Preparation of LCR extracts
The LCR used in this study was obtained by Green M. P. Pharmaceutical Co. Ltd. (Gyeonggido, Korea). To extract LCR, it was subjected to heat treatment with distilled water for 3 h at 105°C. The resulting mixture was then filtered through filter papers. After filtration, the filtrate was rapidly frozen to -70°C and subsequently lyophilized using a freeze dryer (Ilshin BioBase Co., Ltd, Gyeonggido, Korea). The lyophilized extract was kept at -20°C until further use.
Isolation and culture of primary skeletal myoblasts
Ethical approval for this study was obtained from the Jaseng Animal Care and Use Committee (Approval number: JSR-2022-07-001-A). Primary skeletal myoblasts were obtained from 1-d-old Sprague–Dawley rats (Samtako Bio, Korea), and isolated as previously described (Musaro and Carosio 2017; Boscolo Sesillo et al. 2020). Briefly, after postnatal rats were sacrificed, the tibialis anterior muscle from the hindlimb was immediately placed in a petri dish containing cold Dulbecco's Modified Eagle Medium (DMEM; Gibco BRL, Grand Island, NY, USA). The muscle tissue was digested using a skeletal muscle dissociation kit (Miltenyi, Bergisch Gladbach, Germany), and 10 ml of DMEM was added. The resulting suspension was then passed through a 70-µm strainer and centrifuged at 200 ×g for 20 min at room temperature (RT). The cell pellets were resuspended to a mixture of DMEM and Ham's F-10 nutrient mix (Gibco BRL) at a 1:1 ratio, supplemented with 20% fetal bovine serum (Gibco BRL), 1% penicillin-streptomycin (PS, Gibco BRL), and 10 ng/ml fibroblast growth factor-basic (bFGF; Peprotech, NJ, USA). The obtained primary myoblast were seeded in culture dishes or plates coated with Matrigel (Corning, New York City, NY, USA) (Scheme 1).
Extract treatment
When cell density reached 90% confluency after myoblast seeding, the growth medium was replaced with a differentiation medium consisting of DMEM supplemented with 5% horse serum (Gibco BRL) and 1% PS. After 4 d of incubation in the differentiation medium, primary skeletal myotubes were treated with different concentrations of LCR alone or LCR and 200 µM DEX (Sigma-Aldrich, St. Louis, MO, USA), or DEX alone for 48 h (Scheme 1).
Cell viability assay
Following the DEX stimulation, the myotubes were evaluated for cell viability using a Cell Counting Kit-8 (CCK-8; Dojindo, Kumamoto, Japan) utilized as per the manufacturer's instructions. The absorbance of the samples was measured at 450 nm using a microplate reader (Epoch; BioTek, Winooski, VT, USA).
Western blotting
Following the treatment, the myotubes were homogenized in RIPA buffer supplemented with phosphatase and protease inhibitors (Millipore, Burlington, MA, USA) for 30 min. Protein lysates were then separated using an 8% SDS-PAGE (sodium dodecyl sulfate–polyacrylamide gel) and then transferred onto a polyvinylidene difluoride membrane (Millipore) at 100 V for 90 min. The membrane was blocked in 5% nonfat skim milk (BD Biosciences, Franklin Lakes, NJ, USA) for 1 h at RT. Subsequently, the membrane was incubated with primary antibodies (Table 1) and then with secondary antibodies for 2 h at RT. Protein bands were visualized on an Amersham Imager 600 (GE Healthcare Life Sciences, Uppsala, Sweden) imaging system using an enhanced chemiluminescence (ECL) system (Bio-Rad, Hercules, CA, USA). Quantification of protein levels was performed using ImageJ (NIH, Bethesda, Maryland, USA).
Table 1
Primary antibodies used for western blot and immunocytochemistry
Antibody
|
Company
|
Product no.
|
Dilution
|
Myosin Heavy Chain (MHC)
|
R &D Systems
(Minneapolis, Minnesota, USA)
|
MAB4470
|
1:500
|
Atrogin-1
|
Abcam
(Cambridge, Cambridgeshire, U.K)
|
Ab168372
|
1:1000
|
MURF1
|
Invitrogen
(Waltham, Massachusetts, USA)
|
PA5-76695
|
1:1000
|
Immunocytochemistry
Following stimulation, the myotubes were fixed using 4% paraformaldehyde for 30 min at RT and permeabilized with 0.2% Triton X-100 in phosphate-buffered saline for 10 min. The myotubes were blocked with 2% normal goat serum for 1 h before incubation with primary antibodies (Table 1) and then treated with fluorescein isothiocyanate (FITC)-conjugated secondary antibodies (Jackson; west grove, Pennsylvania, USA) for 2 h at RT. Finally, the nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI) for 10 min at RT. The stained cells were visualized using a confocal microscope at 100× or 400× magnification (Nikon, Tokyo, Japan).
Real-time polymerase chain reaction (PCR)
After DEX stimulation, TRIzol (15596018, Ambion) was added to each well for RNA extraction. The extracted RNA was reverse transcribed to cDNA using an Accupower RT PreMix (Bioneer, Daejeon, Korea). Real-time PCR was performed using SYBR Green Master Mix (170-8882AP; Bio-Rad). The primer sequences used for PCR are listed in Table 2.
Table 2
List of primer sequences used for Real-time PCR
Primer
|
Forward (5'-3')
|
Reverse
|
Atrogin-1
|
GTCTCACGATCACCGACCTG
|
ATCTGCCGCTCTGAGAAGTG
|
MURF1
|
GGAGAAGCTGGACTTCATCG
|
CTTGGCACTCAAGAGGAAGG
|
GAPDH
|
CCCCCAATGTATCCGTTGTG
|
TAGCCCAGGATGCCCTTTAGT
|
Statistical analysis
The results are expressed as the mean ± SD. Statistical analyses among groups were performed by one-way analysis of variance (ANOVA) followed by a Tukey’s test using GraphPad Prism software (California, CA, USA). Differences were considered statistically significant at the following p-values: #p < 0.05, ##p < 0.01, ###p < 0.001 vs. blank group, *p < 0.05, **p < 0.01, ***p < 0.001 vs. DEX group.