2.1 Treatment of the animals
Fifty-six male Wistar rats, aged 2–3 months and weighing 160–180 g, were provided by Shanxi Medical University Experimental Animal Center (Shanxi, China). The rats were maintained in ventilated cages with free access to standard chow and water. All experiments were granted approval by the Animal Ethics Committee of Shanxi Medical University. The experiments were performed in strict accordance with national and international guidelines of laboratory animal care. The rats were divided at random into seven groups, which included the control group, 4 weeks ovalbumin (OVA) treatment group (model, ICG001, and budesonide), and 8 weeks OVA group (model, ICG001, and budesonide). Except for the control group, all rats were sensitized by the intraperitoneal (i.p.) injection of 10% OVA suspension containing l00 mg OVA (Sigma Corporation, USA) and 100 mg aluminum hydroxide powder (Chemical Reagent Factory, Tianjin, China) on day 1 and day 8. Beginning on day 15, the rats were challenged by inhaling 1% OVA daily (20 min each time) for 2 successive weeks (i.e., 4 weeks group) or 6 successive weeks (i.e., 8 weeks group). One-half hour before each OVA exposure, the model group rats were given distilled water (0.16 mL) by i.p. injection, the budesonide group rats were administered budesonide (0.5 mg; AstraZeneca Company, Australia) by aerosol inhalation twice daily (10 min each time), and the rats in the ICG001 group were subcutaneously administered ICG001 (5 mg/kg; Selleck Chemicals, USA). Control animals were sensitized and challenged by the same procedures with normal saline instead of OVA. All rats were anesthetized by an i.p. injection of 25% urethane (4 mL/kg, i.p.) and euthanized within 24 hours of the last challenge. The experiments were conducted with single-blinded analysis.
2.2 Histological study of lung tissue
The lower right lobe of the lung from each rat was removed for histological analysis. Paraffin-embedded tissue sections underwent hematoxylin and eosin staining and Masson’s trichrome staining. The sections were observed under light microscopy (100× magnification) to evaluate changes in airway inflammation and airway remodeling and to evaluate fibrosis. On each slide, a minimum of 10 bronchioles with an inner diameter of 150–200 μm were chosen. The thicknesses of the airway wall (Wat) and airway smooth muscle (Wam) were determined by morphometric analysis of transverse sections. The BI2000 medical image analysis system was used to evaluate airway remodeling.
2.3 Bronchoalveolar lavage fluid and cell counts
After euthanizing the animals, the left lung of each rat was lavaged three times with 1 mL of sterile saline, at a recovery rate of 80%. The recovered saline was centrifuged at 2000 revolutions per minute for 10 minutes. The supernatant was refrigerated at –80°C to measure the cytokines. Wright stain was used for counting the total cells and eosinophil (EOS) cells in bronchoalveolar lavage fluid (BALF) with the assistance of a light microscope at 400× magnification and a hemocytometer.
2.4 Enzyme-linked immunosorbent assay
In addition to collecting BALF, approximately 5 mL of whole blood was collected by cardiac puncture. The blood samples were then centrifuged (at 2000 revolutions per minute for 10 minutes at 4°C). Sera were obtained and stored at –80°C for enzyme-linked immunosorbent assay (ELISA) testing. TGF-β1, interleukin (IL)–17, IL–10, and IL–35 secretion in the sera and BALF were measured with an ELISA-kit (eBioscience, USA), based on the manufacturer’s instructions.
2.5 Immunohistochemical analysis
Immunohistochemistry was performed using SABC anti-mouse reagent (Boster Biological Company, Wuhan, China). The primary antibodies were mouse anti-rat E-cadherin (sc–59778), α-smooth muscle actin (α-SMA) (sc–53142), and fibronectin (Fn) antibody (sc18825) (1:100, SantaCruz Company, USA). The secondary antibody was biotinylated goat anti-mouse immunoglobulin G (IgG) antibody (sc–2039; Abcam, USA). All sections were added to the SABC reagent to amplify the reaction, and then stained with diaminobenzidine at room temperature. A light microscope was employed to observe the slices at 400× magnification. Positive areas were brown. For all slices, the mean optical density (OD) was detected by using the BI2000 medical image analysis system.
2.6 Cell culture and treatment
Alveolar type II epithelial cells (RLE–6TN) and lung fibroblast cells (CCC-REPF–1) were maintained in Dulbecco’s Modified Eagle’s Medium/Ham’s F12 medium (Invitrogen, USA) supplemented with 100 U/mL penicillin, 100 μg/mL gentamicin, and 10% fetal calf serum (FCS) (Invitrogen, USA) at 37°C in 5% CO2.
In the TGF-β1 treatment experiments, subconfluent cultures of RLE–6TN and CCC-REPF–1 cells were rinsed with phosphate-buffered saline (PBS) (Invitrogen) and treated with 5 μg/L TGF-β1 (Biosource, USA) in the presence or absence of ICG–001 5 μM. After 24 hours had elapsed, the cells were collected for experimentation.
2.7 Cell counting kit–8 assay
Cultured CCC-REPF–1 cells were seeded into 96-well plates (5×103 cells/well), and 10 μL cell counting kit–8 (CCK–8) was added to each well. After 1 hour of incubation, the absorbance of each well was measured at 450 nm by using a spectrophotometer. Each group had six duplicates.
2.8 Western blot analysis
Cultured RLE–6TN cells were washed, and then pelleted in phosphate-buffered saline (PBS) at 2000 revolutions per minute for 5 minutes. Each cell pellet contained 2×105 cells. The cell pellet was subjected to protein extraction by using a cell lysis buffer. The lung tissues were homogenized, incubated in the lysis buffer, added to a protease inhibitor cocktail, and then centrifuged to obtain extracts of lung proteins. A BCA protein assay kit (ThermoFisher Scientific, USA) was used to measure protein concentration. The samples were loaded with sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto a polyvinylidene fluoride (PVDF) membrane (Millipore Company, USA). The membranes were blocked with 5% skim milk in PBS at 37°C for 2 hours, and then incubated with the appropriate primary antibodies overnight at 4°C to assess the protein levels of E -cadherin, Fn, and α–SMA (1:1500; SantaCruz Biotechnologies, USA). The membranes were washed and exposed to their respective horseradish peroxidase conjugated goat anti-mouse IgG (1:1000; sc2031; SantaCruz Company, USA) for 2.5 hours at room temperature. The labeled band was detected using an enhanced chemiluminescence detection kit (invitrogen, USA). The loading control was β-actin. The experiment was repeated three times.
2.9 Reverse transcription-polymerase chain reaction analysis
Total RNA was isolated and purified from cells by using TRIzol Reagent (invitrogen, USA). Complementary deoxyribonucleic acid (cDNA) was synthesized by using GoScript™ Reverse Transcription System (Promega, USA). The primers used were as follows:
(1) Snail
forward: 5′-CTTGTGTCTGCACGACCTGT–3′;
reverse: 5′-CTTCACATCCGAGTGGGTTT–3′;
(2) MMP–7
forward: 5′-CGGAGATGTTCACTTTGACA–3′;
reverse: 5′-AAGAGTGACCCAGACCCAGA–3′;
(3) α-SMA
forward: 5′- AGCCAGTCGCCATCAGGAAC–3′;
reverse: 5′- GGGAGCATCATCCCAGCAA –3′;
(4) Collagen-I
forward: 5′- GACATGTTCAGCTTTGTGTACCTC–3′;
reverse: 5′-GGGACCCTTAGGCCATTGTGA –3′;
(5) Collagen-III
forward: 5′- TTTGGCACAGCAGTCCAATGTA–3′;
reverse: 5′- GACAGATCCCGAGTTCGCAGA–3′;
(6) β-Actin
forward: 5′-GATTACTGCTCTGGC TCCTAGCA- 3′;
reverse: 5′-GCCACCGATCCACACAGAGT –3′;
(7) Glyceraldehyde 3-phosphate dehydrogenase
forward: 5′- GGTGCTGAGTATGTCGTGGAGT–3′;
reverse: 5′-CAGTCTTCTGAGTGGCAGTGAT–3′;
(8) RN-ACTB:
forward: 5′- TGTCACCAACTGGGACGATA–3′;
reverse: 5′-GGGGTGTTGAAGGTCTCAAA–3′.
The PCR conditions were as follows: initial denaturation at 95°C for 10 minutes, followed by 40 cycles consisting of denaturation at 95°C for 10 seconds, primer annealing at 50°C for 20 seconds, and extension at 72°C for 20 seconds.
2.10 Statistical methods
The data are expressed as the mean ± the standard deviation (SD) with n representing the number of independent experiments. Statistical analysis was conducted using SPSS19.0 software. All data were tested for normality with the K-S test and tested for homogeneity of variance with the Levene test. Groups were statistically compared by using one-way analysis of variance (ANOVA), followed by least significant difference (LSD), or compared by using Kruskal–Wallis testing, followed by Tamhane’s T2 test. Values of P < 0.05 were statistically significant.