum–tomato²⁹ and F. oxysporum–Arabidopsis^30,31 interactions. Based on our transcriptomic analysis, we hypothesized that the NO burst in fungi during the TR4–banana interaction, which disarms plant immunity, was induced by the initial plant defense response involving plant JA biosynthesis. To test this hypothesis, we compared in vivo NO production betweenTR4 and R1 using the NO-sensitive fluorescent probe DAR-4M-AM³² upon JA stimulation (Fig. 5). With a sensitivity level of 0.1 mM nitroprusside³³, we detected comparable levels of NO signal in both strains. However, we observed a significant fluorescent signal burst only in TR4 in response to JA signaling, as the average cytoplasmic fluorescence intensity in MJ-treated TR4 was about 4.5 times higher than that of non-treated cells and 4.2 times higher than that of R1 cells treated with MJ. All evidence points to the direct involvement of fungal NO in TR4 pathogenesis.

4. TR4 accessory genes contribute to mitochondrial activities and host pathogenicity.

To examine genetic components that contribute to TR4 virulence against Cavendish banana plants, we identified 1,587 TR4 encoding accessory genes. Interestingly, these genes are significantly enriched for mitochondrial functions (p < 0.05), including NADH dehydrogenase (ubiquinone) (p-value = 0.00003), electron transfer (p-value = 0.019) and biological processes involved in ATP synthesis (p-value = 0.007) (Supplementary Table 11). More than half of the TR4 accessory genes (856), also enriched for mitochondrial functions, were expressed during fungal infection (Supplementary Table 12). For instance, 38 expressed II5 accessory genes were significantly enriched for electron transport (p-value = 0.05) and 6 were targeted to mitochondria (Supplementary Table 13), including two as parts of the fungal NO biosynthesis pathway. The overlap between accessory genes and induced gene functions supports the notion that TR4 accessory genes contribute directly to the pathogen’s ability to impose nitrosative stress to disarm host defense.

Transcriptional regulation was another significantly enriched functionality among expressed accessory genes (p-value = 0.0098), including transcription factor (TF) genes encoding the GAL4-like Zn(II)2Cys6 binuclear cluster DNA-binding domain (Supplementary Table 12). In the II5 genome, this TF family was expanded to 630 members, which is substantially more than those identified in Saccharomyces cerevisiae (37), Neurospora crassa (114), Magnaporthe oryzae (143), Aspergillus nidulans (257) and Fusarium graminearum (263). Among the expanded TF gene family, 26 accessory genes, along with the core Gene_7374, were grouped with FgZC1 (FGSG_05068) (Extended Data Fig. 8), a transcription factor encoding gene required for host-mediated fungal NO production and virulence in F. graminearum³⁴. At 18 HPI, the expression of Gene_7374 was 3-fold higher in TR4 compared to its orthologous gene in R1. Three expression patterns were identified among these 26 accessory genes: 7, 11 and 8 genes were induced at 18, 32 and 56 HPI, respectively (Supplementary Table 14). In addition, this TF gene family included many genes encoding transcription regulators, such as FoFow2, which controls the plant infection capacity of F. oxysporum³⁵; FoEbr1, which regulates genes involved in general metabolism and virulence³⁶; and FoFtf 1, which regulates virulence and the expression of SIX effectors³⁷.

In addition to confirming that the acquisition of accessory genes may have enabled TR4 to produce a NO burst upon encountering the host, we identified 61 small secreted fungal effectors among the proteins encoded by the expressed TR4 accessory genes (Supplementary Table 15). These effectors included seven that were secreted in xylem and encoded by SIX genes³⁸, including three SIX1 genes, one SIX4 gene, one SIX8 gene and two SIX9 genes. Six out of seven SIX genes were in the accessory regions of chromosome 3 (Supplementary Table 15).

We conducted functional characterization of SIX1 and SIX4 due to the unique expansion of SIX1 in TR4 and the unique expression pattern of SIX4 upon infecting the host banana. Even though SIX4was present in most Foc genomes, its expression was only detected in TR4 (Supplementary Table 15). In contrast to the other SIX genes that were highly expressed at 56 HPI, SIX4 was the only one that was highly expressed at 18 HPI (Supplementary Table 15). SIX1a and SIX4 gene knockout mutants (Dsix1a and Dsix4) exhibited significantly reduced virulence in banana (p < 0.01) (Extended Data Fig. 9), further demonstrating that the accessory sequence regions of Foc TR4 are involved in fungal virulence in Cavendish banana.

Combining population genomics and phylogenetics techniques, this study inspected 35 Foc genomes representing 23 Foc VCG groups and all three Foc races within the FOSCframework and revealed a defined population structure. Whereas historic R1 and R2 strains are phylogenetically related to other F. oxysporum formae speciales, all Foc R4 strains—TR4, STR4 and VCG 0121—form a distinct population or phylogenetic clade, supporting the idea that R4 strains share an evolutionary origin¹⁷.

We carefully inspected the genome assemblies of severalR4 strains and observed that the genomes of TR4 strain II5 and VCG 0121, which respectively carry the mating-type loci MAT1-1 and MAT1-2,share an almost identical chromosomal structure that lacks independent ACs but harbors accessory sequences at the ends of several core chromosomes (Fig. 3, and supplementary Fig. 1). The lack of ACs among these Foc genomes was not expected, as ACs were reported in almost all other genomes within FOSC^11,39-41, including a human pathogenic F. oxysporum genome²⁶. Classifying VCG 0121 strains as either TR4 or STR4 has been debated. The observation that TR4 strains and VCG 0121 are phylogenetically closely related, causing equally severe disease symptoms in Cavendish bananas, and share this unique chromosome architecture suggests that these strains are potentially offspring of the same mating population, which arose before the recent clonal expansion of TR4 strains, consistent with a recent report¹⁸.

Lacking distinct ACs, the TR4 genome has its accessory sequences attached to some core chromosomes, as observed among many F. oxysporum genomes even with distinct ACs. These sequences share the same properties as distinct ACs, including a higher content of repetitive sequences and lower gene density, and are overrepresented in genes with pathogenesis-related functions. We identified numerous genes encoding SIX effectors, the hallmark virulence factor responsible for many Fusarium wilt diseases^10,12,14,38, and demonstrated for the first time the contribution of SIX4 to Foc virulence using targeted mutagenesis. TR4 accessory genes, especially those expressed during infection of Cavendish bananas, are significantly enriched for genes with known mitochondrial functions. TR4 genes that encode proteins responsible for the mitochondria-localized pathway for fungal NO biosynthesis, as well as fungal NO detoxification functions, are uniquely induced when TR4 enters the banana host, compared to the interactions with R1.

An important signaling molecule, NO homeostasis influences many molecular and physiological processes, including growth development, abiotic and biotic stress response, and signal transduction^42,43. Fungi NO is a key signaling molecule involved in fungal-plant interactions^34,44-46 and has been reported in F. graminearum to signal host invasion³⁴ and in M. oryzae⁴⁴ and Botrytis cinerea^46,47 to impose massive nitrosative stress to facilitate disease development. In this study, through a comparative transcriptomics analysis of TR4 (II5) and race 1 (GD02) strains inoculated onto Cavendish bananas, we revealed for the first time that NO is involved in TR4 invasion of banana. Empirically, we confirmed the unique NO induction in TR4 upon JA stimulation. Notably, SIX4 in Fo5176 induces the Arabidopsis JA biosynthesis pathway⁴⁸ and is highly induced at the early phase of interaction, indicating that this plant hormone is involved in the TR4–banana interaction.

As TR4 accessory genes are significantly enriched for mitochondrial functions, we hypothesize that the acquisition of these genes allowed TR4 to enhance the nitrosative pressure within the infected banana. We propose the following mode of action behind the TR4–Cavendish banana interaction (Fig. 6). The recognition of fungal signal activates plant defense involving the JA signaling pathway. The JA signal in turn stimulates fungal NO production only on TR4 attributed to the acquisition of TR4-unique accessory genes. With the accompanying up-regulation of NO detoxification genes and increase in fungal detoxification capacity, TR4 creates a NO burst that enhances nitrosative stress within banana roots. The ability to produce a NO burst that both disarms the host defense and protects the fungus from the toxic environment is accomplished through the expansion of TR4-specific accessory genes, including the expansion of transcription factor genes homologous to FgZC1, which are known to be involved in fungal NO production and virulence³⁴.

Collectively, this study provides insight into the biology of the devastating pathogen TR4 based on a phylogenetic and evolutionary framework.Since first reported in 1989, Fusariumwilt of banana caused by TR4 has continued to spread around the world and now threatens global banana production. Due to its persistence in the soil, one primary strategy is quarantine-based prevention and containment. To avoid future shortages of bananas, scientists around the world must collaborate with farmers and industry partners to establish a sustainable solution. Our initial search for a sustainable solution revealed that the accessory genes carried by the fungal pathogens are not only responsible for producing effector proteins, but also for the elevated NO production within host cells that potentially breaks down host defense. These mechanistic discoveries offer new research directions, such as designing effective NO scavengers for controlling this devastating disease.

Isolate collection, DNA isolation and genome sequencing

Isolates used in this study were provided by Altus Viljoen (Stellenbosch University, South Africa), Randy C. Ploetz (University of Florida, USA) and Chunyu Li (Fruit Tree Research Institute, GDAAS, China). DNA was isolated from freeze-dried mycelium ground in liquid nitrogen as starting material and extracted via three rounds of phenol–chloroform precipitation and treatment with RNase A and proteinase K. Single-molecule real-time (SMRT) sequencing was performed for Foc II5, GD02 and CAV045 at the Beijing Genomics Institute (BGI, Shenzhen, China). PacBio libraries were prepared with the SMRTbell template preparation kit (Pacific Biosciences, Menlo Park, CA, U.S.A.) and size-selected at ~20 kb using BluePippin (Sage Science, Beverly, MA, U.S.A.). Sequencing of these libraries generated 5,487 Mb (II5), 7,774 Mb (CAV045) and 11,354 Mb (GD02) filtered data. Additionally, DNA libraries with 500-bp inserts were subsequently constructed for genomic DNA of all 35 isolates. These DNA libraries were 100-bp paired-end sequenced using the Illumina HiSeq 2500 at ~100X coverage, resulting in 5.2–6.7 Gb of sequence data per isolate.

Genome assembly, gene prediction, annotation and repetitive regions

Genome assembly for Pacbio data was performed using Canu v1.8 ⁴⁹. Data from the Illumina libraries were first trimmed by removing bases with a quality score below 20 at both ends and discarding trimmed reads with lengths less than 70 bp. All sequences in the initial assembly were fed into Quiver along with trimmed Illumina sequences to polish the genome assembly ⁵⁰. De novo sequence assembly for isolates with Illumina sequences was conducted using ABySS assembler ⁵¹. The quality of assembly was evaluated with GRIDSS ⁵² and Sniffles ⁵³. All genomic structural variations were checked and corrected manually. Finally, the completion of all assemblies was confirmed using a BUSCO test employing a fungi database (odb9 version) ⁵⁴.

The repetitive sequences in the assembled genomes were identified using RepeatModeler v1.0.7 ⁵⁵ for de novo repeats and RepeatMasker v4.0.5 (http://www.repeatmasker.org) for annotations. The output from RepeatModeler was combined with known repeats in F. oxysporum 4287 to create the repeat database input for RepeatMasker. Protein-coding genes on the repeat-masked II5 genome assembly were predicted at JGI. Subsequently, the predicted II5 protein-coding genes were used as a training dataset in AUGUSTUS ⁵⁶ to generate the gene predictions for the rest of the Foc genomes. Functional annotation (including Pfam and GO terms) for the predicted protein-coding genes was performed by InterProScan, following a standard annotation workflow ⁵⁷. Potential secreted proteins in the II5 genome were predicted using signalP 5.0 with default parameters ⁵⁸. The proteins containing secretory pathway signal peptides were kept. The transmembrane proteins were predicted with TMHMM 2.0 ⁵⁹ and excluded from the secreted proteins. Putative effectors in II5 LS regions were predicted based on the protein size (≤400 amino acid) and the number of cysteine residues (≥4) among the secreted proteins. To find overrepresented GO terms on accessory sequences versus the whole genome, Fisher’s exact test with FDR < 0.05 was performed.

Read mapping, SNP calling and identification of MAT1 locus

Trimmed Illumina reads were mapped to the reference genome (Foc II5) with Bowtie2 v2.4.2 ⁶⁰. File format conversion was done in the SAMtools v0.1.19 ⁶¹. Genome Analysis Toolkit (GATK v3.5) was used for SNP calling following the GATK best practice guidelines ⁶². Furthermore, we used vcftools (https://vcftools.github.io) to generate a SNP dataset for phylogenomic analyses. The mating-type locus (MAT1-1 or MAT1-2) was determined for each Foc strain by BLASTN (E < 10^-⁵⁰) using the F. graminearum mating-related genes as queries.

Phylogenetic analysis and population structure

To determine the phylogenetic framework within the Foc forma specialis, nucleotide sequences of 10 conserved single-copy orthologous genes within the Fusarium genus were selected and pairwise aligned using ClustalW. After manual removal of regions with poor sequence quality in any isolate, the alignments were concatenated into a single supermatrix. The supermatrix was used as input in MEGA (v10.2.6) to generate a maximum likelihood phylogenetic tree using the general time reversible model with bootstrap test of 500 replicates.

To assess population structure among Foc samples, we performed PCA and model-based clustering. PCA was conducted in SNPRelate. The eigenvector and eigenvalues were imported into R for plotting. The model-based clustering program STRUCTURE v2.3.4 was used to analyze population structure of all Foc isolates with whole-genome SNPs using the admixture model for 10,000 replications as burn-in ⁶³. Structure was run for K values between 1 and 7, and no prior population information was used in the model. The best K value was selected by the Evanno method in STRUCTURE HARVESTER.

RNA preparation, sequencing and analysis

Tissue cultures derived from Cavendish cv ‘Brazilian’ banana plantlets with four or five leaves (approximately 30 cm in height) were transplanted into Hoagland solution ⁶⁴ and kept in a greenhouse at 25–32°C with a 16-h-light/8-h-dark photoperiod. The wild-type Foc TR4 II5 and Foc race 1 GD02 were used to inoculate the ‘Brazilian’ bananas at a concentration of 1 × 10⁷ conidia/ml. Three time points (18 HPI for the adsorption stage, 32 HPI for the biotrophic stage and 56 HPI for the necrotrophic stage) were determined by observing the infection process after inoculating banana roots of ‘Brazilian’ with a GFP-tagged Foc TR4 II5 transformant, which shares the same growth characteristics and virulence as the wild-type Foc TR4 II5. Roots from Foc TR4– and race 1–infected plants at 18, 32 and 56 HPI were harvested for total RNA extraction, with three biological replicates per time point. RNA quality and integrity of each library were confirmed with a minimum RNA integrity number (RIN) value of 7. RNA sequencing was done using an Illumina HiSeq 2000 sequencer to generate ~29 million paired-end reads per library with 100-bp read length.

Paired-end RNA-seq reads were assessed for quality by FastQC v0.10.1. We used Trimmomatic ⁶⁵ to remove poor-quality bases and low-quality reads as well as sequencing adaptors. Leading and trailing read bases with a quality below 20, and a trimmed read length shorter than 70, were removed with parameters LEADING:20, TRAILING:20 and MINLEN:70. The trimmed RNA-seq data were analyzed using STAR ⁶⁶, HTSeq ⁶⁷ and DESeq2 ⁶⁸ pipelines. In short, reads were mapped to reference genomes of M. acuminata (DH-Pahang, AA), Foc TR4 II5 and Foc race 1 GD02 using STAR v2.7.10a. Mapped reads were quantified in HTSeq v0.11.1. Fragments per kilobase of exon per million mapped reads (FPKM) and differential gene expression analysis were conducted using DESeq2 version 1.27.32 with a maximum FDR of 0.05. Genes with per-condition averaged FPKM ≥ 1 were kept in the downstream analysis, and those with an at least 2-fold change in expression were considered differentially expressed between conditions. Corrplot version 0.84 was used to visualize the correlation in gene expression profiles of Foc TR4– and race 1–infected plants across the different timepoints at 18, 32 and 56 HPI. The per-condition averaged FPKM values were log-transformed as log₂(FPKM + 1). Clustering analysis on scaled log-transformed and z-scaled expression values was performed using K-means clustering algorithm "Hartigan-Wong" (R function K-means) and then visualized by ggplot2/3.3.0. This analysis yielded 18 and 24 co-expression gene clusters for fungi and banana, respectively. Gene features with expression correlation with centroids higher than 0.8 were finally accepted by the clusters.

Gene knockout and complementary mutants

The gene-deletion mutants were generated using the standard one-step gene replacement strategy ⁶⁹. First, the ~1.0 kb of the upstream and downstream sequences flanking the targeted effector genes were PCR amplified, and 3′-terminal (TTGACCTCCACTAGCTCCAGCCAAGCC) and 5′-terminal portion sequences (CAAAGGAATAGAGTAGATGCCGACCG) of the hygromycin resistance cassette were added into the primers of 2R and 3F, respectively, as adapters. Then ∼1.8- and ∼1.9-kb fragments containing the upstream or downstream flanking sequences and the 3′ or 5′ terminus of the hygromycin resistance cassette were amplified by overlap PCR. The above two fragments overlapping by 316 bp were co-transformed into protoplasts of Foc TR4 strain II5 (VCG 01213). The complement fragments, which contained the entire effector genes and their native promoter regions, were amplified by PCR and inserted into the modified pFY11 (neomycin resistance) to complement the mutant strains.

Pathogenicity assays

The pathogenicity assays were performed using a plant inoculation method described by Li et al. (2011). In short, banana plantlets with four or five leaves were individually potted in sterile medium that consisted of three parts vermiculite, one part peat and 0.5 parts coconut coir. Fungal conidia of Foc TR4 (VCG 01213), STR4 (VCG 0120), VCG 0120, race 1 (VCG0123) and TR4 II5 mutants were isolated from 3-day-old cultures by filtering through miracloth. Spores were collected, resuspended in sterile water and counted. Twenty plantlets per treatment were inoculated with concentrations of 5,000 conidia/g soil and kept at 25–32°C with a 16-h-light/8-h-dark photoperiod in the greenhouse. The following banana cultivars were used: ‘Zhongjiao No.3’ (Cavendish AAA), ‘Guangfen No.1’ (Pisang Awak ABB) and ‘Fenza’ (Pisang Awak ABB). The disease was scored using a DI from 0–4 (0, no symptoms; 1, some brown spots in the inner rhizome; 2, <25% of the inner rhizome shows browning; 3, up to 75% of the inner rhizome shows browning; and 4, entire inner rhizome and pseudostem are dark brown, dead). Disease index (DI) was calculated using the following equation: DI = [(N_1-5 × S_1-5)/(N × S)] × 100%. In this equation, N_1-5 indicates the number of banana plants with wilt symptoms, S_1-5 is the value of the score of symptoms, N is the total number of tested banana plants and S is the highest score of symptoms (Cachinero et al., 2002). If the value of DI was 0%, the pathogen lost its virulence completely; if the value was 1–25%, the pathogen had a weak virulence; if the value was 26–50%, the pathogen had moderate virulence; if the value was 51–75%, the pathogen had strong virulence; and if the value was 76–100%, the pathogen was highly virulent.

Fluorescence assay and confocal microscopy

To assess NO production, in vivo fluorescence assays were performed using the NO-sensitive fluorescent dye DAR-4M-AM (cell permeable) as probe. Conidia of each strain were harvested from 3-day cultures, washed by collected as described earlier and resuspended in DI water three times. DAR-4M-AM stock (1 mM) in dimethyl sulfoxide (DMSO) was diluted to 2 µM DAR-4M-AM in 10 mM HEPES (pH 7) on ice. Conidia suspensions were dark-incubated with 2 µM DAR-4M-AM dye for 2 hours at 28°C to allow dye loading, washed twice and resuspended to a spore concentration of 2.5 × 10⁵ spores/ml. The resulting conidia were treated with or without 5 µM MJ for 12 hours at 28°C and visualized in a bright/fluorescence field of view under a confocal microscope at the excitation/emission wavelengths of 544/590 nm. Each experiment contained a minimum of three biological replicates and was repeated independently at least three times. The fluorescence intensity of images was calculated with ImageJ software. Five randomly selected fluorescent areas of each of four images for each treatment were analyzed.

Acknowledgements

The authors would like to thank Dr. James Chambers, the director of Microscopy core facility of the Institution for Applied Life Sciences at University of Massachusetts, for his helps with the confocal microscopy experiments. Data were analyzed at the Massachusetts Green High Performance Computing Center (MGHPCC). This project was supported by the Natural Science Foundation of (IOS-165241), the National Research Initiative Competitive Grants Program Grant no. 2008-35604-18800 and MASR-2009-04374, MAS00532 and MAS00496 from the USDA National Institute of Food and Agriculture; as well as by Guangdong Science and Technology Project (2019B1515120088), the Laboratory of Lingnan Modern Agriculture Project (NT2021004), Guangdong Provincial Special Fund for Modern Agriculture Industry Technology Innovation Teams (No. 2022KJ109), and National Banana Industry and Technology System Project (nycytx-33) and the earmarked fund for CARS (CARS-31). The work (proposal:10.46936/10.25585/60008191) conducted by the U.S. Department of Energy Joint Genome Institute (https://ror.org/04xm1d337), a DOE Office of Science User Facility, is supported by the Office of Science of the U.S. Department of Energy operated under Contract No. DE-AC02-05CH11231. L.-J.M. is also supported by an Investigator Award in Infectious Diseases and Pathogenesis by the Burroughs Wellcome Fund BWF-1014893, and the National Eye Instituteof the National Institutes of Health under award number: R01EY030150. HLY is also supported by Lotta M. Crabtree Fellowship. The funding bodies played no role in the design of the study and collection, analysis, and interpretation of the data and in writing of the manuscript.

Author contributions

L.-J.M. and C.Y.L. designed this study. Y.Z. and L.-J.M. wrote the manuscript with input from all authors. Y.Z., H.L.Y., S.H. and I.V.G analyzed the data. Y.Z., S.W.L, K.W. and M.H.L validated the experiments. D.M., R.P. and A.V. collected and provided the strains.

StokstadJul, E. Devastating banana disease may have reached Latin America, could drive up global prices. (2019).
Stover, R.H. Fusarial wilt (Panama disease) of bananas and other Musa species. Fusarial wilt (Panama disease) of bananas and other Musa species. (1962).
Buddenhagen, I. Understanding strain diversity in Fusarium oxysporum f. sp. cubense and history of introduction of'Tropical Race 4'to better manage banana production. in III International Symposium on Banana: ISHS-ProMusa Symposium on Recent Advances in Banana Crop Protection for Sustainable 828 193–204 (2007).
Viljoen, A., Ma, L.-J. & Molina, A.B. Fusarium wilt (Panama disease) and monoculture banana production: Resurgence of a century-old disease. Emerging Plant Diseases and Global Food Security; Ristaino, JB, Records, A., Eds, 159–184 (2020).
Maymon, M. et al. First report of Fusarium oxysporum f. sp. cubense tropical race 4 causing Fusarium wilt of Cavendish bananas in Israel. Plant Disease 102, 2655 (2018).
García-Bastidas, F. et al. First report of Fusarium wilt Tropical Race 4 in Cavendish bananas caused by Fusarium odoratissimum in Colombia. Plant disease 104, 994–994 (2020).
Acuña, R. et al. First report of Fusarium oxysporum f. sp. cubense Tropical Race 4, causing Fusarium wilt in Cavendish bananas in Peru. Plant Disease (2021).
Ma, L.-J. et al. Fusarium pathogenomics. Annual review of microbiology 67, 399–416 (2013).
Dean, R. et al. The Top 10 fungal pathogens in molecular plant pathology. Molecular plant pathology 13, 414–430 (2012).
Zhang, Y. & Ma, L.J. Deciphering Pathogenicity of Fusarium oxysporum From a Phylogenomics Perspective. Adv Genet 100, 179–209 (2017).
Ma, L.-J. et al. Comparative genomics reveals mobile pathogenicity chromosomes in Fusarium. Nature 464, 367–373 (2010).
Yang, H., Yu, H. & Ma, L.-J. Accessory chromosomes in Fusarium oxysporum. Phytopathology 110, 1488–1496 (2020).
Does, H. & Rep, M. Horizontal transfer of supernumerary chromosomes in fungi. in Plant Fungal Pathogens 427–437 (Springer, 2012).
van Dam, P. et al. Effector profiles distinguish formae speciales of Fusarium oxysporum. Environmental Microbiology 18, 4087–4102 (2016).
Bentley, S., Pegg, K., Moore, N., Davis, R. & Buddenhagen, I. Genetic variation among vegetative compatibility groups of Fusarium oxysporum f. sp. cubense analyzed by DNA fingerprinting. Phytopathology 88, 1283–1293 (1998).
Katan, T. & Primo, P.D. Current status of vegetative compatibility groups inFusarium oxysporum: Supplement (1999). Phytoparasitica 27, 273–277 (1999).
Moore, N., Pegg, K., Allen, R. & Irwin, J. Vegetative compatibility and distribution of Fusarium oxysporum f. sp. cubense in Australia. Australian Journal of Experimental Agriculture 33, 797–802 (1993).
Fourie, G., Steenkamp, E., Gordon, T. & Viljoen, A. Evolutionary relationships among the Fusarium oxysporum f. sp. cubense vegetative compatibility groups. Applied and environmental microbiology 75, 4770–4781 (2009).
Ploetz, R.C. Fusarium wilt of banana is caused by several pathogens referred to as Fusarium oxysporum f. sp. cubense. Phytopathology 96, 653–656 (2006).
Ploetz, R.C. Management of Fusarium wilt of banana: A review with special reference to tropical race 4. Crop Protection 73, 7–15 (2015).
Warmington, R.J. et al. High-quality draft genome sequence of the causal agent of the current Panama disease epidemic. Microbiology Resource Announcements 8, e00904-19 (2019).
Yun, Y. et al. Genome data of Fusarium oxysporum f. sp. cubense race 1 and tropical race 4 isolates using long-read sequencing. Molecular Plant-Microbe Interactions 32, 1270–1272 (2019).
Leiva, A.M. et al. Draft Genome Sequence of Fusarium oxysporum f. sp. cubense Tropical Race 4 from Peru, Obtained by Nanopore and Illumina Hybrid Assembly. Microbiology Resource Announcements, e00347-22 (2022).
Maymon, M., Sela, N., Shpatz, U., Galpaz, N. & Freeman, S. The origin and current situation of Fusarium oxysporum f. sp. cubense tropical race 4 in Israel and the Middle East. Scientific reports 10, 1–11 (2020).
Zheng, S.-J. et al. New geographical insights of the latest expansion of Fusarium oxysporum f. sp. cubense tropical race 4 into the greater Mekong subregion. Frontiers in Plant Science 9, 457 (2018).
Zhang, Y. et al. The genome of opportunistic fungal pathogen Fusarium oxysporum carries a unique set of lineage-specific chromosomes. Communications biology 3, 1–12 (2020).
Chellapan, B.V., van Dam, P., Rep, M., Cornelissen, B.J. & Fokkens, L. Non-canonical Helitrons in Fusarium oxysporum. Mobile DNA 7, 1–16 (2016).
Marcos, A.T. et al. Nitric oxide synthesis by nitrate reductase is regulated during development in A spergillus. Molecular Microbiology 99, 15–33 (2016).
Brodhun, F. et al. An iron 13 S-lipoxygenase with an α-linolenic acid specific hydroperoxidase activity from Fusarium oxysporum. PloS one 8, e64919 (2013).
Thatcher, L.F., Manners, J.M. & Kazan, K. Fusarium oxysporum hijacks COI1-mediated jasmonate signaling to promote disease development in Arabidopsis. The Plant Journal 58, 927–939 (2009).
Guo, L. et al. Metatranscriptomic comparison of endophytic and pathogenic Fusarium–Arabidopsis interactions reveals plant transcriptional plasticity. Molecular Plant-Microbe Interactions 34, 1071–1083 (2021).
Kojima, H. et al. Bioimaging of nitric oxide with fluorescent indicators based on the rhodamine chromophore. Analytical chemistry 73, 1967–1973 (2001).
Lacza, Z. et al. The novel red-fluorescent probe DAR-4M measures reactive nitrogen species rather than NO. Journal of pharmacological and toxicological methods 52, 335–340 (2005).
Ding, Y., Gardiner, D.M., Xiao, D. & Kazan, K. Regulators of nitric oxide signaling triggered by host perception in a plant pathogen. Proceedings of the National Academy of Sciences 117, 11147–11157 (2020).
Imazaki, I., Kurahashi, M., Iida, Y. & Tsuge, T. Fow2, a Zn (II) 2Cys6-type transcription regulator, controls plant infection of the vascular wilt fungus Fusarium oxysporum. Molecular microbiology 63, 737–753 (2007).
Jonkers, W. et al. EBR1 genomic expansion and its role in virulence of F usarium species. Environmental microbiology 16, 1982–2003 (2014).
Niño-Sánchez, J. et al. The FTF gene family regulates virulence and expression of SIX effectors in Fusarium oxysporum. Molecular plant pathology 17, 1124–1139 (2016).
Rep, M. et al. A tomato xylem sap protein represents a new family of small cysteine-rich proteins with structural similarity to lipid transfer proteins. FEBS letters 534, 82–86 (2003).
van Dam, P. et al. A mobile pathogenicity chromosome in Fusarium oxysporum for infection of multiple cucurbit species. Scientific reports 7, 1–15 (2017).
Taylor, A. et al. Identification of pathogenicity-related genes in Fusarium oxysporum f. sp. cepae. Molecular Plant Pathology 17, 1032–1047 (2016).
Williams, A.H. et al. Comparative genomics and prediction of conditionally dispensable sequences in legume–infecting Fusarium oxysporum formae speciales facilitates identification of candidate effectors. BMC genomics 17, 1–24 (2016).
Arasimowicz-Jelonek, M. & Floryszak‐Wieczorek, J. Nitric oxide: an effective weapon of the plant or the pathogen? Molecular Plant Pathology 15, 406–416 (2014).
Simontacchi, M., Galatro, A., Ramos-Artuso, F. & Santa-María, G.E. Plant survival in a changing environment: the role of nitric oxide in plant responses to abiotic stress. Frontiers in plant science 6, 977 (2015).
Samalova, M. et al. Nitric oxide generated by the rice blast fungus Magnaporthe oryzae drives plant infection. New Phytologist 197, 207–222 (2013).
Sarkar, T.S., Biswas, P., Ghosh, S.K. & Ghosh, S. Nitric oxide production by necrotrophic pathogen Macrophomina phaseolina and the host plant in charcoal rot disease of jute: complexity of the interplay between necrotroph–host plant interactions. PLoS One 9, e107348 (2014).
TURRION-GOMEZ, J.L. & Benito, E.P. Flux of nitric oxide between the necrotrophic pathogen Botrytis cinerea and the host plant. Molecular Plant Pathology 12, 606–616 (2011).
Floryszak-Wieczorek, J., Arasimowicz, M., Milczarek, G., Jelen, H. & Jackowiak, H. Only an early nitric oxide burst and the following wave of secondary nitric oxide generation enhanced effective defence responses of pelargonium to a necrotrophic pathogen. New Phytologist 175, 718–730 (2007).
Thatcher, L.F., Gardiner, D.M., Kazan, K. & Manners, J.M. A highly conserved effector in Fusarium oxysporum is required for full virulence on Arabidopsis. Molecular Plant-Microbe Interactions 25, 180–190 (2012).
Koren, S. et al. Canu: scalable and accurate long-read assembly via adaptive k-mer weighting and repeat separation. Genome research 27, 722–736 (2017).
Chin, C.-S. et al. Nonhybrid, finished microbial genome assemblies from long-read SMRT sequencing data. Nature methods 10, 563–569 (2013).
Simpson, J.T. et al. ABySS: a parallel assembler for short read sequence data. Genome research 19, 1117–1123 (2009).
Cameron, D.L. et al. GRIDSS: sensitive and specific genomic rearrangement detection using positional de Bruijn graph assembly. Genome research 27, 2050–2060 (2017).
Sedlazeck, F.J. et al. Accurate detection of complex structural variations using single-molecule sequencing. Nature methods 15, 461–468 (2018).
Simão, F.A., Waterhouse, R.M., Ioannidis, P., Kriventseva, E.V. & Zdobnov, E.M. BUSCO: assessing genome assembly and annotation completeness with single-copy orthologs. Bioinformatics 31, 3210–3212 (2015).
Saha, S., Bridges, S., Magbanua, Z.V. & Peterson, D.G. Empirical comparison of ab initio repeat finding programs. Nucleic acids research 36, 2284–2294 (2008).
Stanke, M. et al. AUGUSTUS: ab initio prediction of alternative transcripts. Nucleic acids research 34, W435-W439 (2006).
Jones, P. et al. InterProScan 5: genome-scale protein function classification. Bioinformatics 30, 1236–1240 (2014).
Armenteros, J.A. et al. SignalP 5.0 improves signal peptide predictions using deep neural networks. Nat Biotechnol 37, 420–423 (2019).
Krogh, A., Larsson, B., Von Heijne, G. & Sonnhammer, E.L. Predicting transmembrane protein topology with a hidden Markov model: application to complete genomes. Journal of molecular biology 305, 567–580 (2001).
Langmead, B. & Salzberg, S.L. Fast gapped-read alignment with Bowtie 2. Nature methods 9, 357–359 (2012).
Li, H. et al. The sequence alignment/map format and SAMtools. Bioinformatics 25, 2078–2079 (2009).
DePristo, M.A. et al. A framework for variation discovery and genotyping using next-generation DNA sequencing data. Nature genetics 43, 491–498 (2011).
Falush, D., Stephens, M. & Pritchard, J.K. Inference of population structure using multilocus genotype data: linked loci and correlated allele frequencies. Genetics 164, 1567–1587 (2003).
Hoagland, D.R. & Arnon, D.I. The water-culture method for growing plants without soil. Circular. California agricultural experiment station 347(1950).
Bolger, A.M., Lohse, M. & Usadel, B. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics 30, 2114–2120 (2014).
Dobin, A. et al. STAR: ultrafast universal RNA-seq aligner. Bioinformatics 29, 15–21 (2013).
Anders, S., Pyl, P.T. & Huber, W. HTSeq—a Python framework to work with high-throughput sequencing data. bioinformatics 31, 166–169 (2015).
Love, M.I., Huber, W. & Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome biology 15, 1–21 (2014).
Zhang, H. et al. Eight RGS and RGS-like proteins orchestrate growth, differentiation, and pathogenicity of Magnaporthe oryzae. PLoS pathogens 7, e1002450 (2011).

Table 1 is available in the Supplementary Files section

There is NO Competing Interest.

ExtendedDataFig1.pdf
Extended Data Fig. 1: Structure variation among Focgenomes. a) Whole-genome comparison between Foc II5 and Foc UK0001 reveals the existence of translocations in accessory sequences. Regions of homology between the two genomes were plotted as links via MUMmer (D). The accessory sequences typically display features of low GC content (A), high repetitive sequence composition (B) and low gene density (C). b) Syntenic characterization of F. oxysporumgenomes. Global view of genome synteny by mapping Foc II5 assembly to the reference genome Fol 4287, CAV045 and GD02. The four Fol 4287 unique accessory chromosomes are not present in Foc strains. c) Analysis of the chr3 synteny among multiple F. oxysporum strains (Top) and translocation of accessory sequences in the genome (Bottom). Gray links indicate conserved sequences shared by F. oxysporum genomes; green links indicate accessory sequences shared between Foc TR4 II5 and VCG0121 CAV045; red links indicate accessory sequences of chr11.
ExtendedDataFig2.pdf
Extended Data Fig. 2: SNP density on Chromosomes 3 and 6 of two Foc TR4 and two VCG 0121 strains (plotted in a 5-kb sliding window using Circos). Tracks from inside to outside are as follows: four histogram circles of SNP distribution on Chromosomes 3 and 6 for 811-VCG 01213-I-TR4, 789-VCG 01213-16-A-TR4, CAV2318-VCG 0121-T and CAV180-VCG 0121-T; and II5 core chr3 and chr6 (blue) with accessory sequences (orange) as reference. We marked the mating-type locus MAT1 on the core chromosomal region of chromosome 6, and Helitrons on accessory region of chromosome 3.
ExtendedDataFig3.pdf
Extended Data Fig. 3: Comparative meta-transcriptomics of Cavendish bananas infected with R1 (GD02) and TR4 (II5). a) The time-course stages of infection of GFP-tagged Foc in banana root. Root materials were collected, and the infection processes were monitored under a microscope after inoculation at different infection stages. Left to right: At 8 HPI, the pathogen starts the adsorptic stage, in which Focspores were observed on the surface of the host plant root. The pathogen started to germinate and cover the surface of plant root at 18 HPI, when the pathogen reached the biotrophic stage. The pathogen continued to grow, and hyphae penetrated the root. At approximately 32 HPI, many hyphae were evident in the xylem, and visible dark spots appear on the root, indicating the infective transition from the biotrophic to necrotrophic stage. At 56 HPI, there was a large increase in fungal biomass and necrotic root symptoms. b) Focrace 1 has weaker penetration capability than Foc TR4 in the infection process. Percentage of mapped reads derived from fungi and plants in the infection time course in race 1– (red) and Foc TR4–banana (green) interaction. The average of percentages of all replicates at each time point is displayed. c) Pearson correlation coefficient analysis of all samples using FPKM values of all expressed genes in fungi. TR4 transcriptional profiles had a high correlation at 18 and 32 HPI. The high correlation between R1 at 32 HPI and TR4 at 18 HPI/32 HPI and low correlation between R1 and TR4 at 18 HPI/32 HPI indicate that Foc TR4 responded more rapidly to the host than R1.
ExtendedDataFig4.pdf
Extended Data Fig. 4: Expression profiles of 18 fungal co-expressed gene clusters based TR4 and R1 shared orthologs using a global hierarchical clustering algorithm. Color scale indicates the correlation of expression between genes and the cluster centroids. Genes with an expression correlation with a centroid lower than 0.8 are shown in gray.
ExtendedDataFig5.pdf
Extended Data Fig. 5: Expression patterns a) and fungal network based on enriched Gene Ontology (GO) terms b) of three fungal gene clusters, Foc-C5, Foc-C7, and Foc-C14 that were significantly induced at 18 HPI in TR4 compared to R1. Foc-C5 (510 genes) was enriched for electron transfer activity (corrected p-value = 0.01), Foc-C7 (846 genes) for heme-copper terminal oxidase activity (corrected p-value = 0.03) and Foc-C14 (694 genes) for NADPH quinone reductase activity and regulation of the nitrogen compound metabolic process (corrected p-value = 0.05). Collectively, these three clusters are enriched for NO biosynthesis and denitrification genes. GO annotations and genes are presented as nodes. The annotations are highlighted with different colors based on the distribution of the nodes in the network. The size of the node is proportional to the number of connections.
ExtendedDataFig6.pdf
Extended Data Fig. 6: qRT-PCR of banana phytoglobin genes regulated by cellular NO level and serve as active scavengers of NO. qRT-PCR conformed that all three genes were significantly induced in Cavendish banana at 18 HPI with TR4 strain II5 compared with R1 strain GD02. Our RNAseq data identified one of the banana phytoglobin genes, Ma02_g10610, as one of the top 10 most highly induced plant genes. Asterisks indicate phytoglobin gene expressions that are significantly induced (* = p-value < 0.05, Student’s t test) in Foc TR4 inoculated Cavendish banana.
ExtendedDataFig7.pdf
Extended Data Fig. 7: Expression profiles of 24 plant-expressed gene clusters. Color scale indicates the correlation of expression between genes and the cluster centroids. Genes with an expression correlation with a centroid lower than 0.8 are shown in gray.
ExtendedDataFig8.pdf
Extended Data Fig. 8: Phylogeny of expressed, accessory transcription factor (TF) genes encoding the GAL4-like Zn(II)2Cys6 binuclear cluster DNA-binding domain. The phylogenetic analysis, inferred from maximum likelihood analysis, revealed that the TR4 expanded GAL4-like domain-containing TFs were grouped into three major clades. Notably, Clade III comprises 26 expanded homologs to FgZC1 (FGSG_05068), a transcription factor known to play an important role in the host-mediated fungal NO production and virulence in F. graminearum. In addition to those expressed accessory genes, this analysis included functional characterized genes with a GAL4-like domain. Ab, Alternaria brassicicola; Cl, Colletotrichum lindemuthianum; Fg, Fusarium graminearum; Fo, Fusarium oxysporum; Fv, Fusarium verticillioides; Ff, Fusarium fujikuroi; Mo, Magnaporthe oryzae; Vd, Verticillium dahliae.
ExtendedDataFig9.pdf
Extended Data Fig. 9: Functional study of two fungal effectors SIX1 and SIX4, both encoded in the accessory region of chromosome 3 and both were induced significantly upon infecting the host banana. Mutants DSIX1 and DSIX4 were generated in Foc TR4 II5 WT background using the standard one-step gene replacement strategy⁶⁹. Their complementary strains DSIX1-C (complemented FocDSIX1 strain) and DSIX4-C (complemented FocDSIX4 strain) were generated using the entire effector genes and their native promoter regions combining with the neomycin resistance. Cavendish banana plantlets with four or five leaves inoculated with mock (H₂O) and treatment soil samples were inoculated with conidia (5000 conidia/g soil) of different strains. Twenty plantlets were used for each treatment. The disease severity index (DSI) was calculated using the equation: DSI = [N_1-5 x S_1-5]/(N x S)] x 100%. In this equation, N is the total number of tested banana plants, and S is the highest score of symptoms. The DSI value of 0% suggests the loss of virulence, as the mock treated samples. The DSI values between 76-100% indicates highly virulent, as WT inoculated samples. Mutant DSIX1 inoculated samples had the DSI value 8%±1.2 between and mutant DSIX4 inoculated samples had the DSI value 35%±4.1, both showed significantly reduced symptoms compared to the WT. DSIX1-C and DSIX4-C restored virulence in Cavendish banana.
SupplementaryTablesfinalJuly22.xlsx
Datasets
Table1final.xlsx

Download PDF

Journal Publication

published 16 Aug, 2024

Read the published version in Nature Microbiology →

Version 1

posted

You are reading this latest preprint version

Accessory genes in tropical race 4 contributed to the recent resurgence of the devastating disease of Fusarium wilt of banana

Status:

Journal Publication

Version 1

Abstract

Figures

Main text

Results

Discussion

Methods

Declarations

References

Table

Additional Declarations

Supplementary Files

Status:

Journal Publication

Version 1