Cell lines
Wild type (AG10076) and XP-C (GM15983) immortalized patient derived-fibroblasts were purchased from Coriell Biorepository (Coriell Institute, New Jersey, USA). The cells were cultured in DMEM high glucose, GlutaMAX media (Gibco, Massachusetts, USA) supplemented with 10% FBS and 1% penicillin/streptomycin at 37°C in a 5% CO2 incubator.
siRNA Kinome Targeting Library
A siRNA library targeting all human kinases (Qiagen, Hilden, Germany) was utilized. The library consists of two siRNAs targeting each individual 646 human kinase hence 1292 siRNAs. The library was screened in 96 well plates with one siRNA transfected per well at a final concentration of 5nM. Lipofectamine RNAiMax (Thermofisher scientific, Massachusetts, USA) was utilized for the transfection.
The sequences of hit siRNAs are CGCGATCTAGTATATGTTTAA for LATS1 and TCGGTTGGTGCATCTAATGAA for PIK3C3.
UVB dose-response
The photosensitivity of XP-C cells as a function of increased UVB doses was examined and compared to that of WT cells. For that, cells were seeded in 96 well plates until 80% confluency, undergone washing with PBS then were subjected to increasing UVB doses. Twenty-four hours post UVB irradiation, cell viability was recorded by PrestoBlue (Thermofisher Scientific) according to the manufacturer’s suggestion. Data normalization was based on the calculation of the percentage of viability at each dose compared to the viability of control non-irradiated cells (dose zero) set as 100% of viability.
6-4PP DNA damage staining and quantification
DNA damage quantification was carried out by immune-staining the cells with an antibody against 6 − 4 PP (Cosmo Bio, California, USA) and secondary mouse AF488 (Invitrogen, California, USA). Cells were seeded until confluency then subjected to UVB irradiation at 0.03J/cm2. Twenty hours post irradiation the cells were stained according to previous protocol (25). Image acquisition was carried out at 10X magnification followed by quantification by Cell-Insight NXT.
EdU incorporation-cell proliferation assay
To quantify the effect of transfection on cell proliferation, both cell lines were cultured in 6-well plates and transfected with either siAS, siLATS1 or siPIK3C3. Forty- eight hours post transfection the cells were irradiated at 0.02J/cm2 then incubated for respective times in the presence of EdU. The cells were further on collected, stained according to the manufacturer’s protocol and analyzed by flow cytometry (BD LSRII flow cytometer, BD Biosciences). Post analysis was carried out by flowing software (26) (Turku Bioimaging, Finland).
Cell death quantification
48hrs post transfection, cells in 6 well plates were irradiated then incubated with both CellEvent (Thermofisher Scientific, Massachusetts, USA), caspase 3/7 activity probe, and PI. Cells were further on collected and analyzed by flow cytometry (BD LSRII flow cytometer, BD Biosciences) twenty-four hours post irradiation at 0.02J/cm2 and 0.1J/cm2 for XP-C and WT cells respectively. Additional analysis was carried out by flowing software (26) (Turku Bioimaging).
qRT-PCR
Total RNA was isolated using RNeasy plus mini kit (Qiagen) then quantified using Nanodrop 1000. 1µg of RNA was reverse transcribed to cDNA using the SuperScript iV VILO Master Mix (Invitrogen). Next, 5µL of cDNA (5ng/µL) was used in qPCR reactions with gene-specific primers targeting XPC, PIK3C3, LATS1, FOXN1 and GAPDH (Qiagen). qPCR was performed by Platinum SYBER Green qPCR SuperMix-UDG (Invitrogen). Samples were run in triplicates through BioRad CFX96™ Real-time Sys (C1000 Touch™ Thermal Cycler). Relative expression levels were calculated based on the 2-ΔΔCT method reported Livak et al.(27).
Protein extraction and Immunoblotting
Total proteins were extracted with RIPA buffer (Sigma Aldrich) supplemented with protease and phosphatase inhibitor. Western blotting was performed as previously described (28). Images were recorded using Biorad Molecular Imager® Chemi Doc™ XRS and analyzed using Image Lab™ software. For phosphorylation experiments, the membranes were stripped using ReBlot Plus Mild Antibody Stripping Solution (Merck, Darmstadt, Germany), washed, blocked with 5%BSA then re-incubated with primary Ab following the previous protocol.
Immunofluorescence and associated microscopy
For the translocation of YAP, both cell lines were seeded in 96 well microplates. WT and XP-C cells were transfected with either siAS or siLATS1 then irradiated at dose 0.02J/cm2. One hour post irradiation the cells were fixed then stained with anti-YAP antibody (Santa Cruz, Texas, USA). 2ry mouse-C5 antibody (Jacksons Lab, Maine, USA) was then incubated together with FITC-Phaloidine (Thermofisher Scientific, Massachusetts, USA). Nuclear DNA was counter-stained with Hoechst (Sigma-Aldrich, Missouri, USA). Cell images were acquired by the Zeiss LSM880 Microscope at 40X.
Statistical analysis
Screening hit selection and single cell analysis were carried out by R software (29). GraphPad Prism v.8 was used for statistical analysis.