Animals
Male 8-week-old C57BL/6J mice were acquired from Shanghai Laboratory Animal Center Ltd., China. Food and water were provided ad libitum. The animals were maintained on a 12 h light/dark cycle.
Isolation and characterization of EPCs
EPCs were isolated and characterized as previously described[23]. Briefly, crude cells were isolated from mouse bone marrow, and cultured in a 37 °C incubator under 5% CO2. We used passages 3–7 for experiments. EPCs were characterized using immunofluorescence. Briefly, cells were fixed in 4% paraformaldehyde (PFA), incubated with Human Dil-Acetylated Low Density Lipoprotein (Dil-Ac-LDL) and FITC labeled Ulex europaeus agglutinin 1(FITC-UEA-1) (Sigma Deisenhofen, Germany) and visualized using a confocal microscope. We further characterized EPCs using flow cytometry. Positive cells were identified using antibodies against CD34, CD133 and VEGF-2(all the antibodies were purchased from BD Bioscience, USA).
Cell treatment
The TUG1 overexpression vector, miR-29c-3p mimic and vehicle were purchased from GenePharm Co. Ltd. (Shanghai, China). Twenty-four hours after transfection, cells were collected for analysis. For high glucose treatment, EPCs were cultured in serum-free DMEM containing 25 mM high glucose for 24h. For Wnt pathway and autophagy experiments, EPCs were incubated with Wnt pathway inhibitor Dickkopf-1(DKK1) (0.1 mg/ml) and autophagy inhibitor 10 µM chloroquine (CQ) (sigma-Aldrich).
Immunofluorescence
EPCs were seeded in six-well plates and fixed in 4% PFA. For tissue immunofluorescence experiments, gastrocnemius muscle tissue was isolated from ischemic hind limbs, fixed in 4% PFA, embedded in paraffin, then cut into 5μm sections for immunofluorescence staining. Sections were blocked with 10% bovine serum albumin and incubated with primary antibody. This was followed by incubation with fluorescently-labeled secondary antibodies. Nuclei were labeled with 4′,6-diamidino-2-phenylindole (DAPI) (Beyotime, Shanghai) and cells were visualized using fluorescence microscopy.
Wound scratch assay
EPCs were seeded in six-well plates. When EPCs are spread over the entire six-well plate, the medium was removed, and a 200μl pipette tip was used to create a linear scratch. Then, EPCs were washed twice with PBS and treated with 25mM high glucose or overexpression TUG1 for 24 h. Images were obtained by an Olympus inverted phase-contrast microscope.
Transwell assay
EPCs (1×105) were plated in the upper portion of Transwell chambers (8 μm, 24-well plates) that had been coated with Matrigel [24]. The insert membranes were cut out and stained with crystal violet (Beyotime Technology, China), and invading cells were photographed and counted using an inverted phase-contrast microscope.
Tube formation assay
EPC tube formation was assessed using an in vitro Angiogenesis Assay Kit (Chemicon, Billerica, MA, USA) as described previously [25]. EPCs (1×104) were grown in EC matrix solution with EGM-2 MV medium, at 37 °C for 16 h. Tube formation was evaluated under an inverted light microscope. The area of tube formation was quantified in three random fields; the total area of tube formation represented the degree of angiogenesis.
Ischemic hind limb model construction
For construction of the ischemic hindlimb model, diabetes mice were used [26]. To create the model, mice were anesthetized and the hindlimb area was depilated. The proximal and distal portions of the femoral artery were ligated. After surgery, buprenorphine (0.04 mg/kg) was injected to reduce the pain. Normal saline or TUG1 overexpression lentiviruses were injected into the distal ischemic hind limb. Four weeks later, hind limb blood perfusion was measured using a Laser Doppler perfusion imager system (Moor Instruments Limited, Devon, UK). Red sections indicated richer perfusion.
Dual-luciferase reporter assay
The Dual-Luciferase Reporter Assay System (Promega, Madison, WI, USA) was used [27] and segments of TUG1 and the 3ʹ-untranslated region (UTR) of platelet-derived growth factor type BB (PDGF-BB), containing miR-29c-3p binding sites (WT) or mutated binding sites (MUT), were synthesized by Sangon Biotech (Shanghai, China). These fragments were subcloned into the pGL4-Basic vectors (Promega). Cells were cotransfected with constructs containing WT or MUT TUG1 and the 3ʹ-UTR of PDGF-BB and miR-29c-3p mimics. After 48 h, cells were harvested, lysed and measured using a plate reader.
Real-time reverse-transcription polymerase chain reaction (qRT-PCR)
Total RNA was isolated from cells using TRIzol reagent (Invitrogen, Carlsbad, CA, USA), according to the manufacturer’s protocol. Reverse transcription was carried out using a Prime Script RT reagent kit (TaKaRa, Dalian, China), according to the manufacturer’s instructions.
Amplification was carried out using SYBR Premix Ex Taq (TaKaRa). For miR-29c-3p, qRT-PCR was performed using a microRNA assay kit. Relative gene expression was calculated using the 2˗ΔΔCT method. PCR reactions were performed in triplicate, using the following primers: PDGF-BB Forward: CAGTGACCTTGGAGGACCAC, Reverse: GAATGGTCACCCGAGCTTGA; TUG1 Forward: CTGAAGAAAGGCAATCCATC, Reverse: GTAGGCTACTACAGGTCATTTG; GAPDH Forward: GTGAAGGTCGGAGTCAACGG, Reverse: TCCTGGAAGATGGTGATGGG.
Western blot analysis
EPCs were harvested in cold RIPA buffer, the protein was extracted by protein extraction kit (Jiancheng, Nanjing) and quantified by a BCA assay kit (Solarbio Life Sciences). Proteins (20 µg per lane) were separated by 10% SDS-PAGE, and were then transferred to PVDF membranes. Membranes were blocked with 5% nonfat dry milk and incubated with primary antibodies: Wnt (1:1000), p-β-catenin (1:1000), PDGF-BB (1:500), LC3 I/II (1:1000) (all antibody purchased from Cell Signaling Technology) at 4°C overnight. Then, membranes were washed in TBS-Tween five times, followed by incubation with HRP-conjugated secondary antibodies (1:5000) (Cell Signaling Technology) for 1 h at room temperature. GAPDH was used as the loading control. Bands were detected using an ECL assay kit. Protein gray values were measured using ImageJ software.
Statistical analysis
All experiments were performed at least three times. Data were expressed as the mean ±standard deviation (SD). Comparisons were performed using the unpaired Student’s t-test. Data were analyzed using SPSS 21 (SPSS, Chicago, IL, USA). P <0.05 was considered statistically significant.