Sample Size and Data Collection Methods
The sample size was all animals presented in each clinic suspected of strangles throughout the study period. Physical examination measurements such as body temperature, heart rate, and respiration rate were taken as part of the clinical examination. Moreover, equines, which showed cough, swollen lymph nodes with abscess formation, serous and mucopurulent nasal discharge, rupture of the mandibular lymph node, and enlargement of the submandibular lymph node, were clinically suspected to have strangles.
One hundred sixty nasal swab samples (75 horses, 59 donkeys, and 26 mules) were collected. Sterile cotton-tipped swabs moistened with peptone water broth (Microxpress Pvt. Ltd., India) were inserted into the nasal cavities of each equine, and the mucus surface was rubbed by rotating the swabs on both nostrils gently. The swabs were then placed back into labelled sterile universal tubes containing 5 ml of peptone water broth (Microxpress Pvt. Ltd., India). Labelled samples of nasal swabs were transported in an icebox to the Veterinary Microbiology Laboratory of the College of Veterinary Medicine and Animal Sciences, University of Gondar, for microbiological analysis. Questionnaires were used to gather information about strangles to assess the risk factors. Interviews with animal owners who had taken their animals to veterinary clinics were conducted to evaluate the owners' ways of managing their animals, their current feeding and watering practices, their history of transportation, and the equines' most recent health state.
Isolation and Identification of Streptococcus equi Species
Collected swap samples were cultured on 5% blood agar (Sisco Research Laboratories Pvt. Ltd., India) at 37°C under aerobic conditions, and to differentiate the genus Streptococcus, the colony was transferred from blood agar to Edward medium (Oxoid Ltd., Basingstoke, Hants., England), which was supplemented with 5% sheep blood on Edward medium and incubated at 37°C for 24 hrs. Under complete aerobic conditions, a honey-like colony was taken and subcultured onto 5% blood agar (Sisco Research Laboratories Pvt. Ltd., India) plates and incubated at 37°C under aerobic conditions.
The isolated bacteria were subcultured onto MacConkey agar (HiMidia Laboratories Pvt. Ltd., India) to differentiate Streptococcus species from Enterococcus species, of which Enterococcus species can tolerate bile salt and can grow on MacConkey agar, but Streptococcus species cannot grow. Therefore, beta-hemolytic colonies were subcultured on fresh 5% blood agar, and the morphology of the Streptococcus species (shape, arrangement) was examined by Gram staining. The Streptococcus equi species isolates were identified by biochemical tests such as the catalase test, the vogues proskuer test (VP), the oxidative fermentative test (OF), and the carbohydrate fermentation test. Moreover, sugar fermentation tests were carried out for glucose (HiMidia laboratories Pvt., Ltd., India), maltose, sucrose, sorbitol, starch; mannitol (Blulux laboratories Pvt., Ltd., India), lactose (Carelabmed, India), and arabinose (Finkem laboratories Pvt., Ltd., South Africa). The general flowchart of Streptococcus species isolation technique is depicted in Fig. 2.
Polymerase chain reaction of the SeM gene
Polymerase chain reaction was carried out to detect the presence of the SeM gene, which encodes the M-like protein exclusively found in S. equi subspecies equi. Therefore, all suspected isolates of S. equi species were tested for the SeM gene at the Molecular Biology Laboratory, Institute of Biotechnology, University of Gondar. The Streptococcus equi species isolates were cultured on tryptone soy broth (Micro-Express, India) and incubated overnight at 37°C. Then the genomic DNA of S. equi was extracted from overnight cultures using the conventional boiling method [12]. After centrifuging 1.5 ml of 24-hour cultured broth at 12,000 rpm for 5 minutes, the supernatant was discarded, and the pellets were washed twice with sterile water. The pellets were then mixed with 50 µl of lysozyme (20 mg/ml) (Himedia India), homogenized using a vortex, and then incubated at 37°C for 5 minutes before being heated in a boiling water bath at 56°C for another 5 minutes. The debris was then separated using a vortex and centrifuged for 5 minutes at 12,000 rpm. The supernatant was then used as the DNA template for PCR and kept at -20°C until needed. A NanoDrop was used to check the purity of the extracted DNA. The absorbance at 260 and 280 nm giving a ratio between 1.7–1.9 ng/µl was considered pure DNA and used for PCR amplification.
Amplification was carried out in a thermal cycler (TC-412, Germany) and the PCR protocol was performed as described by Kelly (2006). The 541 bp SeM gene was amplified using forward primers (5’- CAGAAAACTAAGTGCCGGTG − 3’) and reverse primers (5’-ATTCGGTAAGAGCTTGACGC-3), initial denaturation at 95°C for 5 min, denaturation at 90°C for 30 sec, annealing at 52°C for 40 sec, extension at 72°C for 1min, and final extension at 72°C for 7min. The reaction volume used was 20 µL containing 4 µL of the reaction mix (Blulux, India), 2 µL of the extracted DNA template, 0.5 µL of each primer, and 13 µL of nuclease-free water. The primers used in this study were procured from Proligo Pty., Ltd., Australia.
Visualization of the SeM gene through agarose gel electrophoresis
The PCR amplification products were analysed by electrophoresis in a 2% agarose gel and stained with 3 µL of ethidium bromide (Blulux, India). Twelve microliters of the PCR product along with 3 µl of gel loading dye (Medox, India) was loaded into the wells and enough running buffer, Tris-acetate EDTA (TAE 1x) (Medox, India), was added to cover the surface of the gel. Then, electrophoresis was performed at 100 volts for 40 min. The product sizes were determined by comparison with the relative mobility of the 100 bp DNA standard ladder (Mumbai, India). After sufficient migration, the gels were taken to the gel documentation system machine (Biobase, China), and the results were visualized and recorded.
Antibiogram profile of Streptococcus equi subspecies equi
The antimicrobial susceptibility test results of S. equi subspecies equi were determined using the standard antimicrobial susceptibility guidelines described in the Clinical Laboratory Standard Institute [13]. The in vitro susceptibility test was performed on a molecularly confirmed isolate of S. equi ssp. equi and disc diffusion susceptibility tests were used. Six antibiotics used to treat equine strangles including penicillin G (10 U), amoxicillin (30 µg), tetracycline (30 µg), sulfamethoxazole-trimethoprim (1.25 µg), erythromycin (30 µg), and vancomycin (30 µg) were tested.
Colonies of the same morphologic type were mixed into 5 ml sterile saline water and vortexed. The turbidity was compared to 0.5 McFarland standards and inoculated onto Muller-Hinton agar (Oxoid Ltd., Basingstoke, England). After 15 minutes, antibiotic discs were placed into inoculated Muller-Hinton agar (Oxoid Ltd., Basingstoke, England) and aerobically incubated for 24 hours at 37°C. The zone of inhibition was measured using a ruler. According to the CLSI (2021) standard, individual antibiotic inhibition was classified as susceptible, intermediate, or resistant [13]