Identification of a Cinnamoyl-CoA Reductase Involved in Cinnamaldehyde Biosynthesis from Cinnamomum cassia

doi:10.21203/rs.3.rs-3277916/v1

Download PDF

Research Article

Identification of a Cinnamoyl-CoA Reductase Involved in Cinnamaldehyde Biosynthesis from Cinnamomum cassia

https://doi.org/10.21203/rs.3.rs-3277916/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

A significant accumulation of cinnamaldehyde has been found in the barks of Cinnamomum cassia, which are used in traditional Chinese medicine. Cinnamaldehyde exhibits various pharmacological properties such as anti-inflammatory, analgesic, and stomachic effects. However, further confirmation of the biosynthetic pathway for cinnamaldehyde is needed. In this study, we analyzed 15 transcriptomes from five different tissues to understand the accumulation of active components and identify the genes responsible for cinnamaldehyde biosynthesis. Our transcriptome database contained nearly all genes associated with the cinnamaldehyde pathway, with the majority of them demonstrating high abundance in branch barks and barks. We successfully cloned C. cassia cinnamoyl-CoA reductase (CcCCR1), a key gene in the biosynthesis of cinnamaldehyde, and found that its expression pattern mirrored the cinnamaldehyde content level. The recombinant CcCCR1 protein efficiently converted cinnamoyl-CoA into cinnamaldehyde. Compared to Arabidopsis thaliana cinnamoyl-CoA reductase 1 (AtCCR1), CcCCR1 exhibited approximately 17-fold higher catalytic efficiency (kcat/Km). Molecular docking studies also indicated superior catalytic activity of CcCCR1 compared to AtCCR1, which can be utilized for engineering higher cinnamaldehyde production as previously reported. These findings provide valuable insights for the functional characterization of enzyme-coding genes and hold potential for future engineering of cinnamaldehyde biosynthetic pathways.

Transcriptome

Cinnamomum cassia

metabolic profiling

cinnamaldehyde

cinnamoyl-CoA reductase

Cinnamomum cassia Presl, a member of the Lauraceae family, is extensively cultivated in southern China and its barks have been widely utilized as a significant medicinal substance in China for treating chronic bronchitis, impotence, dyspnea, rheumatism and neurodynia (China Pharmacopeia Commission, 2020). Numerous studies have documented the remarkable properties of cinnamon essential oils, including their anti-inflammatory effects, antioxidant activity, potential for anticancer activity, and antibacterial properties (Kim et al. 2018, Doyle et al. 2019, Mateen et al. 2019, Kim 2022).

Cinnamaldehyde is the primary component of cinnamon essential oil (China Pharmacopeia Commission, 2020). Cinnamaldehyde has received the Generally Recognized as Safe (GRAS) status from the United States Food and Drug Administration (FDA) and the Flavour and Extract Manufacturer's Association (FEMA). Additionally, it has been granted A status by the Council of Europe, indicating its approval for use in foodstuffs (Doyle and Stephens 2019). Cinnamaldehyde is currently obtained by chemical synthesis from benzaldehyde and acetaldehyde or by direct extraction from cinnamon bark oil. Nevertheless, these methods have certain drawbacks: (i) the challenge of effectively isolating various cinnamaldehyde derivatives and stereoisomers during chemical synthesis, and (ii) the need for plant logging and consumption in the extraction process (Bang et al. 2016). Therefore, it is crucial to develop a sustainable and highly efficient biological system, such as constructing a microbial cell factory, to engineer the production of cinnamaldehyde. In a previous study, Bang et al. (2016) demonstrated that the introduction of Streptomyces maritimus phenylalanine ammonia-lyases (SmPAL), Streptomyces coelicolor 4-coumarate:CoA ligase (Sc4CL), and Arabidopsis thaliana cinnamoyl-CoA reductase 1 (AtCCR1) into Escherichia coli resulted in the production of cinnamaldehyde with a yield as high as 75 mg/L. However, further enhancements are still required. The enzymes PAL and 4CL utilized in this engineered bacterial system are derived from microbial sources. The suboptimal activities of these biosynthetic enzymes may contribute to the low conversion rate of cinnamaldehyde. Additional improvements can be achieved through engineering the activities of individual enzymes or by developing protein scaffolds to modularly control pathway flux. These strategies have the potential to enhance enzymatic reactions and enable the attainment of significantly higher production titers.

Lignin mainly comprises diverse phenylpropanoids, primarily ρ-coumaryl, coniferyl, and sinapyl alcohols, which are formed through the dehydrogenation of ρ-coumaraldehyde, coniferaldehyde, and sinapaldehyde. Upon integration into lignin, these monolignols are identified as ρ-hydroxyphenyl (H), guaiacyl(G), and syringyl (S) units, respectively (Lourenço et al. 2016). CCR is the first committed gene in the lignin-specific pathway and plays a role in the lignin biosynthesis pathway. In 1975 and 1976, two studies confirmed that CCR functions as a catalyst for converting various cinnamoyl-CoA thiol esters (ρ-coumaroyl-CoA, feruloyl-CoA, sinapoyl-CoA, caffeoyl-CoA, 5-Hydroxyferuloyl-CoA, and cinnamoyl-CoA) into their corresponding cinnamaldehydes (ρ-coumaraldehyde, coniferaldehyde, sinapaldehyde, caffealdehyde, 5-Hydroxyferuylaldehyde, and cinnamaldehyde) in vitro (Gross and Kreiten 1975, Wengenmayer et al. 1976). Except cinnamoyl-CoA, the other derivatives serve as substrates in the biosynthesis of monolignols. Futhermore, it was observed that CCR from cell suspension cultures of soybean (Glycine max L. var. Mandarin) or Forsythia exhibits low affinity towards cinnamoyl-CoA (Gross and Kreiten 1975, Wengenmayer et al. 1976). In 1997, CCR was first cloned and identified in Eucalyptus gunnii (Lacombe et al. 1997). This initial characterization of a gene corresponding to CCR opens up new possibilities for genetically engineering plants with lower lignin content. After that, two CCR isoforms in Arabidopsis thaliana, namely AtCCR1 and AtCCR2, contain a conserved motif known as KNWYCYGK. AtCCR1 is primarily involved in constitutive lignification, whereas AtCCR2 is involved in the biosynthesis of phenolic compounds, which can accumulate and contribute to pathogen resistance (Lauvergeat et al. 2001). This pattern has also been confirmed in numerous other higher terrestrial plants, including maize, rice, sugarcane and eucalyptus (Lauvergeat et al. 2001, Guillaumie et al. 2007, Xu et al. 2009, Carocha et al. 2015, Jardim-Messeder et al. 2021). However, cinnamaldehyde residues cannot be directly formed via polymerization (Vanholme et al. 2019), and only a limited number of plant species contain substantial levels of cinnamaldehyde. Therefore, previous studies have primarily focused on regulating the flux of precursors (ρ-coumaroyl-CoA, feruloyl-CoA, sinapoyl-CoA, caffeoyl-CoA and 5-Hydroxyferuloyl-CoA) through the pathway leading to lignin biosynthesis (Baltas et al. 2005, Zhou et al. 2010, Liu et al. 2012). Nevertheless, the abundant presence of cinnamaldehyde in cinnamon barks suggests that CCR from cinnamon may exhibit high catalytic activity towards cinnamoyl-CoA.

In this study, we conducted targeted cinnamaldehyde profiling on various tissues including leaf buds, young leaves, mature leaves, branch barks, and barks to examine the accumulation of active compounds. To identify potential genes involved in the biosynthesis of cinnamaldehyde, we utilized Illumina deep RNA sequencing to analyze 15 transcriptomes of C. cassia. Consequently, we uncovered the genes responsible for cinnamaldehyde biosynthesis. Additionally, we cloned and characterized the key gene CCR, which plays a crucial role in cinnamaldehyde formation, to determine its biochemical function. Our results revealed that CcCCR1 showed around 17-fold higher catalytic efficiency (kcat/Km) in comparison to AtCCR1, the cinnamoyl-CoA reductase enzyme found in Arabidopsis thaliana. Furthermore, molecular docking analysis confirmed the superior catalytic activity of CcCCR1 over AtCCR1, as previously reported in cinnamaldehyde production engineering studies (Bang et al. 2016). These findings serve as a valuable reference for understanding the functionality of genes encoding enzymes and offer insights for future endeavors in engineering the biosynthetic pathways of cinnamaldehyde.

Plant materials and compound standards

C. cassia specimens were collected from the Zhao-Qing region (longitude: 112.33E; latitude: 23.36N) in Guangdong Province, China. In May 2019, five different tissue types, namely, leaf buds, young leaves, mature leaves, branch barks, and barks, were collected from 7-year-old C. cassia trees. The collected samples were immediately flash-frozen in liquid nitrogen and stored at -80°C. Multiple biological replicates were obtained to ensure experimental reproducibility.

The cinnamoyl-CoA, ρ-coumaroyl-CoA and ρ-coumaraldehyde used in the experiments was procured from Shanghai Zhen-Zhun Bio-Technology Co., Ltd, China. The cinnamaldehyde standard employed was purchased from TCI, Japan.

Total RNA extraction, cDNA library construction and sequencing

Total RNA was extracted from leaf buds, young leaves, mature leaves, branch barks, and barks using a plant total RNA extraction kit from Magen (China) following the manufacturer's protocol. The isolated total RNA was then utilized for cDNA library construction and subjected to deep sequencing on the Illumina HiSeq 2000 platform.

De novo transcriptome assembly

Raw reads were subjected to analysis for the removal of sequencing adaptors, reads containing poly-N sequences, reads with less than 60 nucleotides, ribosomal RNA reads, and low-quality reads using Trimmomatic v0.33 (Bolger et al. 2014). Following the elimination of contaminating reads, de novo assembly was performed using Trinity pipeline v2.0.6 (Grabherr et al. 2011) with a minimum contig length requirement of 100 nucleotides. Subsequently, the software program (Langmead and Salzberg 2012) was employed to cluster transcripts into unigenes.

Functional annotation and classification of unigenes

Unigenes were subjected to annotation against the Nr, Universal Protein Resource (UniProt), EuKaryotic Orthologous Groups (KOG), and Swiss-Prot databases using the local BLASTX program, with an E-value threshold of 1e − 5. Subsequently, Gene Ontology (GO) annotation of unigenes was conducted to provide information on molecular function, biological processes, and cellular components. This was accomplished utilizing Blast2GO (Conesa et al. 2005). To characterize the metabolic pathways, the annotated unigenes were further mapped based on data from public databases including the Cluster of Orthologous Groups (COG) and the Kyoto Encyclopedia of Genes and Genomes (KEGG).

Identifying genes involved in the biosynthesis of cinnamaldehyde in C. cassia

An initial investigation of the genes associated with cinnamaldehyde biosynthesis was performed using five database annotations, primarily focusing on KEGG annotations. All obtained sequences underwent protein function domain analysis using NCBI CCD and PFAM. Subsequently, a heat map was generated utilizing TBtools (Chen et al. 2020).

Bioinformatics analysis and cloning of CcCCR1

The deduced protein sequences of CcCCR1 and CCR1 from other plant species were obtained from the NCBI. The accession numbers of other species CCRs are listed in Supplementary Table 1. Multiple amino acid sequence alignment was conducted using CLUSTALW (Thompson et al. 1994) with the downloaded sequences as templates. The alignment results were annotated using ESPript3 (https://espript.ibcp.fr) (Robert and Gouet 2014). Phylogenetic analysis was performed using the one-step build a ML tree function of TBtools (Chen et al. 2020) and modified using iTOL (http://itol.embl.de/). The isoelectric point of the CcCCR1 protein was determined for subsequent bioinformatics analysis using ExPASy (http://web.expasy.org/compute_pi/).

For the cloning of the CcCCR1 gene, primers (forward primer: TATCGGATCCGAATTCATGCCGATAGAAGACAGCTCCT; reverse primer: GGTGGTGGTGCTCGAGAGAGAGCGGTTTTGGGAGG) were designed based on our transcriptomes to amplify the full-length open reading frames (ORFs). AtCCR1 (NCBI ID: NM_001332191.1) was cloned as a positive control, with the following primers (forward primer: TATCGGATCCGAATTCATGCCAGTCGACGTAGCC; reverse primer: GGTGGTGGTGCTCGAGAGACCCGATCTTAATGCCATTTTCC). PCR was performed for 35 cycles at 94°C for 30 s, 60°C for 1 min, and 72°C for 1 min. The resulting PCR products were subcloned into the pET30a vector and transformed into Escherichia coli DH5α cells. After sequencing confirmation, the successful constructs were transformed into E. coli Rosetta (DE3) cells.

Recombinant protein expression of CcCCR1 and AtCCR1 and purification in E. coli cells

The transformed colonies of E. coli cells were cultured in LB medium supplemented with kanamycin (50 mg/L) and chloramphenicol (25 mg/L) at 37°C until the OD600 reached a value higher than 0.4. Protein expression was induced by adding 0.1 mM isopropyl-β-D-1-thiogalactopyranoside (IPTG) at 16°C. The cells were allowed to grow for 16–20 hours and then harvested by centrifugation at 8000 rpm for 5 minutes. The resulting cell pellets were frozen and stored at -80°C for 10 minutes. Each frozen cell pellet corresponding to the CCR homologs was individually resuspended in binding buffer (pH 7.5) containing Tris-HCl (50 mM), NaCl (200 mM), and imidazole (10 mM). Subsequently, the cells were lysed by sonication for 10 minutes on ice using 5-second pulses at 200 W. Following sonication, the cell debris for each CCR homolog was removed by centrifugation at 12,000 rpm for 20 minutes at 4°C.

All purification steps were carried out at 4°C using a Ni column (25 mL, Sangon Biotech, China) that had been equilibrated with binding buffer. Samples from each enzyme preparation were applied to the affinity column, and the columns were initially washed with binding buffer to remove unbound proteins. The target proteins were eluted individually with elution buffer (250 mM in binding buffer), and 1-mL fractions were collected. For each CCR homolog, 15 µL aliquots of every other fraction were subjected to analysis using SDS-PAGE with gradient gels (10% acrylamide), and the proteins were visualized using an eStain L1 protein staining system (Bio-Rad, USA). Fractions containing each His-tagged CCR (with a molecular mass of approximately 42.9 kDa for CcCCR1 and 44 kDa for AtCCR1) were combined and dialyzed using centrifugal filter columns (Millipore, USA) at 4000 rpm. The protein concentration was determined using the BCA method, with bovine serum albumin used as the standard.

Enzyme assay activity of CcCCR1 and AtCCR1

For enzyme characterization, enzyme assays were conducted using a total reaction volume of 200 µL with excess NADPH and cinnamoyl-CoA as the substrates. The reaction mixture for enzyme assays consisted of 100 mM potassium/sodium phosphate (pH 6.25), 5 µg of purified protein, and was incubated at 30°C for 1 hour. Each sample was then overlaid with 200 µL of methanol, vigorously vortexed, and centrifuged at 12,000 rpm for 5 minutes. Subsequently, 200 µL of the supernatant was used for HPLC analysis. The HPLC analysis was conducted on an Agilent 1260 Series HPLC system equipped with a Poroshell 120 SB-C18 column (4.6 ×250 mm, 5 µm). The mobile phase for each sample consisted of a 35:65 mixture of 100% acetonitrile and 0.1% phosphoric acid, delivered at a flow rate of 1 mL/min. The analysis was performed at a temperature of 30°C and monitored at a wavelength of 290 nm for a duration of 15 minutes.

To determine the Michaelis-Menten kinetic parameters, different substrate concentrations ranging from 0.02 to 0.3 mM were used. The experiments were carried out in duplicate.

Molecular docking

Protein homology modeling was conducted utilizing the Alphafold2 server (https://colab.research.google.com/github/sokrypton/ColabFold/blob/main/AlphaFold2.ipynb#scrollTo=G4yBrceuFbf3) (Jumper et al. 2021), which yielded a protein structure of satisfactory quality. The structures of the ligands, namely cinnamoyl-CoA and NADPH, were obtained from PubChem (https://pubchem.ncbi.nlm.nih.gov/). Subsequently, the receptors and ligands underwent pre-processing using Schrodinger software (version 12.9). The grid boxes for cinnamoyl-CoA were determined based on the crystal structure of PhCCR (PDBID: 4R1S) (Pan et al. 2014, Sattler et al. 2017 ).

Following the execution of ligand docking, the docking results were evaluated based on the best docking score, and the output was visualized using Pymol software (version 1.15). The molecular docking process involved two rounds. Initially, the structure derived from protein homology modeling served as the receptor, while the cofactor NADPH acted as the ligand for the first round of docking. Subsequently, the receptor consisted of the protein structure bound to NADPH, and the substrate was employed as the ligand for the second round of docking.

Profiling of cinnamaldehyde in different tissues of C. cassia

In order to investigate the accumulation of cinnamaldehyde in various tissues of C. cassia, HPLC was utilized to analyze the methanol extracts obtained from leaf buds, young leaves, mature leaves, branch barks, and barks. Our findings revealed that barks exhibited the highest levels of cinnamaldehyde accumulation, while branch barks demonstrated the second highest levels (Fig. 1). These levels were found to be twice as high compared to those detected in young leaves, mature leaves, and leaf buds. These results suggest that the expression of cinnamaldehyde biosynthetic genes differs among these tissues.

Sequencing and de novo assembly of the C. cassia transcriptome

In order to identify key genes associated with cinnamaldehyde production, a total of fifteen RNA-seq libraries were constructed from tissues including young leaves, mature leaves, leaf buds, branch barks, and barks. Subsequently, these libraries were sequenced using the Illumina platform. De novo assembly of the obtained data resulted in 21,456,754 transcripts, with an average length of 48 bp. These transcripts were further assembled into 249,510 unigenes, possessing an average length of 467.33 bp and an N50 of 738 bp (Table 1). Although the N50 value obtained in this study was slightly lower than the previously reported N50 of 1248 bp (Gao et al. 2020), it sufficiently meets the requirements for the discovery of metabolite-related genes associated with cinnamaldehyde production.

Table 1

Throughput and quality of RNA-seq.
Type	Sequences	Bases	Min	Max	Average	N50	(A + T) %	(C + G) %
All_Contigs	21,456,754	1.25E + 09	25	16889	58.23	48	54.67	45.33
All_Unigenes	249,510	1.17E + 08	201	15761	467.33	738	56.34	43.66

Functional annotation of C.cassia unigenes

C. cassia unigenes were subjected to BLAST searches against five public databases to obtain annotations. Among the entire set of unigenes, 61,849 were successfully annotated in the GO database, 62,805 in the Swiss-Prot database, 89,467 in the Nr database, 49,232 in the COG database, and 13,441 in the KEGG database (Fig. 2).

Firstly, among the biological process subcategories in the GO annotation, the subcategory with the second highest number of annotated unigenes was metabolic process (24,620). Additionally, within the molecular function subcategories, the most frequently matched subcategory was catalytic activity (33,124) (SFig. 1).

Secondly, in the COG annotation, the largest category observed was general function prediction only (6,486). Moreover, this study specifically focused on the categories of secondary metabolite biosynthesis, transport, and catabolism, with 2,188 unigenes being identified in the COG database. This finding highlights the complexity of secondary metabolism in C. cassia.

Thirdly, Blastx results for C. cassia were utilized to assign associated KEGG pathways to all unigenes, resulting in 13,441 unigenes being assigned to 148 pathways. Key secondary metabolic pathways related to phenylpropanoid biosynthesis were also assigned to 203 unigenes (SFig. 3).

In conclusion, the gene annotations obtained in this study sufficiently meet the requirements for the discovery of metabolite-related genes associated with cinnamaldehyde production.

Putative genes involved in cinnamaldehyde biosynthetic pathway and sequence analysis of CcCCR1

In this study, a heat map depicting the expression profiles of genes involved in the phenylalanine to cinnamaldehyde conversion pathway was generated using RPKM reads of unigenes across various tissues. Figure 3A presents the putative pathway of cinnamaldehyde biosynthesis. The RPKM value of CcCCR1, which is the first gene in the cinnamaldehyde pathway, showed higher expression in the branch bark and bark compared to other tissues (Fig. 3A). For phylogenetic tree analysis, CCRs (cinnamoyl-CoA reductase) from monocot and dicot plants, including CcCCR1, were utilized. CcCCR1 was categorized into the dicot subfamily along with other CCRs from different plant species (Fig. 3B). Sequence alignment of CcCCR1 revealed the presence of the KNWYCYGK motif responsible for CoA-binding and NADPH binding, whereas other CCRs do not possess this motif. These two motifs have been reported to exist in all confirmed CCR sequences (Lacombe et al. 1997) (Fig. 3C), indicating that CcCCR1 plays a pivotal role in the cinnamaldehyde biosynthetic pathway.

Isolation and functional characterization of the CcCCR1 gene involved in the synthesis of cinnamaldehyde in C. cassia

The full-length cDNA of CcCCR1 was identified to be 1581bp in length, which included a 993 bp open reading frame (ORF) (GenBank ID: OR416486). The ORF encoded a protein consisting of 330 amino acids, with a calculated molecular weight of 36.3 kDa and an isoelectric point of 6.40. To investigate the biochemical functions of CcCCR1, the cDNA containing the 993-bp ORF was successfully cloned. Recombinant CcCCR1 protein production was achieved using an His-tagged vector (pET-30a). This vector facilitated the expression of soluble proteins in Rosetta (DE3) cells. Subsequently, the proteins were purified via Ni affinity chromatography using Dextrin Beads 6FF. On SDS-PAGE, the CcCCR1 protein displayed a molecular mass of approximately 42.9 kDa (Fig. 4A). Upon incubation of the recombinant CcCCR1 protein with cinnamoyl-CoA, HPLC analysis revealed that the protein effectively converted the substrate cinnamoyl-CoA into the corresponding product cinnamaldehyde (Fig. 4B).

Enzymatic kinetic parameters

The spectrophotometric NADPH consumption assays were conducted to determine the kinetic parameters of the recombinant proteins CcCCR1 and AtCCR1. It was observed that both CcCCR1 and AtCCR1 had a similar affinity towards cinnamoyl-CoA. However, CcCCR1 exhibited an approximately 17-fold higher catalytic efficiency (kcat/Km) compared to that of AtCCR1. This finding suggests that CcCCR1 possesses superior catalytic activity and holds promise as a more favorable enzyme for future engineering of biosynthetic pathways targeting cinnamaldehyde production. Detailed results can be found in Table 2 and Supplementary Fig. S4.

Table 2

Kinetic parameters of AtCCR1 and CcCCR1.
Protein ID	Vmax (nkat mg^− 1)	Km(µM)	kcat(min^− 1)	Km/kcat(µM^− 1 min^− 1)
AtCCR1	0.498617985	248.2	1.283186	0.00517
CcCCR1	6.63287069	245.5	17.66643	0.071961

Molecular docking

To elucidate the catalytic activities of AtCCR1 and CcCCR1, a molecular docking approach was employed. The overall structure (SFig. S5) of the two CCRs showed significant resemblance to the crystal structures of PhCCR1. When aligning PhCCR1 with AtCCR1, a higher r.m.s.d. value of 0.495 Å was obtained compared to the alignment between PhCCR1 and CcCCR1, which yielded a higher r.m.s.d. value of 0.488 Å. The r.m.s.d. value for the alignment between CcCCR1 and AtCCR1 is 0.351 Å. The molecular docking analysis also involved the utilization of NADPH and cinnamoyl-CoA as small ligand molecules. The binding pocket of NADPH and cinnamoyl-CoA is consistent with previous studies (Fig. 5A & 5B) (Pan et al. 2014, Sattler et al. 2017). When NADPH was used as a ligand, the docking scores of CcCCR1 (-10.7638) and AtCCR1 (-10.9801) were found to be similar, suggesting possible differences in cinnamoyl-CoA binding. Following ligand docking using Schrodinger, CcCCR1 exhibited a higher docking score than AtCCR1 (-11.0371 < -9.11643). The greater binding capability of CcCCR1 might account for the higher cinnamoyl-CoA production in C. cassia compared to A. thaliana.

CCR catalyzes the reduction of hydroxycinnamoyl-coenzyme A esters using NADPH to produce hydroxycinnamyl aldehyde. It acts on hydroxycinnamoyl-coenzyme A esters derived from lignin monolignol biosynthetic substrates as well as non-lignin biosynthesis substrates, such as ρ-Methoxycinnamoyl-CoA, 3,4-Dimethoxycinnamoyl-CoA and cinnamoyl-CoA in this study (Gross and Kreiten 1975), indicating CCR is a broad-specificity enzyme in vitro. In our study, we characterized CcCCR1 converted the substrate cinnamoyl-CoA into the corresponding product cinnamaldehyde. Additionally, we also confirmed that this CcCCR1 is capable of catalyzing the conversion of ρ-coumaroyl-CoA to ρ-coumaraldehyde, highlighting its involvement in lignin biosynthesis (SFig. 6). It should be noted that cinnamyl alcohol, which is derived from cinnamaldehyde residues through dehydrogenation, cannot be directly incorporated into lignin through polymerization. As some arguments suggest, an excessive number of initial monomers could lead to low molecular weight lignin, thereby favoring positive selection for plants with restricted biosynthesis or translocation of such monomers into the lignifying cell wall (Vanholme et al. 2019). Cinnamon accumulates a large amount of cinnamaldehyde, which may contribute to its adaptation to the environment due to the protective properties of cinnamaldehyde. No studies have indicated the accumulation of cinnamaldehyde content in A. thaliana, and it has been observed that AtCCR1 does not catalyze the conversion of cinnamoyl-CoA into cinnamaldehyde in vivo. This is likely due to the fact that A. thaliana is a small grass species where hydroxycinnamoyl-CoA predominantly serves the lignin biosynthesis pathway.

The remarkable catalytic activity exhibited by CcCCR1 towards cinnamoyl-CoA suggests the potential for functional evolution to adapt environment, thus facilitating the emergence of structured clusters of nonsynonymous substitutions critical for enzyme adaptation towards novel functions (Matsuno et al. 2009). All confirmed CCRs share the NWYCY sequence motif, which could directly affect both the catalysis and binding of the CoA (Sattler et al. 2017). In our molecular docking results, we found Cys-163 is in close proximity to Cys-155 in cinnamon, and it has been shown that the two residues contribute to cystine formation under oxidizing conditions (Pan et al. 2014) However, in AtCCR1, these two cysteine residues are far away from the CoA group. In additional, the side chain of Pro-140 is engaged in hydrophobic interactions with nearby Tyr-289, similar to SbCCR1(Sattler et al. 2017). Nevertheless, in AtCCR1, the corresponding residues are Arg-137 and Tyr-288 (SFig. 7). Furthermore, CcCCR1 exhibits different residues compared to AtCCR1 (SER222/LEU221, THR223/VAL222) (Fig. 5). These differing residues were examined within the vicinity of the cinnamoyl-CoA binding pocket, and this substitution potentially contributes to the divergent substrate specificity observed between the two CCRs. It may play a crucial role in their binding capabilities and needs to be confirmed. Taken together, these findings provide structural information for CCR catalytic activity in plants.

The bark of C. cassia, a traditional Chinese medicine, contains a significant amount of cinnamaldehyde. This compound has various beneficial effects such as reducing inflammation, relieving pain, and aiding digestion. In our study, we analyzed the genetic information of different tissues and identified the genes responsible for cinnamaldehyde production. We successfully cloned a key gene called CcCCR1, which showed high efficiency in converting a precursor into cinnamaldehyde. Compared to a similar enzyme in another plant, CcCCR1 was much more effective. These findings provide valuable insights for improving cinnamaldehyde production through genetic engineering.

Acknowledgements We are grateful for financial support of the Guangdong Basic and Applied Basic Research Foundation (2020B1515420007) and the Key-Area Research and Development Program of Guangdong Province (2020B020221001, 2021B070701000).

Author contribution statement HW and YQL conceived and designed the research. PY analyzed data and wrote the manuscript. JMS and JHL assist during the experiments. All authors read and approved the manuscripts.

Data availability The CDS and protein sequence of CcCCR1 have been summitted to GenBank (accession number: OR416486).

Conflict of interest The authors declare no conflict of interest.

Baltas M, Lapeyre C, Bedos-Belval F et al (2005) Kinetic and inhibition studies of cinnamoyl-CoA reductase 1 from Arabidopsis thaliana. Plant Physiol Biochem 43(8):746–753
Bang HB, Lee YH, Kim SC et al (2016) Metabolic engineering of Escherichia coli for the production of cinnamaldehyde. Microb Cell Fact 15:16
Bolger AM, Lohse M, Usadel B (2014) Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics 30(15):2114–2120
Carocha V, Soler M, Hefer C et al (2015) Genome-wide analysis of the lignin toolbox of Eucalyptus grandis. New Phytol 206(4):1297–1313
Chen C, Chen H, Zhang Y et al (2020) TBtools: An Integrative Toolkit Developed for Interactive Analyses of Big Biological Data. Mol Plant 13(8):1194–1202
Conesa A, Götz S, García-Gómez JM et al (2005) Blast2GO: a universal tool for annotation, visualization and analysis in functional genomics research. Bioinformatics 21(18):3674–3676
Doyle AA, Krämer T, Kavanagh K et al (2019) Cinnamaldehydes: Synthesis, antibacterial evaluation, and the effect of molecular structure on antibacterial activity. Results in Chemistry 1:100013
Doyle AA, Stephens JC (2019) A review of cinnamaldehyde and its derivatives as antibacterial agents. Fitoterapia 139:104405
Gao H, Xu D, Zhang H et al (2020) Transcriptomics and metabolomics analyses reveal the differential accumulation of phenylpropanoids between Cinnamomum cassia Presl and Cinnamomum cassia Presl var. macrophyllum Chu. Ind Crop Prod. 148
Grabherr MG, Haas BJ, Yassour M et al (2011) Full-length transcriptome assembly from RNA-Seq data without a reference genome. Nat Biotechnol 29(7):644–652
Gross GG, Kreiten W (1975) Reduction of coenzyme a thioesters of cinnamic acids with an enzyme preparation from lignifying tissue ofForsythia. FEBS Lett 54(2):259–262
Guillaumie S, San-Clemente H, Deswarte C et al (2007) MAIZEWALL. Database and developmental gene expression profiling of cell wall biosynthesis and assembly in maize. Plant Physiol 143(1):339–363
Jardim-Messeder D, Felix-Cordeiro T, Barzilai L et al (2021) Genome-wide analysis of general phenylpropanoid and monolignol-specific metabolism genes in sugarcane. Funct Integr Genomics 21(1):73–99
Jumper J, Evans R, Pritzel A et al (2021) Highly accurate protein structure prediction with AlphaFold. Nature 596(7873):583–589
Kim ME, Na JY, Lee JS (2018) Anti-inflammatory effects of trans-cinnamaldehyde on lipopolysaccharide-stimulated macrophage activation via MAPKs pathway regulation. Immunopharmacol Immunotoxicol 40(3):219–224
Kim TW (2022) Cinnamaldehyde induces autophagy-mediated cell death through ER stress and epigenetic modification in gastric cancer cells. Acta Pharmacol Sin 43(3):712–723
Lacombe E, Hawkins S, Van Doorsselaere J et al (1997) Cinnamoyl CoA reductase, the first committed enzyme of the lignin branch biosynthetic pathway: cloning, expression and phylogenetic relationships. Plant J 11(3):429–441
Langmead B, Salzberg SL (2012) Fast gapped-read alignment with Bowtie 2. Nat Methods 9(4):357–359
Lauvergeat V, Lacomme C, Lacombe E et al (2001) Two cinnamoyl-CoA reductase (CCR) genes from Arabidopsis thaliana are differentially expressed during development and in response to infection with pathogenic bacteria. Phytochemistry 57(7):1187–1195
Liu L, Stein A, Wittkop B et al (2012) A knockout mutation in the lignin biosynthesis gene CCR1 explains a major QTL for acid detergent lignin content in Brassica napus seeds. Theor Appl Genet 124(8):1573–1586
Lourenço A, Rencoret J, Chemetova C et al (2016) Lignin Composition and Structure Differs between Xylem, Phloem and Phellem in Quercus suber L. Front Plant Sci 7
Mateen S, Rehman MT, Shahzad S et al (2019) Anti-oxidant and anti-inflammatory effects of cinnamaldehyde and eugenol on mononuclear cells of rheumatoid arthritis patients. Eur J Pharmacol 852:14–24
Matsuno M, Compagnon V, Schoch GA et al (2009) Evolution of a Novel Phenolic Pathway for Pollen Development. Science 325(5948):1688–1692
Pan H, Zhou R, Louie GV et al (2014) Structural studies of cinnamoyl-CoA reductase and cinnamyl-alcohol dehydrogenase, key enzymes of monolignol biosynthesis. Plant Cell 26(9):3709–3727
Robert X, Gouet P (2014) Deciphering key features in protein structures with the new ENDscript server. Nucleic Acids Res 42(W1):W320–W324
Sattler SA, Walker AM, Vermerris W et al (2017) Structural and Biochemical Characterization of Cinnamoyl-CoA Reductases. Plant Physiol 173(2):1031–1044
Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22(22):4673–4680
Vanholme R, De Meester B, Ralph J et al (2019) Lignin biosynthesis and its integration into metabolism. Curr Opin Biotechnol 56:230–239
Wengenmayer H, Ebel J, Grisebach H (1976) Enzymic synthesis of lignin precursors. Purification and properties of a cinnamoyl-CoA: NADPH reductase from cell suspension cultures of soybean (Glycinemax). Eur J Biochem 65(2):529–536
Xu Z, Zhang D, Hu J et al (2009) Comparative genome analysis of lignin biosynthesis gene families across the plant kingdom. BMC Bioinformatics 10:11
Zhou R, Jackson L, Shadle G et al (2010) Distinct cinnamoyl CoA reductases involved in parallel routes to lignin in Medicago truncatula. Proc. Natl. Acad. Sci. U. S. A. 107(41): 17803–17808

SupplementaryInformation.docx

Download PDF

Version 1

posted

You are reading this latest preprint version

Identification of a Cinnamoyl-CoA Reductase Involved in Cinnamaldehyde Biosynthesis from Cinnamomum cassia

Status:

Version 1

Abstract

Figures

Introduction

Materials and methods

Plant materials and compound standards

Total RNA extraction, cDNA library construction and sequencing

De novo transcriptome assembly

Functional annotation and classification of unigenes

Enzyme assay activity of CcCCR1 and AtCCR1

Molecular docking

RESULTS

Enzymatic kinetic parameters

Molecular docking

Discussion

Conclusion

Declarations

References

Supplementary Files

Status:

Version 1