Role of follicular CD8+ T cells labeled with B cell helper immunotypes in multiple sclerosis and a murine model

doi:10.21203/rs.3.rs-3305043/v1

Download PDF

Research Article

Role of follicular CD8+ T cells labeled with B cell helper immunotypes in multiple sclerosis and a murine model

https://doi.org/10.21203/rs.3.rs-3305043/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background

Multiple sclerosis (MS) has been considered to be a T cell-dependent autoimmune disease of the central nervous system (CNS), and so does the experimental autoimmune encephalomyelitis (EAE) model. Recent studies have revealed a specific subset of CD8 T cells, known as CD8 follicular T cells (CD8⁺CXCR5⁺ T), are involved in antiviral, anti-tumor immunity, and systemic autoimmunity. While the role of CD8⁺CXCR5⁺ T cells in MS and EAE remains unclear.

Methods

We detected CD8⁺CXCR5⁺ T cell frequency in the peripheral blood of relapsing-remitting MS patients and healthy controls by flow cytometry and analyzed its correlation with disease activity. To show the dynamic changes and locations of CD8⁺CXCR5⁺ T cells in secondary lymphoid organs and CNS from EAE mice, flow cytometry and multiplexed immunohistochemistry were performed. RNA-seq, co-culture experiments and in vivo adoptive transfer were then conducted to reveal the phenotypes and functions of CD8⁺CXCR5⁺ T cells.

Results

Expansion of CD8⁺CXCR5⁺ T cells in MS patients and EAE mice was detected during the acute phase. In relapsing MS patients, elevated frequencies of circulating CD8⁺CXCR5⁺ T cells were positively correlated with new gadolinium-enhancement lesions of CNS. In EAE mice, CD8⁺CXCR5⁺ T cells infiltrated in ectopic lymphoid structures of spinal cords and germinal centers of spleens were positively correlated with clinical score and highly expressed ICOS, CD40L, IL-21 and IL-6. In vitro co-culture experiments and CD8⁺CXCR5⁺ T-adoptive mice both confirmed the ability of CD8⁺CXCR5⁺ T cells to provide B cell help and contribute to disease progression.

Conclusions

CD8⁺CXCR5⁺ T cells which bridged cytotoxic T cells and B cells in MS might be a promising target for developing disease-modifying treatments in the future.

CD8+CXCR5+ T

EAE

ectopic lymphoid structures

B cell helper

Multiple sclerosis (MS) is a chronic inflammatory autoimmune disease that affects the central nervous system (CNS). The overreaction of the immune system and loss of immune tolerance are believed to contribute to the development of MS [1, 2]. Though CD4⁺ T subsets are typically considered to initiate the disease, CD8⁺ T cells which kill oligodendrocytes and neurons by the secretion of cytotoxic granules also play a key role [3]. In MS patients, there is an oligoclonal expansion of CD8⁺ T cells that outnumber CD4⁺ T cells in the inflamed plaques and cerebrospinal fluid (CSF) [4]. Recent studies have shown that a new subset of CD8 T cells that express CXCR5, a chemokine receptor, has diverse functional properties including B-cell helper, cytotoxic and regulatory features in different conditions [5, 6]. The role of CD8⁺CXCR5⁺ T cells in MS is still not clearly understood and requires further investigation [7].

Certain T cells, known as CD8⁺CXCR5⁺ T cells, possess the ability to enter B cell follicles and act as CD4 T follicular helper cells (Tfh) due to their similar priming process [7]. Tfh cells express high levels of the transcriptional factor Bcl-6 and costimulatory molecules ICOS, PD-1, and CD40L, which allows them to locate in the germinal center and promote a humoral immune response [8]. The existence of CD8⁺CXCR5⁺ T cells has been confirmed in human tonsils, primate and rodent lymphatic follicles, as well as a small population found in the blood [9, 10]. Although the role of CD8⁺CXCR5⁺ T cells in peripheral immune response has been the main focus, their presence in B cell follicles is noteworthy.

In our initial research, we discovered that Tfh cells can enhance the antibody production of B cells in a manner that relies on IL-21 and CD40L. This was observed in MOG_{35 − 55}-induced experimental autoimmune encephalomyelitis (EAE). Intriguingly, Tfh cells teamed up with B cells to form ectopic lymphoid structures (ELSs) in the CNS of EAE mice [11]. These ELSs were also present in secondary progressive MS and EAE mice, which allowed for the infiltration of CXCR5-positive cells [11–13]. CD8⁺CXCR5⁺ T cells could also migrate towards CXCL13, which was increased in the CSF of MS patients and in the CNS during relapsing EAE [14, 15].

Here, we have discovered the expansion of CD8⁺CXCR5⁺ T cells not only in the circulation of relapsing MS patients, but also in the secondary lymphoid organs and CNS of the EAE mice. These CD8⁺CXCR5⁺ T cells exhibit a distinct transcriptome and phenotype compared to CD8⁺CXCR5⁻ T cells, and display B cell-helper functions. Our in vitro and in vivo studies support the potential of targeting CD8⁺CXCR5⁺ T cell therapy, in addition to B-cell depletion treatments, in the future [16].

Ethics Statement

This study was carried out in accordance with the recommendations of “the Biomedical Research Guideline involving Human Participants, National Health and Family Planning Commission of China” with written informed consent from all subjects. All subjects gave written informed consent in accordance with the Declaration of Helsinki. The protocol was approved by the “Air Force Medical Center Ethical Review Board of Fourth Military Medical University.”

Study Population

Patients with relapsing-remitting MS (RR-MS) from August 2021 to September 2022 who fulfilled the 2017 McDonald’s diagnostic criteria in our hospital were enrolled [17]. A clinical relapse was defined as appearance of new neurological dysfunctions lasting over 24 hours (hrs) with new lesions on MRI scanning. A remission was considered as patients who had a stable condition for more than 1 month since the last relapse. EDSS score and gadolinium-enhanced foci were evaluated by another two attending physicians separately. Sex and age-matched healthy controls (HCs) were included.

EAE Induction

Female C57BL/6J mice at 6–8 weeks old were purchased from Experimental Animal Center of Air Force Military Medical University. EAE was induced with 200 ug MOG_{35 − 55} peptide (NJPeptide, China) emulsified in incomplete Freund’s adjuvant (Sigma - Aldrich, USA) added with 5 mg/mL Mycobacterium Tuberculosis H37RA (Difco, USA). Each mouse was immunized with the emulsion subcutaneously into four sites at the back followed by intraperitoneal injection of 200 ng pertussis toxin (List Biological Laboratory). The pertussis toxin was given again at day 2 post-immunization (p.i.). After immunization, clinical symptoms of the mice were assessed in a double-blind manner as previously performed: 0, no disease; 1, paralysis of tail; 2, ataxia or weakness of hind limb; 3, partial hind limb paralysis; 4, hind limb paralysis; 5, hind limb and partial forelimb paralysis; 6, moribund. All the experimental protocols were authorized by the Institutional Ethics Committee [11].

Mononuclear Cells Isolation

For relapsing MS patients, the blood sample was acquired before corticosteroid impulse therapy. Then the human peripheral blood mononuclear cells (PBMCs) were isolated with Ficoll-Paque medium (Dakewe, China) by gradient-density centrifugation at 2000 rpm for 30 min without acceleration and breaking.

For CNS mononuclear cells isolation, the brain and spinal cord of each EAE mouse were digested with collagenase Ⅱ (Sigma - Aldrich) and passed through the 70-um nylon mesh. After centrifugation at 2000 rpm for 10 min, cell pellets suspended with 30% Percoll were plated on 70% Percoll and centrifuged at 2000 rpm for 30 min without acceleration and breaking. Mononuclear cells at the 30/70 interface were obtained.

For isolation of mononuclear cells of mouse spleens and inguinal lymph nodes, the tissue homogenate was passed through 70-um nylon mesh and cell suspension from spleens was processed with mouse lymphocyte separation medium (Dakewe, China).

Flow Cytometry

For surface antigen staining, cell suspensions were incubated with fluorescent antibodies and the isotype controls. For intracellular staining, after cells stimulated with cell stimulation cocktail (eBioscience) for 4 h at 37 ℃, cell membranes were fixed and broken (BD Biosciences) following surface staining and then incubated with relevant antibodies. All the antibodies used during above staining were as follows: anti-human CD3-percp (UCHT1; Biolegend), anti-human CD4-FITC (OKT4; Biolegend), anti-human CD8a-FITC (RPA-T8; Biolegend), anti-human CXCR5-PE (J252D4; Biolegend), anti-human PD-1-allophycocyanin (EH12.2H7; Biolegend), and anti-mouse CD3-Pacific blue (17A2; Biolegend), anti-mouse CD4-FITC (GK1.5; Biolegend), anti-mouse CD8a-FITC (53 − 6.7; Biolegend), anti-mouse CXCR5-allophycocyanin (L138D7; Biolegend), anti-mouse PD-1-PE (29F.1A12; Biolegend), anti-mouse B220-FITC (RA3-6B2; Biolegend), anti-mouse GL7-allophycocyanin (GL7; Biolegend), anti-mouse CD107a-PE (1D4B; Biolegend), anti-mouse perforin-PE (S16009A; Biolegend), anti-mouse granzyme B-PE (QA16A02; Biolegend), anti-mouse ICOS-PE (15F9; Biolegend), anti-mouse CD40L-PE (SA047C3; Biolegend), anti-mouse IL-4-PE-Cyanine 7 (11B11; Biolegend), anti-mouse IL-6-PE (MP5-20F3; Biolegend), anti-mouse IL-21-PE (FFA21 ; Invitrogen).

Immunohistochemistry

For multiplexed immunohistochemistry, the mice were anesthetized and perfused transcardially with phosphate-buffered saline (PBS) and 4% paraformaldehyde. The spleens and spinal cords were dissected and cryo-protected in 30% sucrose followed by 10-um-thick sections preparation using a cryostat microtome. Processed sections were deparaffinized with xylenes, rehydrated with graded alcohols and rinsed with diH2O and 1X PBS. Antigen retrieval was performed in 1X Tris-EDTA pH9.0 in a microwave oven for 20 min. After the sections were cooled down, the tissues were incubated with 3% H₂O₂ for 15 min at room temperature (RT) and followed by blocking with blocking/antibody diluent (Akoya Biosciences) for 10 min at RT. Then the sections were stained with rabbit anti-mouse CD8a (1:2000; Abcam) at 4℃ overnight followed by brief wash in 1X PBST and horseradish peroxidase (HRP)-conjugated secondary antibody orderly. Then the sections were incubated with Opal570 (Akoya Biosciences) for 10 min at RT. Subsequently, the processes for antigen retrieval, blocking and antibody incubation were repeated 3 times as the first circle. And the primary antibodies and the related Opal fluorophores were incubated in the following order: rabbit anti-mouse CXCR5 (1:1000; Novus) with Opal620 (Akoya Biosciences), rabbit anti-mouse CD4 (1:2000; Abcam) with Opal520 (Akoya Biosciences), rabbit anti-mouse NK1.1 (1:100; Abcam) with Opal650 (Akoya Biosciences) and rabbit anti-mouse CD20 (1:1000; Servicebio) with Opal690 (Akoya Biosciences). After washing in the PBST, the sections were incubated with DAPI for 5 min at RT and mounted with prolong antifade mountant. Multispectral images were acquired with a Vectra 3.0 Automated Quantitative Pathology Imaging System and quantification analysis was conducted with InForm Advanced Image Analysis Software (PerkinElmer).

For simple immunohistochemistry, spinal cord sections were prepared like above. Then sections were incubated with rabbit anti-mouse CXCR5 (1:1000; Novus) and rabbit anti-mouse CXCL13 (1:500; Abcam) respectively at 4℃ overnight, followed by incubation with HRP-conjugated secondary antibody, diaminobenzidine and hematoxylin in order. Images were acquired with ZYScanner.

RT-qPCR

Total RNA of the mononuclear cells from CNS or from PBMC of patients was extracted and cDNA was synthesized with 1st strand cDNA synthesis supermix (Hifair). RT-qPCR was performed using SYBR master mix (Hifair) according to the instructions: 95℃ for 2 min, followed by 40 cycles at 95℃ for 10 s and 60℃ for 30 s. The expression level of target genes was assessed by normalization to β-actin. Primers used in this section were as follows: β-actin (forward primer, CACGAAACTACCTTCAACTCC; reverse primer, CATACTCCTGCTTGCTGATC), cxcl13 (forward primer, GGCCACGGTATTCTGGAAGC; reverse primer, GGGCGTAACTTGAATCCGATCTA), cxcr5 (forward primer, ATAGGCACCAGCACAAACCT; reverse primer, CTGTAGGGGAATCTCCGTGC).

Cell Sorting and Culturing

For best sorting of CD8⁺CXCR5⁺ T cells, spleens of mice at peak EAE and control group were dissected and prepared into mononuclear cell suspension. Negative isolation for enriching CD8⁺ T cells was adopted by the mouse CD8 T cell isolation kit (Biolegend). Then the CD8⁺ T cells were incubated with allophycocyanin-conjugated anti-CXCR5 antibody (Biolegend) and anti-allophycocyanin microbeads (Biolegend) consecutively to enrich CXCR5 positive and CXCR5 negative CD8⁺ T cells separately.

To determine the cytotoxicity of CXCR5 positive or negative CD8 T cells, 1 x 10⁴ mouse oligodendrocyte precursor cells (MOPC) re-suspended in Dulbecco's modified Eagle's medium (Invitrogen, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum, 2 mM l-glutamine, 100 IU/mL penicillin, and 100 mg/mL streptomycin sulfate were co-cultured with splenic CD8⁺CXCR5⁺ T, CD8⁺CXCR5⁻ T cells or not (CD8 : MOPC = 0.5, 1, 2 and 4) in the presence of IL-2 (250 IU/mL, Peprotech, USA). After 6 hours, the lysis rate of MOPC was calculated through remaining viable target cells by CCK-8 assay.

For T-B co-culture experiment, 4 x 10⁴ splenic B cells from EAE or control mice were cultured alone, or with 1 x 10⁴ splenic CD8⁺CXCR5⁺ T or CD8⁺CXCR5⁻ T cells derived from EAE mice or control mice in the presence of 1 µg/mL MOG_{35 − 55} alone. An irrelevant peptide (1 µg/mL) was used as control for antibody specificity test. After 5 days, the culture supernatant was collected and the titer of anti-MOG_{35 − 55} antibody was quantified by chemiluminescent enzyme-linked immunosorbent assay (CLISA).

Autoantibody Detection

Enzyme-linked immunosorbent assay (ELISA) was applied to detect serum MOG_35–55-specific antibody. 10 µg/mL MOG_35–55 peptide was pre-coated into the 96-well transparent microplates at 4℃ overnight and subsequently blocking the plates with 3% bovine serum albumin for 1h. Then the plates were incubated with 100µL serum samples from different groups of mice (1/100 dilution) at 37℃ for 1h and followed by PBST wash three times and horseradish peroxidase-conjugated goat anti-mouse IgG for 1h at 37℃. After last three wash, the plates were added with tetramethylbenzidine and read at 450 nm.

CLISA, similar to conventional ELISA except for the substrate solution, was used to detect MOG_35–55-specific antibody in cell culture supernatant because of the low titer of the antibody. After adding the Lumigen PS-atto substrate (Lumigen, Inc., Southfield, MI, USA), the chemiluminescence intensity was monitored using a luminescence reader (GENios, Tecan Group Ltd., Männedorf, Switzerland).

Serum Cytokine Detection

Mouse serum IL-6 and IL-21 concentrations were detected with the appropriate ELISA kits (Elabscience Biotechnology Co. Ltd, Wuhan, China).

RNA Sequencing

Total RNA was extracted from sorted splenic CD8⁺CXCR5⁺ and CD8⁺CXCR5⁻ T cells using TRIzol Reagent (Invitrogen) according to the manufacturer’s instructions. Qualified RNAs were quantified and used for stranded RNA sequencing library preparation with KC™ Stranded mRNA Library Prep Kit for Illumina. And sequencing was supported by BGI DNBSEQ - T7 at Seqhealth Technology Co., Ltd (Wuhan China). Trimmed clean data were mapped to the GRCm38 mice genome (ftp://ftp.ensembl.org/pub/release-87/fasta/mus_musculus/dna/) by STAR software (version 2.5.3a). Genes differentially expressed between groups were identified using the edgeR package (version 3.12.1) and a p-value cutoff of 0.05 with a fold-change cutoff of 2 was used to judge the statistical significance. Gene ontology (GO) analysis and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis were both implemented by KOBAS software (version 2.1.1) with a p-value cutoff of 0.05 to judge statistically significant enrichment.

Adoptive Cell Transfer

The donor mice chosen from EAE mice at peak phase were sacrificed and splenocytes were extracted. The splenocytes were cultured for 3 days in the presence of 10 µg/mL MOG_{35 − 55}. CD8⁺CXCR5⁺ T cells and CD8⁺CXCR5⁻ T cells were magnetically isolated, then 3 x 10⁵ CD8⁺CXCR5⁺ T cells or CD8⁺CXCR5⁻ T cells were injected into pre-immunized recipient mice through the tail vein at day 2 p.i.. The disease score was measured daily in a double-blind manner.

Statistics

Statistical analyses were performed with GraphPad Prism 8.0 (GraphPad Software, USA). The Kruskal-Wallis H test was used to compare the age among relapsing MS patients, remitting MS patients and HCs. Mann-Whitney U test was used to assess the difference of onset age, disease duration and EDSS score among the three groups. Fisher’s exact test was applied in the comparison of the ratio of females. For statistical analysis of multiple groups, one-way or two-way ANOVA was used to compare the differences. Nonparametric Spearman rank analysis was used to assess the correlation between two variables. A P value < 0.05 was considered statistically significant in all analyses.

Demographic and clinical characteristics of the relapsing-remitting MS patients and HCs

29 MS patients (15 relapsing patients, 14 remitting patients) and 13 HCs were enrolled in this study, as shown in Table 1. No statistical differences in the age and female ratio among groups. There were also no significant differences in the onset age and disease duration between relapsing and remitting MS patients. The EDSS score of the relapsing MS patients was slightly higher than the remitting MS patients, but there was no significant difference (P > 0.05).

Table 1

Demographic and clinical characteristics of the relapsing-remitting MS patients and HCs
Variable	Relapsing MS (n=15)	Remitting MS (n=14)	HCs (n=13)	P value
Age (years)	37 [26-51]	35.5 [17-52]	29 [16-48]	0.309
Female, no. (%)	11 (73.3)	10 (71.4)	9 (69.2)	1.000
Onset age (years)	34 [22-46]	29.5 [16-38]	NA	0.196
Disease duration (years)	2.3 [0.2-16]	3.2 [0.3-16]	NA	0.776
EDSS	3.0 [1.0-9.0]	2.5 [0-4]	NA	0.235
MS, multiple sclerosis; HCs, healthy controls; EDSS, Kurtzke’s Expanded Disability Status Scale; NA, not applicable. Data are presented as number (percentage) or median [range]. Differences among relapsing MS, remitting MS and HCs were analyzed by Kruskal-Wallis test (age), Chi-square test (female ratio), Mann-Whitney U test (onset age, disease duration, and EDSS). P value < 0.05 was considered statistically significant.

Increased circulating CD8 ⁺ CXCR5 ⁺ T cells positively correlated with new gadolinium enhancements in the relapsing MS patients

In this study, blood samples from MS patients and HCs were collected and peripheral blood mononuclear cells were isolated timely. According to the gating strategy as previously reported (Fig. 1A) [11, 18], the CD8⁺CXCR5⁺ T cells, CD8⁺CXCR5⁻ T cells, CD8⁺CXCR5⁺PD-1⁺ T cells, CD8⁺CXCR5⁻PD-1⁺ T cells and Tfh cells (CD4⁺CXCR5⁺PD-1⁺) were evaluated by flow cytometry. The percentages of CD8⁺CXCR5⁺ T, CD8⁺CXCR5⁻ T and Tfh cells were significantly higher in the relapsing MS patients (P < 0.05). The numbers of the three subsets showed the same trends. While in the remitting phase, CD8⁺CXCR5⁺ T cell frequency and cell number did not decrease as sensitively as CD8⁺CXCR5⁻ T (P < 0.001 for number) or Tfh cells (P < 0.05 for frequency). Like Tfh cells, both CD8⁺CXCR5⁺PD-1⁺ T and CD8⁺CXCR5⁻PD-1⁺ T cells had similar dynamic changes as the condition fluctuated despite no statistical difference (Fig. 1B). In addition, CD8⁺CXCR5⁺ T and CD8⁺CXCR5⁺PD-1⁺ T cells showed very similar changes both in the proportion and cell number during relapsing and remitting phases. Further correlation analysis also showed great positive correlations between CD8⁺CXCR5⁺ T and CD8⁺CXCR5⁺PD-1⁺ T cells (“r = 0.8693, P < 0.0001” for frequency, “r = 0.9153, P < 0.0001” for cell number) (Fig. 2A, Figure S1A). What’s more, significant correlations of both CD8⁺CXCR5⁺ T cell frequency with CD8⁺CXCR5⁻ T cell frequency (r = 0.6553, P = 0.0001) and CD8⁺CXCR5⁺ T cell number with CD8⁺CXCR5⁻PD-1⁺ T cell number (r = 0.5607, P = 0.0066) were observed. While, there were no significant differences in the proportion and cell number of CD8⁺CXCR5⁺ T cells with Tfh cells. In terms of disease severity, CD8⁺CXCR5⁺ T cells showed no remarkable correlations with EDSS score (“r = 0.1826, P = 0.3431” for frequency, “r = 0.2365, P = 0.2350” for cell number) (Fig. 2B, Figure S1B). But unexpectedly, there were significant correlations between CD8⁺CXCR5⁺ T cells and central nervous system (CNS) new gadolinium enhancements of relapsing patients (“r = 0.6878, P = 0.0373” for frequency, “r = 0.7504, P = 0.0189” for cell number) (Fig. 2C, Figure S1C). The results suggest that increased circulating CD8⁺CXCR5⁺ T cells in relapsing MS patients might be involved in disease progress and indicate the newly developed demyelinations in CNS.

CD8 ⁺ CXCR5 ⁺ T cells localized into germinal centers and spinal cords which correlated with clinical score of EAE mice

To discover the role of CD8⁺CXCR5⁺ T cells in EAE mice, its dynamic changes in frequency and morphology in secondary lymphoid organs (SLOs) and central nervous system (CNS) were examined. First, the EAE model was induced in C57BL/6J mice and the clinical score was divided into four phases according to the days post immunization (dpi): pre-EAE phase (5–7 dpi, score 0), peak-EAE phase (15–21 dpi, score 4-4.5), remission phase (22–28 dpi, score 1.5–2.5), and chronic phase (35–45 dpi, score 2–3) (Fig. 3A). Then the dynamic changes of CD8⁺CXCR5⁺ T cells in spleens, inguinal lymph nodes (LN) and CNS of EAE mice at different phases were detected by flow cytometry. CD8⁺CXCR5⁺ T cell frequencies all increased notably at the peak phase and declined during the remission phase. In the chronic phase, the proportion increased again (Fig. 3B-E). Such changes in the CNS and the spleens were very similar. Meanwhile, CD8⁺CXCR5⁺ T cells in LN seemed to increase more sensitively before the onset. PD-1-expressing CD8⁺CXCR5⁺ T cells in the CNS were also analyzed. The subtype changes were in conformity with CD8⁺CXCR5⁺ T cells and a good correlation was observed (Figure S2A, B).

The germinal center is critical for B cell maturation and high-affinity antibody production. Previous studies pointed Tfh cell which is a powerful helper for B cell activation and differentiation localized at the T-B border or resided in the light zone [11, 19]. The present results showed CD8⁺CXCR5⁺ T cells localized into the germinal center and expanded within the B cell follicles of EAE mice (Fig. 4A). Additionally, most CD8 T cells were located alongside CD4 T cells. The data suggest CD8⁺CXCR5⁺ T cells could also be involved in B cell regulation.

In line with early reports concerning about CXCL13 in the CNS of EAE mice [15, 20], we also found dramatically upregulated CXCL13 and CXCR5 in the CNS (Figure S3B). CXCR5 positive cells were recruited to areas with high levels of CXCL13 (Figure S3A). Further multiplex immunofluorescence staining revealed aggregations of CD8⁺CXCR5⁺ T cells in the spinal cords of EAE mice during the peak phase, particularly at sites where immune cells had infiltrated (Fig. 4B). CD8 T cells and CD4 T cells were found in close proximity in the spinal cord. And a small portion of CD8⁺CXCR5⁺ T cells were observed near CD20-positive cells. Meanwhile, flow cytometry analysis showed a positive correlation between the frequency of CD8⁺CXCR5⁺ T cells in the CNS and Tfh cells, germinal center (GC) B cells, as well as clinical scores of EAE mice respectively (“r = 0.8218, P < 0.0001” for Tfh cell, “r = 0.5128, P = 0.0147” for GC B cell, “r = 0.6820, P = 0.0481” for EAE score) (Fig. 4C-E). These findings suggest CD8⁺CXCR5⁺ T cells may contribute to disease progression in EAE by proliferating in follicles or ectopic lymphoid structures, and participating in humoral immunity.

Tfh-like helper functions, but not enhanced cytotoxicity of CD8⁺CXCR5⁺ T cells in EAE

Previous studies in cancers, chronic infections and autoimmune diseases have indicated diverse properties of CD8⁺CXCR5⁺ T cells including cytotoxic, regulatory-like and B-cell helper functions [21–23]. But the features of this CD8 subset in EAE remain elusive. To clarify this, RNA sequencing was performed on sorted splenic CD8⁺CXCR5⁺ T cells and CD8⁺CXCR5⁻ T cells from EAE mice in peak phase and contemporaneous control mice. The gene expression pattern of CD8⁺CXCR5⁺ T cells in both the EAE and control group was distinct from that of CD8⁺CXCR5⁻ T cells. Pathway analysis of differential upregulated gene profiles revealed that in EAE mice, the differential gene expression was mainly associated with rheumatoid arthritis, B cell receptor signaling pathway, intestinal immune network for IgA production and NF-kappa B signaling pathway (Fig. 5B). While in the control group, the differential gene expression was mainly associated with NF-kappa B signaling pathway, Fc gamma R-mediated phagocytosis, PI3K-Akt signaling pathway and Calcium signaling pathway (Fig. 5A). The differences between CD8⁺CXCR5⁺ T cells in EAE mice and the control group were further analyzed. Pathway analysis of differential upregulated gene profiles showed genes in CD8⁺CXCR5⁺ T cells of EAE were associated with rheumatoid arthritis, NF-kappa B signaling pathway and B cell receptor signaling pathway (Fig. 5C).

The most studied subset of CD8 T cells is the cytotoxicity T lymphocyte with the ability to kill target cells by perforin, granules and interferon-γ (IFN-γ) [24]. While under different conditions, CD8 T cells may acquire diverse functions. RNA sequencing revealed the functions associated with rheumatoid arthritis, B cell receptor signaling pathway, intestinal immune network for IgA production and NF-kappa B signaling pathway of CD8⁺CXCR5⁺ T cells in EAE, which implicated that CD8⁺CXCR5⁺ T cells may be involved in inflammatory process and humoral immune response. Further analysis of differential genes related to inflammation and humoral immunity showed CD8⁺CXCR5⁺ T cells from control mice expressed higher levels of cytotoxic granzyme A, granzyme B and inflammatory mediators like S100a9 and matrix metalloproteinases (MMPs) (Fig. 6A). In addition, this subset shared gene profile with Tfh cells such as higher levels of transcriptional factor Bcl6, follicular markers Pdcd1, Cd200, Cd40lg and lower levels of Ccr7. We also observed higher expression of pro-inflammatory cytokines Il4, Il15, Il18 and chemokines Ccl3, Ccl4, Cxcl9 and Cxcl10 (Fig. 6A). Interestingly, CD8⁺CXCR5⁺ T cells in control mice expressed higher Il10 than CD8⁺CXCR5⁻ T cells. All the above results suggested stronger cytotoxicity, immunomodulation and Tfh-like functions of CD8⁺CXCR5⁺ T cells than CD8⁺CXCR5⁻ T cells in the control group.

Partially consistent with the control mice, CD8⁺CXCR5⁺ T cells from EAE mice also expressed higher levels of Bcl6, Cd200 and lower levels of Eomes, Il7r and Ccr7 like Tfh cells. The expression of Il4, Il18 and chemokines Ccl3, Cxcl9 and Cxcl10 were also higher than CD8⁺CXCR5⁻ T cells (Fig. 6B). Unexpectedly, CD8⁺CXCR5⁺ T cells from EAE mice expressed higher CD177, which is important for neutrophil activation and transendothelial migration, than CD8⁺CXCR5⁻ T cells markedly (Fig. 6B). While, the expression of granzyme A and granzyme B were not different significantly. And the less expressed gene of effector marker Ctsw and Cd226 suggested CD8⁺CXCR5⁺ T cells might be less cytotoxic in EAE mice. To further characterize the functions of CD8⁺CXCR5⁺ T cells in EAE and control mice, flow cytometry was applied and the phenotype differences between CD8⁺CXCR5⁺ and CD8⁺CXCR5⁻ T cells were observed from control and EAE mice. First, under phorbol 12-myristate 13-acetate (PMA)-stimulated conditions, we observed higher frequencies of effector marker CD107a, perforin and granzyme B in CD8⁺CXCR5⁺ T cells compared with CD8⁺CXCR5⁻ T cells from control mice (Fig. 6C, D). While, CD8⁺CXCR5⁺ T cells in EAE mice expressed less perforin than CD8⁺CXCR5⁻ T cells significantly, albeit differences of CD107a and granzyme B expressions between CD8⁺CXCR5⁺ T cells and CD8⁺CXCR5⁻ T cells were similar in EAE mice compared with control. Co-culture mouse oligodendrocyte precursor cells with CD8⁺CXCR5⁺ T or CD8⁺CXCR5⁻ T cells from EAE mice in vitro showed lysis rates from both groups increased as the effect-target ratio increased. While CD8⁺CXCR5⁺ T cells did not show enhanced cytotoxicity than CD8⁺CXCR5⁻ T cells in EAE mice (Fig. 6E). The results suggested CD8⁺CXCR5⁺ T cells could be less effective in EAE conditions.

Second, the frequencies of ICOS and CD40L were higher in CD8⁺CXCR5⁺ T cells than in CD8⁺CXCR5⁻ T cells. Additionally, cytokines including IL-4, IL-6 and IL-21 were significantly increased in CD8⁺CXCR5⁺ T cells (Fig. 6C, D). IL-4 and CD40L were much higher in EAE mice. Meanwhile, sorted splenic CD8⁺CXCR5⁺ T cells from control or EAE mice were co-cultured with B cells from either control or EAE mice. Under MOG_{35 − 55} conditions, the level of anti-MOG_{35 − 55} autoantibody produced in the supernatant was measured by CLISA. The results showed that the levels of anti-MOG_{35 − 55} antibody were higher when B cells were co-cultured with CD8⁺CXCR5⁺ T cells from both the control and EAE groups, compared to B cells alone. This effect was particularly pronounced in the EAE group (Fig. 6F), suggesting CD8⁺CXCR5⁺ T cells from EAE mice could help antigen-sensitized B cells produce much more autoantibody through Tfh-like helper functions.

CD8⁺CXCR5⁺ T cells adoptive transfer aggravated EAE

To determine the role of CD8⁺CXCR5⁺ T cells in vivo, CD8⁺CXCR5⁺ T and CD8⁺CXCR5⁻ T cells sorted from EAE mice at peak phase were transferred into recipient mice at day 2 after the recipient mice immunized with MOG_{35 − 55} (Fig. 7A). Clinical scores of each mouse in four groups were evaluated daily following immunization for 40 days. Recipient mice that received CD8⁺CXCR5⁺ T cells showed an early onset of EAE and a more severe condition compared to PBS-treated mice and CD8⁺CXCR5⁻ T-adopted mice (Fig. 7B). Despite that there was no significant difference in the time for disease remission among the three EAE groups, CD8⁺CXCR5⁺ T-adopted mice were still more severe during the relapse phase. Both the average and accumulative scores of CD8⁺CXCR5⁺ T-adopted mice were the highest among the groups (Fig. 7C, D). In addition, more inflammation and demyelinating lesions in the spinal cord of CD8⁺CXCR5⁺ T-adopted mice were observed (Fig. 7E, F). The CD8⁺CXCR5⁺ T cells also led to higher levels of anti-MOG_{35 − 55} antibody, indicating their ability to boost humoral immunity in vivo (Fig. 7G). In accordance with cell stimulation assay, levels of IL-6 and IL-21 in the serum of CD8⁺CXCR5⁺ T-adopted mice were higher than the other two EAE groups (Fig. 7H), which supports the notion that CD8⁺CXCR5⁺ T cells could worsen the onset of EAE and increase disease severity by enhancing humoral immunity.

Our data clarified dynamic changes of CD8⁺CXCR5⁺ T cells in the peripheral blood of MS patients and their relation with demyelinations in the CNS of relapsing patients. We also provided insight into the frequency changes and distribution pattern of CD8⁺CXCR5⁺ T cells, as well as the potential involvement in promoting humoral immunity via increased expression of CD40L, ICOS and the secretion of IL-6 and IL-21 during the progression of EAE.

As the main effector cell to eradicate infected or tumor cells, CD8 T cell plays a key role through cytotoxic granules restricted to the extra-follicles [25]. In MS patients, CD8 T cells were also considered to be pathogenic for all CNS cells which expressed major histocompatibility complex class I molecules [26]. While, suppressive and regulatory roles of some CD8 subsets were still in debate [27, 28]. Recent studies in infections immunity revealed a small portion of CD8 T cells expressing CXCR5 could enter into the germinal center [9, 10]. In addition to the diverse capacity for virus control and Tfh cell regulation in different disease environments [21, 29], transcriptional program and differentiation factors showed the divergence of CD8⁺CXCR5⁺ T cells from classical CD8 T cells [9]. The CD8 T cell distributions also greatly affect its functions in specific conditions. Due to limited access to brain samples and secondary lymphoid organs of MS patients, this study focused on circulating CD8⁺CXCR5⁺ T cells which increased with disease recurrence and decreased with disease remission. The dynamic changes showed similarities among CD8⁺CXCR5⁺ T cells, CD8⁺CXCR5⁻ T cells and circulating follicular T helper cells (cTfh). The cTfh has been deemed as memory Tfh cells that express CXCR5 and PD-1 [30]. While circulating PD-1^hiCXCR5⁻ CD4 T cells can support local humoral immunity as cTfh [31]. Our report also showed that PD-1-expressing CD8⁺CXCR5⁺ T cells and CD8⁺CXCR5⁻ T cells both changed significantly with disease conditions. The marked correlation of CD8⁺CXCR5⁺ T cells with PD-1⁺CD8⁺CXCR5⁺ T cells prompted the latter as a major role of CD8⁺CXCR5⁺ T cells during MS recurrence. And similar to cTfh, CD8⁺CXCR5⁺ T cells are suggested to be involved in local autoantibody production [32]. In EAE mice, there were comparable dynamic changes in CD8⁺CXCR5⁺ T cells and PD-1⁺CD8⁺CXCR5⁺ T cells observed in the secondary lymphoid organs and CNS. It was noteworthy that the swift rise of CD8⁺CXCR5⁺ T cells in the inguinal lymph nodes before the onset of symptoms could be linked to a rapid activation of specific T-cells in the draining lymph nodes [33]. Even though none of the CD8⁺CXCR5⁺ T cells were found in the draining lymph nodes of non-obese diabetic and collagen-induced arthritis mouse models [34].

CXCR5 is a major marker of follicular B cells and is important for follicular homing T cells with B cell helper function [19]. These CXCR5-positive cells can be recruited by CXCL13 to form germinal centers. CD8⁺CXCR5⁺ T cells in this study mostly infiltrated in the dark zone of mouse spleens, indicating their regulation of B cells. Meanwhile, CD8⁺CXCR5⁺ T cells were first identified in the ectopic lymphoid structure-like areas, where CXCL13 and CXCR5 increased significantly in the spinal cord of EAE mice. The subset mainly bordered upon CD4 T cells and neared plasma cells partially. Upon further flow cytometry analysis, it was found that CD8⁺CXCR5⁺ T cells had positive relations with Tfh cells and activated B cells in the CNS. Based on these results, it is suggested that CD8⁺CXCR5⁺ T cells may be involved in disease development by regulating the activation of ectopic humoral immunity or the structure integrity [35].

Our study showed CD8⁺CXCR5⁺ T cells concentrated in pathways related to inflammation and B cells based on transcriptome and pathway analysis. Inflammation cytokines including IL-1β, TNF-α and IL-6 will be promoted after NF-κB signaling activation, which also involves production of MMPs leading to immune cells infiltration and EAE aggravation [36, 37]. Moreover, the noncanonical NF-κB signaling pathway is related to the maturation and activation of B cells [38]. In comparison to CD8⁺CXCR5⁻ T cells, CD8⁺CXCR5⁺ T cells in EAE mice had higher levels of IL-6, IL-18 and MMP9. Additionally, CD8⁺CXCR5⁺ T cells exhibited phenotypic features similar with Tfh cells due to expression of CD40L, ICOS and IL-21, which favor B cell helper function. This was supported by in vitro co-culture experiment with B cells. CD8⁺CXCR5⁺ T cells in EAE mice retained certain cytotoxicity but did not show an enhanced ability to destroy the oligodendrocytes. Meanwhile, the level of perforin was reduced under EAE conditions which may be related to the cell distribution. High level of BCL-6 and low level of CCR7 restricted CD8⁺CXCR5⁺ T cells in the dark zone and around T-B border. BCL-6 is an important transcription factor for Tfh cells and essential for germinal center formation [39]. However, it hinders the production of cytotoxicity, which may partly account for the location and function of CD8⁺CXCR5⁺ T cells [40]. Dysregulated humoral immune activation contributes to EAE progression except Th1/Th17-mediated pathogenic mechanisms [11, 41]. Our data further pointed out that CD8⁺CXCR5⁺ T cells adoption accelerated disease. Increased anti-MOG_{35 − 55} autoantibody and B cell helper cytokines including IL-6 and IL-21 suggested the Tfh-like functions of CD8⁺CXCR5⁺ T cells.

The study also has some limitations. On the one hand, access to enough CSF or brain samples of MS patients is difficult, so the role of CD8⁺CXCR5⁺ T cells in the CNS could not be clarified straightly. On the other hand, the mechanisms of autoantibody production promoted by CD8⁺CXCR5⁺ T cells through IL-6 and IL-21 directly or indirectly needs further study.

Considering the general therapeutic effect of targeting CD4 T cells and the good effect of targeting B cells in the clinic respectively [42], perhaps targeting CD8⁺CXCR5⁺ T cells would be beneficial for reducing humoral immune activation in MS patients. It is important to note that treatment regimens that do not target total CD8 T cells can help avoid the increased risk of infection. Our study extends the cognition of CD8 T cells in MS and provides a theoretical basis for future new therapy to the patients. Further study is needed to clarify the comprehensive mechanisms of CD8⁺CXCR5⁺ T cells in MS and discover a potential new disease-modifying therapy.

In summary, our data illustrated the elevated frequency, CNS-infiltration and B cell helper functions of CD8⁺CXCR5⁺ T cells in MS and EAE mice bridging a communication for cytotoxic T cells and B cells, which could further improve humoral immunopathogenesis of MS and provide a potential treatment target in addition to B cell-depletion therapy.

CNS

central nervous system

CSF

cerebrospinal fluid

CLISA

chemiluminescent enzyme-linked immunosorbent assay

EAE

experimental autoimmune encephalomyelitis

ELSs

ectopic lymphoid structures

ELISA

enzyme-linked immunosorbent assay

EDSS

Expanded Disability Status Scale

gene ontology

germinal center

Hrs

hours

HCs

healthy controls

HRP

horseradish peroxidase

IFN-γ

interferonγ

KEGG

Kyoto Encyclopedia of Genes and Genomes

multiple sclerosis

MOPC

mouse oligodendrocyte precursor cells

MMPs

matrix metalloproteinases

p.i.

post immunization

PBMCs

peripheral blood mononuclear cells

PMA

phorbol 12-myristate 13-acetate

room temperature

SLO

secondary lymphoid organ

Tfh

follicular T helper

Acknowledgements

We thank Jin-Tao Hu for his technical support with flow cytometry and data analysis.

Author Contributions

KY, CZ and JG designed the study. JDing and JZhang immunized the mice and performed the immunohistochemistry. DJ, SY and JW performed the flow cytometry. YS, YH and CHu performed cell-coculture experiments. XZ and JZ performed the ELISA and CLISA. TL, CHan and XQ took care of the mice. SZ and JL diagnosed RR-MS patients and followed up the patients. JDing and JZhang drafted the manuscript and figures.

Funding

This study was supported by National Natural Science Foundation of China (grant no. 81901226 to CZ, no. 82073154 to KY, and no. 82171339 to JG) and Key Research and Development Project of Shaanxi Province (grant no. 2022ZDLSF02-04 to JG)

Availability of data and materials

The datasets used and/or analyzed in the current study are available from the corresponding author upon reasonable request.

Ethics approval and consent to participate

All subjects gave written informed consent in accordance with the Declaration of Helsinki. The protocol was approved by the “Air Force Medical Center Ethical Review Board of Fourth Military Medical University.”

Consent for publication

Signed informed consent was received from all the patients including consent for publication.

Competing interests

The authors have declared no conflict of interests.

Dobson R, Giovannoni G. Multiple sclerosis - a review. Eur J Neurol. 2019;26(1):27–40.
Dendrou CA, Fugger L, Friese MA. Immunopathology of multiple sclerosis. Nat Rev Immunol. 2015;15(9):545–58.
Salou M, Nicol B, Garcia A, Laplaud DA. Involvement of cd8(+) t cells in multiple sclerosis. Front Immunol. 2015;6:604.
Salou M, Garcia A, Michel L, Gainche-Salmon A, Loussouarn D, Nicol B, et al. Expanded cd8 t-cell sharing between periphery and cns in multiple sclerosis. Ann Clin Transl Neurol. 2015;2(6):609–22.
Valentine KM, Hoyer KK. Cxcr5 + cd8 t cells: protective or pathogenic? Front Immunol. 2019;10:1322.
Yu D, Ye L. A portrait of cxcr5(+) follicular cytotoxic cd8(+) t cells. Trends Immunol. 2018;39(12):965–79.
Fousteri G, Kuka M. The elusive identity of cxcr5(+) cd8 t cells in viral infection and autoimmunity: cytotoxic, regulatory, or helper cells? Mol Immunol. 2020;119:101–05.
Breitfeld D, Ohl L, Kremmer E, Ellwart J, Sallusto F, Lipp M, et al. Follicular b helper t cells express cxc chemokine receptor 5, localize to b cell follicles, and support immunoglobulin production. J Exp Med. 2000;192(11):1545–52.
Perdomo-Celis F, Taborda NA, Rugeles MT. Follicular cd8(+) t cells: origin, function and importance during hiv infection. Front Immunol. 2017;8:1241.
Quigley MF, Gonzalez VD, Granath A, Andersson J, Sandberg JK. Cxcr5 + ccr7- cd8 t cells are early effector memory cells that infiltrate tonsil b cell follicles. Eur J Immunol. 2007;37(12):3352–62.
Guo J, Zhao C, Wu F, Tao L, Zhang C, Zhao D, et al. T follicular helper-like cells are involved in the pathogenesis of experimental autoimmune encephalomyelitis. Front Immunol. 2018;9:944.
Serafini B, Rosicarelli B, Magliozzi R, Stigliano E, Aloisi F. Detection of ectopic b-cell follicles with germinal centers in the meninges of patients with secondary progressive multiple sclerosis. Brain Pathol. 2004;14(2):164–74.
Magliozzi R, Howell O, Vora A, Serafini B, Nicholas R, Puopolo M, et al. Meningeal b-cell follicles in secondary progressive multiple sclerosis associate with early onset of disease and severe cortical pathology. Brain. 2007;130(Pt 4):1089–104.
Klimatcheva E, Pandina T, Reilly C, Torno S, Bussler H, Scrivens M, et al. Cxcl13 antibody for the treatment of autoimmune disorders. Bmc Immunol. 2015;16(1):6.
Bagaeva LV, Rao P, Powers JM, Segal BM. Cxc chemokine ligand 13 plays a role in experimental autoimmune encephalomyelitis. J Immunol. 2006;176(12):7676–85.
Zhao D, Zhao C, Lu J, Han Y, Sun T, Ren K, et al. Efficacy and safety of repeated low-dose rituximab therapy in relapsing-remitting multiple sclerosis: a retrospective case series study. Mult Scler Relat Disord. 2023;70:104518.
Thompson AJ, Banwell BL, Barkhof F, Carroll WM, Coetzee T, Comi G, et al. Diagnosis of multiple sclerosis: 2017 revisions of the mcdonald criteria. Lancet Neurol. 2018;17(2):162–73.
Shen J, Luo X, Wu Q, Huang J, Xiao G, Wang L, et al. A subset of cxcr5(+)cd8(+) t cells in the germinal centers from human tonsils and lymph nodes help b cells produce immunoglobulins. Front Immunol. 2018;9:2287.
Schaerli P, Willimann K, Lang AB, Lipp M, Loetscher P, Moser B. Cxc chemokine receptor 5 expression defines follicular homing t cells with b cell helper function. J Exp Med. 2000;192(11):1553–62.
Schropp V, Chunder R, Dietel B, Tacke S, Kuerten S. The presence of cerebellar b cell aggregates is associated with a specific chemokine profile in the cerebrospinal fluid in a mouse model of multiple sclerosis. J Neuroinflammation. 2023;20(1).
He R, Hou S, Liu C, Zhang A, Bai Q, Han M, et al. Follicular cxcr5- expressing cd8(+) t cells curtail chronic viral infection. Nature. 2016;537(7620):412–28.
Miles B, Miller SM, Folkvord JM, Levy DN, Rakasz EG, Skinner PJ, et al. Follicular regulatory cd8 t cells impair the germinal center response in siv and ex vivo hiv infection. Plos Pathog. 2016;12(10):e1005924.
Yang R, Masters AR, Fortner KA, Champagne DP, Yanguas-Casas N, Silberger DJ, et al. Il-6 promotes the differentiation of a subset of naive cd8 + t cells into il-21-producing b helper cd8 + t cells. J Exp Med. 2016;213(11):2281–91.
St PM, Ohashi PS. The roles of cd8(+) t cell subsets in antitumor immunity. Trends Cell Biol. 2020;30(9):695–704.
Fukazawa Y, Lum R, Okoye AA, Park H, Matsuda K, Bae JY, et al. B cell follicle sanctuary permits persistent productive simian immunodeficiency virus infection in elite controllers. Nat Med. 2015;21(2):132–39.
Höftberger R, Aboul-Enein F, Brueck W, Lucchinetti C, Rodriguez M, Schmidbauer M, et al. Expression of major histocompatibility complex class i molecules on the different cell types in multiple sclerosis lesions. Brain Pathol. 2004;14(1):43–50.
Ortega SB, Kashi VP, Cunnusamy K, Franco J, Karandikar NJ. Autoregulatory cd8 t cells depend on cognate antigen recognition and cd4/cd8 myelin determinants. Neurol Neuroimmunol Neuroinflamm. 2015;2(6):e170.
Kumar V. Homeostatic control of immunity by tcr peptide-specific tregs. J Clin Invest. 2004;114(9):1222–26.
Kim HJ, Verbinnen B, Tang X, Lu L, Cantor H. Inhibition of follicular t-helper cells by cd8(+) regulatory t cells is essential for self tolerance. Nature. 2010;467(7313):328–32.
He J, Tsai LM, Leong YA, Hu X, Ma CS, Chevalier N, et al. Circulating precursor ccr7(lo)pd-1(hi) cxcr5(+) cd4(+) t cells indicate tfh cell activity and promote antibody responses upon antigen reexposure. Immunity. 2013;39(4):770–81.
Caielli S, Veiga DT, Balasubramanian P, Athale S, Domic B, Murat E, et al. A cd4(+) t cell population expanded in lupus blood provides b cell help through interleukin-10 and succinate. Nat Med. 2019;25(1):75–81.
Chen Y, Yu M, Zheng Y, Fu G, Xin G, Zhu W, et al. Cxcr5(+)pd-1(+) follicular helper cd8 t cells control b cell tolerance. Nat Commun. 2019;10(1):4415.
Furtado GC, Marcondes MC, Latkowski JA, Tsai J, Wensky A, Lafaille JJ. Swift entry of myelin-specific t lymphocytes into the central nervous system in spontaneous autoimmune encephalomyelitis. J Immunol. 2008;181(7):4648–55.
Valentine KM, Mullins GN, Davalos OA, Seow LW, Hoyer KK. Cd8 follicular t cells localize throughout the follicle during germinal center reactions and maintain cytolytic and helper properties. J Autoimmun. 2021;123:102690.
Kang YM, Zhang X, Wagner UG, Yang H, Beckenbaugh RD, Kurtin PJ, et al. Cd8 t cells are required for the formation of ectopic germinal centers in rheumatoid synovitis. J Exp Med. 2002;195(10):1325–36.
Zhou C, Liang T, Jiang J, Chen J, Chen T, Huang S, et al. Mmp9 and stat1 are biomarkers of the change in immune infiltration after anti-tuberculosis therapy, and the immune status can identify patients with spinal tuberculosis. Int Immunopharmacol. 2023;116:109588.
Liu X, Zhang X, Niu X, Zhang P, Wang Q, Xue X, et al. Mdivi-1 modulates macrophage/microglial polarization in mice with eae via the inhibition of the tlr2/4-gsk3beta-nf-kappab inflammatory signaling axis. Mol Neurobiol. 2022;59(1):1–16.
Yu J, Zhou X, Nakaya M, Jin W, Cheng X, Sun SC. T cell-intrinsic function of the noncanonical nf-kappab pathway in the regulation of gm-csf expression and experimental autoimmune encephalomyelitis pathogenesis. J Immunol. 2014;193(1):422–30.
Liu D, Yan J, Sun J, Liu B, Ma W, Li Y, et al. Bcl6 controls contact-dependent help delivery during follicular t-b cell interactions. Immunity. 2021;54(10):2245–55.
Yoshida K, Sakamoto A, Yamashita K, Arguni E, Horigome S, Arima M, et al. Bcl6 controls granzyme b expression in effector cd8 + t cells. Eur J Immunol. 2006;36(12):3146–56.
Seals MR, Moran MM, Leavenworth JD, Leavenworth JW. Contribution of dysregulated b-cells and ige antibody responses to multiple sclerosis. Front Immunol. 2022;13:900117.
Denic A, Wootla B, Rodriguez M. Cd8(+) t cells in multiple sclerosis. Expert Opin Ther Targets. 2013;17(9):1053–66.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Role of follicular CD8+ T cells labeled with B cell helper immunotypes in multiple sclerosis and a murine model

Status:

Version 1

Abstract

Background

Methods

Results

Conclusions

Figures

Background

Materials and methods

Ethics Statement

Study Population

EAE Induction

Mononuclear Cells Isolation

Flow Cytometry

Immunohistochemistry

RT-qPCR

Cell Sorting and Culturing

Autoantibody Detection

Serum Cytokine Detection

RNA Sequencing

Adoptive Cell Transfer

Statistics

Results

Demographic and clinical characteristics of the relapsing-remitting MS patients and HCs

Tfh-like helper functions, but not enhanced cytotoxicity of CD8⁺CXCR5⁺ T cells in EAE

CD8⁺CXCR5⁺ T cells adoptive transfer aggravated EAE

Discussion

Conclusions

Abbreviations

Declarations

References

Additional Declarations

Status:

Version 1

Role of follicular CD8+ T cells labeled with B cell helper immunotypes in multiple sclerosis and a murine model

Status:

Version 1

Abstract

Background

Methods

Results

Conclusions

Figures

Background

Materials and methods

Ethics Statement

Study Population

EAE Induction

Mononuclear Cells Isolation

Flow Cytometry

Immunohistochemistry

RT-qPCR

Cell Sorting and Culturing

Autoantibody Detection

Serum Cytokine Detection

RNA Sequencing

Adoptive Cell Transfer

Statistics

Results

Demographic and clinical characteristics of the relapsing-remitting MS patients and HCs

Tfh-like helper functions, but not enhanced cytotoxicity of CD8+CXCR5+ T cells in EAE

CD8+CXCR5+ T cells adoptive transfer aggravated EAE

Discussion

Conclusions

Abbreviations

Declarations

References

Additional Declarations

Status:

Version 1

Tfh-like helper functions, but not enhanced cytotoxicity of CD8⁺CXCR5⁺ T cells in EAE

CD8⁺CXCR5⁺ T cells adoptive transfer aggravated EAE