Patients and specimens
A total of 7 benign gastric tissue, 29 poor-differentiated and 48 well-differentiated cancerous tissue were collected under surgical resection in the first affiliated hospital of Jinan university during 2015 Jan to 2019 Nov. All of the samples were saved in liquid nitrogen until further analysis. The whole patients didn’t received any chemotherapy or radiotherapy before. This research was permitted by Ethics Committee of the first affiliated hospital of Jinan university.
Bioinformatic analysis
The website of Gene Expression Profiling Interactive Analysis (http://gepia.cancer-pku.cn) was applied to inquire and analyze the expression differences of MALA1 between gastric cancer tissues (n = 408) and para-cancer tissue (n = 211). The gastric cancer data set from kaplan-meier Plotter online database (http:/kmplot.com/analysis/) was used for online data, and the gastric cancer samples were divided into the high-expression group and the low-expression group for survival analysis.
Cell culture
GES1, MKN45, MGC803, and AGS cells were purchased from the Model Culture Collection (ATCC, Manassas, VA, USA). All of the cells were cultured with RPMI1640 medium. All complete medium consisted of 10% FBS (fetal bovine serum), 1% penicillin (100 U/mL) and streptomycin (0.1 mg/mL). Total cells were cultivated at 37℃ with 5% CO2. Reagents used in cell culture were bought from Gibco (Grand Island, NY, USA).
Cell transfection
LncRNA MALAT1 shRNA and shRNA negative control (NC) were bought from GenePharma (Shanghai, China). AGS cells were harvested at confluence of 70–80% and 35nM shRNA were transfected into 105 cells in a 2 ml cell suspension. This experiment included untransfected cells as control group. The interval between transfection and the subsequent experiment was 24 h.
Total RNA and qPCR
Total RNA was isolated from human gastric cancer tissue samples using TRIzol® Reagent Invitrogen (Invitrogen, USA). Then RNA samples were reversely transcribed by PrimeScript RT Master Mix kit (Takara, Dalian, China). The expression levels of mRNA was examined by SYBR Premix Ex Taq™ (Takara Bio, Otsu, Japan). GAPDH was considered as the internal reference gene. 2-ΔΔCq was used to analyze the relative expression of each genes. Primers were designed as follows: GAPDH: sense, 5’- AGAAGGCTGGGGCTCATTTG –3’ and antisense, 5’- AGGGGCCATCCACAGTCTTC –3; MALAT1: sense, 5’- TGGGATGGTCTTAACAGGGA –3’ and antisense, 5’- CCTGAAGGTGTTCGTGCCAA –3; VEGFA: sense, 5’- CGCAGCTACTGCCATCAAT –3’ and antisense, 5’- GTGAGGTTTGATCCGCATAATCT –3; AKT: sense, 5’- CCCAGGAGGTTTTTGGGCTT –3’ and antisense, 5’- AAGGTGCGTTCGATGACAGT –3; mTOR: sense, 5’- AACCTCCTCCCCTCCAATGA –3’ and antisense, 5’- AATCCCATGAGGCCTTGGTG –3; ERK1: sense, 5’- TGAAAACCACACGTCACATGG –3’ and antisense, 5’- CCCTGCATTGATCCACCTGT –3; ERK2: sense, 5’- AGTTCTTGACCCCTGGTCCT –3’ and antisense, 5’- CCTGGGACATCCCCAGAAAC –3.
CCK 8 assay
Cell proliferation was analyzed by using CCK 8 assay kit (Beyotime, China) according to the manufacturer instructions. Treated cells were incubated in 96-well plates with or without inhibitor for indicated times and followed by the addition of 10 μL CCK 8 reagent to each well. Samples were further incubated at 37 ℃ for 1 h. OD values were measured at 450 nm. All of the experiments were performed in triplicate.
Cell apoptosis and cell cycle assay
Cells were harvested after specific treatment, washed with ice-cold PBS for 3 times, and stained with annexin V-fluorescein isothiocyanate (FITC) apoptosis detection kits (KeyGEN Biotech, Nanjing, China). Cell apoptosis was analyzed in a flow cytometer (BD Biosciences).
After trypsinization, AGS cells were washed with cold PBS. Cells were participated and cold ethanol (75%) was used to dissolve the cells, followed by incubation at 4 °C for 4 h. Cells were washed with cold PBS three times. After washing, cells were stained with BD Pharmingen™ PI/RNase for 30 min at 25 °C, followed by flow cytometer at different cell cycle phases (G1, S, and G2).
Western blot
After trypsinization, AGS cells were harvested and then lysed in RIPA buffer (RIBO-BIO) with protease inhibitors (Roche, Switzerland). The concentration of protein was examined by using the BCA Protein Assay kit (Genstar, China). Protein samples were separated by 10% SDS-PAGE, and then transferred to PVDF membranes (Millipore, Boston, MA, USA). Next, the membranes were blocked with 5% milk for 1 h at room temperature and following incubation of primary antibodies (anti-VEGFA, anti-AKT, anti-p-AKT, anti-mTOR, anti-p-mTOR, anti-p-ERK, anti-ERK, and anti-GADPH) at 4 °C overnight. The PVDF membranes were incubated for another 1 h at room temperature in secondary antibody after washing three times with TBST. Strips were exposed with StarSignal Plus Chemiluminescent Assay Kit (Genstar, China).
Transwell assay
Cells were cultured for 72 h, and then in serum-free medium for another 24 h. After detachment with 0.05% trypsin- EDTA the cells were resuspended in a serum-free medium. Upper insert was filled with 100 μl of the cell suspension while reservoir chamber was filled with 600 μl of culture medium. Matrigel invasion assays were carried out in modified Boyden chambers with filter inserts with 8-μm pores in 24-well plates (Corning, NY, USA). The surfaces of the filters were coated with 50mg/L ice-cold Matrigel (Matrigel basement membrane matrix, BD Bioscience, NJ, USA).
Migration or invasion of cells was monitored at 3, 6, and 12 h at 37 °C in 5% CO2. Crystal violet was used as the staining solution to distinguish between migrated and non-migrated cells. A cotton swab was used to remove the cells that were left in the upper chamber of the membrane. Those cells that migrated through the insert were examined and counted with bright-field microscope.
Dual-luciferase reporter gene assay
The relationship between miR–126–5p and MALAT1 was identified using dual-luciferase reporter gene assay. MALAT1 and VEGFA untranslated region was artificially synthesized and inserted into pGL3-control vector (Promega, Madison) between XhoI and BamH sites. Using site-directed mutagenesis, MALAT1 (MALAT1-MUT) and VEGFA mutant (VEGF-MUT) sequence was conducted on the basis of wild-type (WT) sequence. Recombinant plasmids were co-transfected into HEK 293T cells (Shanghai Institute of Biological Sciences, Chinese Academy of Sciences, Shanghai, China) with miR–126–5p mimic and the negative control (NC) of miR–126–5p, respectively. After transfection for 48 h, the cells were lysed for determination of luciferase activity, which was measured on a Luminometer TD–20/20 (E5311; Promega, Madison, WI, USA) using a dual-Luciferase Reporter Assay System kit (Promega, Madison, WI, USA).
Statistical analysis
All assays were conducted in three separate experiments. All data were expressed as mean ± standard deviation (SD). Statistical analysis was performed with SPSS 22.0 software (SPSS, Chicago, IL, USA). The Student’ s t-test was used to determine the statistically significant differences between two groups. Kaplan-Meier analysis was used to determine the effects on overall survival of EC patients. Differences were considered statistically significant when P values less than 0.05.