LncRNA FLVCR1-AS1 functions as competing endogenous RNA (ceRNA) to sponge miR-381-3p and aggravate colorectal cancer via upregulation of Wnt signaling pathway

doi:10.21203/rs.3.rs-3309785/v1

Download PDF

Research Article

LncRNA FLVCR1-AS1 functions as competing endogenous RNA (ceRNA) to sponge miR-381-3p and aggravate colorectal cancer via upregulation of Wnt signaling pathway

https://doi.org/10.21203/rs.3.rs-3309785/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Introduction

Colorectal cancer (CRC) is the third most frequent cancer and the second deadliest cancer, worldwide. Long non-coding RNAs (lncRNAs) have been introduced as vital regulators of CRC. lncRNA feline leukemia virus subgroup C receptor 1 antisense RNA 1 (FLVCR1‑AS1) is suggested to play a significant role in the tumorigenesis of several cancers. Wnt signaling pathway is the most deregulated pathway in CRC. The present study aimed to investigate the underlying mechanism of function of FLVCR1-AS1 in CRC through FLVCR1-AS1/miR-381-3p/ CTNNB1, LRP6, FZD3 axis.

Methods

The expression level of FLVCR1-AS1 was compared between CRC tissues and adjacent normal tissues, and additionally between CRC cell lines. Knockdown of FLVCR1-AS1 was performed in HCT116 cells, afterwards, the effects of this knockdown on the expression levels of FLVCR1-AS1, miR-381-3p, and three genes was examined via Real time-PCR. The differences in proliferation were evaluated using MTT assay, and cell death was assessed by flow cytometry.

Results

The results confirmed that FLVCR1-AS1 was upregulated in CRC tissues compared to adjacent normal tissues. RT-qPCR validated that FLVCR1-AS1 has the most level of expression in HT29, HCT116, SW480, and Caco2; respectively. Knockdown of FLVCR1‑AS1 was significantly followed by attenuated viability of HCT116 cells; while resulted in enhanced apoptosis and necrosis.

Conclusion

These findings support the idea that FLVCR1-AS1 may act as an oncogene in CRC and targeting FLVCR1-AS1/miR-381-3p/ CTNNB1, LRP6, FZD3 axis may be introduced as a novel target for CRC therapy and diagnosis in the future.

Colorectal cancer

ceRNA

FLVCR1-AS1

miR-381-3p

Wnt signaling

Colorectal cancer (CRC) is one of the most common cancers and has been reported as the second type of cancer leading to death (Kommuru et al. 2022). CRC is recorded to be responsible for 10% of all cancer incidences and 9.4% of all cancer-related deaths, worldwide (Krasteva and Georgieva 2022). Several various hereditary and non-hereditary factors as well as lifestyle have been recognized as risk factors for CRC. This cancer usually develops after the age of 50; although it can occur in youth (Lewandowska et al. 2022). Presently, the most common clinical treatment approaches for CRC are surgery, chemotherapy, and radiotherapy (Nedaeinia et al. 2016). Nevertheless, radiotherapy and chemotherapy are reported to kill a considerable number of normal cells and these traditional therapy strategies are disabled to effectively cure CRC. With the development of molecular biology and genomics, targeted therapy has reached steps forward in the cure of cancer. Albeit, significant progress in CRC diagnosis and therapy has been made, this cancer has still unpleasant consequences. Hence, more investigations are required to recognize the underlying mechanisms of CRC and uncover novel therapeutic and diagnostic targets (Zhao et al. 2021).

Wnt/β-catenin signaling is proven to exert significant roles in diverse cancers. Deviated Wnt/β-catenin signaling is associated with various aspects of cancer, including the initiation, progression, malignant transformation, and other tumorigenic behaviors (Yu et al. 2021). β-catenin-dependent canonical Wnt pathway is stimulated via binding of WNT ligand to receptors Frizzled (FZD) and low-density lipoprotein receptor-related protein 5 or 6 (LRP5/6). WNT protein provokes heterodimerization of FZD and LRP5/6 which finally leads to translocation of β-catenin to the nucleus, where β-catenin creates a complex with T-cell factor (TCF) / lymphoid enhancer factor (LEF) transcription factors and makes transcription of Wnt signaling responding genes instantiate cyclinD1 and c-MYC (Wang et al. 2021). In the absence of WNT proteins, β-catenin is stranded by a destructive complex containing adenomatosis polyposis coli (APC), glycogen synthase kinase 3 (GSK3), and Axin and casein kinase Iα (CKIα). This complex lets β-catenin gets phosphorylated by GSK3 and become ubiquitinated by E3 polyubiquitin ligase β-TrCP which is followed by its transportation to the proteasome for degradation. So, in this condition, β-catenin cannot trigger the Wnt pathway and makes the signals off (Sehgal et al. 2021; Yu et al. 2021).

Long non-coding RNAs (lncRNAs) are a type of non-coding RNA with more than 200 nucleotides in length (Agirre et al. 2019). There is increasing evidence representing the roles of lncRNAs in gene expression regulation and subsequently in tumor cell proliferation, invasion, migration, cell cycle, and other cell behaviors (Zhang et al. 2021). The ceRNA mechanism has proven that lncRNAs can function as competing endogenous RNAs (ceRNAs) to interact with sequestered microRNAs (miRNAs), leading to enhanced expression of downstream target genes (Chang et al. 2020). The aberrant expression of some lncRNAs has been reported in CRC. It has been depicted that lncRNA KCNQ1OT1 participates in ceRNA network miR-421/NR3C1, XIAP to accelerate CRC (Abdolvand et al. 2022). An investigation has indicated that lncRNA NEAT1 plays a critical role in the tumorigenesis of CRC by influencing the Wnt signaling pathway (Azizidoost et al. 2022). LncRNA feline leukemia virus subgroup C receptor 1 antisense RNA 1 (FLVCR1-AS1) is suggested to play a tumor-promoting role in several cancers containing osteosarcoma (Jiang et al. 2020), cholangiocarcinoma (Bao et al. 2019), breast cancer (Pan et al. 2020), ovarian cancer (Yan et al. 2019), gastric cancer (Liu et al. 2019) and lung cancer (Lin et al. 2019). Also, it is manifested that FLVCR1-AS1 is overexpressed in CRC and participates in a ceRNA network, and competes with Ras-related protein 2a (RAP2A) for attaching to miR-381 (Han et al. 2021). In addition, It has been shown that FLVCR1-AS1 sponges miR-381-3p and promotes breast cancer carcinogenesis (Pan et al. 2020).

The present study aimed to investigate the function of FLVCR1-AS1 in CRC through modulating FLVCR1-AS1/ miR-381-3p/ FZD3, CTNNB1, LRP6 axis (Fig. 1). The study was performed by comparing the expression of FLVCR1-AS1 between CRC tissues and adjacent normal tissues, and also between 4 CRC cell lines. afterwards, FLVCR1-AS1 was downregulated in the CRC cell line and was followed by evaluating its consequences on the expression of other members of axis and also on the cell proliferation and apoptosis.

Figure 1 lncRNA FLVCR1-AS1 sponges miR-381-3p and suppresses its inhibitory effects on FZD3, LRP6, and CTNNB1 leading to upregulation of Wnt signaling pathway that is followed by enhanced proliferation and repressed apoptosis

2.1. Tissue specimens

A total of 20 pairs of CRC tissues and adjacent non-tumor tissues were acquired from CRC patients (11 males and 9 females) with a mean age of 65 years and ranging from 29 to 85 in 2017 and 2018 at the Poursina Hakim Gastrointestinal Disease research center. As people referred to Poursina Hakim Institute suffering from various CRC symptoms, colonoscopy and clinical tests were employed to discriminate the CRC patients from healthy people. All patients had not received radiotherapy or chemotherapy before tissue sampling. The specimens were quickly cryopreserved in the liquid nitrogen until DNA extraction. Written informed consents had been provided by all patients and the study was approved by the Ethics Committee of Isfahan University School of medical sciences (IR.MUI.MED.REC.1398.728).

2.2. Cell lines and Cell culture

The cell lines (HT29, SW480, CACO2 and HCT116) were obtained from the Pasteur institution (Tehran, IRAN) and were cultured in Dulbecco's modified Eagle's medium (DMEM) supplement with 10% fetal bovine serum (FBS) (Gibco, Paisley, UK) and 100 U/ml penicillin and 100 /ml streptomycin (Bioidia, IRAN) were incubated at 37ºC and 5% CO₂ in the humidified incubator.

2.3. RNA extraction and RT-qPCR

FavorPrep™ Tissue Total RNA Mini Kit (Favorgen, Taiwan) was used to extract total RNA from tissue samples and CRC cell lines. Subsequently, total RNA was reverse transcribed using BioFact™ 2X RT Pre-Mix kit (Biofact, Korea) and random hexamer primer. miRNA cDNA Synthesis was conducted using BONmiR High Sensitivity MicroRNA 1st Strand cDNA Synthesis kit (Bonyakhteh, Tehran, Iran). The qPCR was performed on the Mic qPCR instrument (Bio Molecular System, Australia) using RealQ Plus 2x Master Mix Green (Amplicon, Denmark). The sequences of primers are listed in table 1. Fold expression changes were calculated by 2^−ΔΔCt method (Livak and Schmittgen 2001). GAPDH and U6 were employed as reference genes.

Table.1 Primer sequences

Gene	Primer sequences (5’-3’)	Product size	Annealing temperature	Transcript number
FLVCR1-AS1	F: GTGGCTCTCTCGTTCCC R: CCGTCCTTCGGTAGTGTC	147	56	NR_027285.1
CTNNB1	F: TGGCTTGGAATGAGACTGCTGAT R: GCCACCCATCTCATGTTCCATCAT	161	65.6	NM_001904.4
FZD3	F: TTCCATGTCCATATCAGGTTACTC R: GTCGGCTCTCATTCACTATCTC	186	58	NM_001412905.1
LRP6	F: AACGCGAGAAGGGAAGATGG R: CAAAGGGGCCGCTCTCAG	82	60	NM_002336.3
GAPDH	F: TCCTCTGACTTCAACAGCGACAC R: CACCCTGTTGCTGTAGCCAAATTC	126	62.6	NM_002046.7
U6	F: CGCTTCGGCAGCACATATACTA R: GGAACGCTTCACGAATTTGC	94	59.6	NR_104084.1

2.4. Cell transfection

The HCT116 cells were divided into three groups. The cells of the first and the second group (NC cells) were transfected with specific shRNA targeting FLVCR1-AS1 (shFLVCR1-AS1) and shRNA as negative control (shNC) which had been cloned into PRNAT-H1.1/Neo plasmid. While, the third group was employed as control cells. The sequences of shRNAs are manifested in Table 2. Transfection was performed based on Turbofect™ Transfection Reagent’s protocol (Thermo Fisher Scientific, Inc) and the result was evaluated after 24 hours via examining GFP expression using fluorescent microscope (Nikon, Japan).

Table 2

Sequences of shRNAs
ShRNA	Sequences (5'-3')
shFLVCR1-AS1	GGTAAGCAGTGGCTCCTCTAA
ShNC	AATTCTCCGAACGTGTCACGT

2.5. MTT assay

HCT-116 cells were seeded into 96 well plates (12,000 cells/well) and 24, 48, and 72 hours after transfection, the medium was replaced with serum-free medium containing 0.5 mg/ml 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide (MTT) (Sigma-Aldrich, USA). Afterward, the cells were incubated at 37°C for 4 hours in darkness. After removing the MTT solution, the formazan precipitate was dissolved by 100 µl DMSO and the absorbance was evaluated at 570 nm using a microplate reader (BioTek, Winooski, VT, USA).

2.6. Apoptosis assay

To examine apoptosis rate 24, 48, and 72 hours after transfection, the cells which had been seeded in a 4-well plate, were digested using 200 µl trypsin (Gibco, Paisley, UK), and 400 µl DMEM medium containing 10% FBS (Gibco, Paisley, UK) was added to terminate the digestion. Then, the cells were centrifuged at 1500 rpm for 5 minutes at 4°C. The collected cells were washed with PBS and then resuspended in a binding buffer. Double-staining was performed with a Annexin V-FITC Apoptosis Detection kit (MBR, Iran) according to the manufacturer's protocol. The apoptotic cell ratio was analyzed using flow cytometry (BD Biosciences FACS calibur).

2.7. Statistical analysis

All experiments were performed in triplicate and data are represented as the mean ± standard deviation. SPSS and GraphPad prism software version 9.0 for Mac (GraphPad Software, San Diego, CA, USA) were used to conduct statistical analysis. Unpaired t-test and one-way analysis of variance followed by Tukey's post hoc test were applied to compare the differences between two and multiple groups, respectively. P < 0.05 was considered to indicate a statistically significant difference.

3.1. The expression of FLVCR1-AS1 in CRC tissues and cell lines

The expression of FLVCR1-AS1 was evaluated in 20 pairs of CRC tissues and adjacent normal tissues. The clinical characteristics of CRC patients are mentioned in Table 3. It was detected that the expression of FLVCR1-AS1 was significantly upregulated in CRC tissues compared to normal tissues (p < 0.0001) (Fig. 2A). This result supports the idea that FLVCR1-AS1 may act as an oncogene in CRC. In addition, RT-qPCR demonstrated that the expression of FLVCR1-AS1 was higher in the HT29 cell line compared to SW480, CACO2, and HCT116 (Fig. 2B). the HT29 cells were employed for subsequent experiments. Unfortunately, it was not an appropriate host for transfection in our system. In fact, the cells death was observed after transfection; Thus, the second cell line with the higher expression of FLVCR1-AS1 was considered for the next steps.

Table 3

The characteristics of patients
Characteristic	Patients (n = 20)
Sex Male Female	11 9
Age / years >60 ≤60	6 14
Tomur location Colon Rectal	12 8
Metastasis Yes No	5 15
Pathological stage I II III IV	2 8 8 2
Familial history of cancer Yes No	9 11

3.2. knockdown of FLVCR1-AS1 inhibits cell proliferation and induces apoptosis

To investigate whether FLVCR1-AS1 influences cell viability and apoptosis of HCT116 cells, FLVCR1-AS1 was downregulated using shFLVCR1-AS1. The transfection efficiency was observed by fluorescent microscope (Fig. 3A-D) and effect of shFLVCR1-AS1 on expression level of FLVCR1-AS1 was determined through RT-qPCR (Fig. 3E). The results indicated that the expression of FLVCR1-AS1 was significantly downregulated following transfecting cells with shFLVCR1-AS1 (p < 0.05).

MTT assay revealed that the proliferation of HCT116 cells which had been transfected with shFLVCR1-AS1 was attenuated compared to the NC or control cells (Fig. 3F). Furthermore, to examine the influences of FLCVR1-AS1 knockdown on the apoptosis rate of CRC, HCT116 cells were transfected with shFLVCR1-AS1 or shNC. Afterward, the cells were stained with Annexin V and Propidium iodide (PI) and were detected using flow cytometry. As is demonstrated in Fig. 2G, the percentage of apoptosis in FLVCR1-AS1 downregulated cells was significantly higher than in NC and control cells. Also, the flow cytometry cell map of HCT-116 cells is represented in Fig. 4. These results support the view that the knockdown of FLVCR1-AS1 aggravates CRC cell apoptosis.

3.3. FLVCR1-AS1 upregulates Wnt signaling pathway via sponging miR-381-3p

MiR-381-3p, which has been commonly introduced as a tumor suppressor miRNA involved in a number of human cancers, is reported as a target of FLVCR1-AS1 in breast cancer, too (Pan et al. 2020). Hence, this miRNA was considered to investigate the molecular mechanism by which FLVCR1-AS1 stimulates CRC. The consequence of FLVCR1-AS1 knockdown on miR-381-3p was evaluated via RT-qPCR (Fig. 5A). The results demonstrated that the expression of miR-381-3p was significantly elevated in the cells which had been transfected with shFLVCR1-AS1, compared with the NC or control cells. Additionally, based on previous studies which had reported CTNNB1, FZD3 and LRP6 as oncogenic agents promoting the Wnt signaling pathway, and the data representing these genes as targets of miR-381-3p, we examined their expression, too (Fig. 5B-D). The reduced expression of CTNNB1, FZD3, and LRP6 was observed in the downregulated FLVCR1-AS1 cells. These findings were consistence with the idea that FLVCR1-AS1 provokes CRC via upregulation of the Wnt signaling pathway through ceRNA network FLVCR1-AS1/miR-381-3p/CTNNB1, FZD3, LRP6.

CRC is a serious menace to human life worldwide (Liu et al. 2020). Discovering the underlying molecular mechanisms involved in tumorigenesis of CRC let us design novel and beneficial approaches to treat, prognose and diagnose CRC. Recent investigations have uncovered that lncRNAs and miRNAs play pivotal roles in cancers and they are valuable targets and significant markers for treating cancer, and diagnosis and prognosis it (Qian, Shi, and Luo 2020; Annese et al. 2020).

Actually, our investigation was designed based on a ceRNA network containing miR-381-3p which is sponged by FLVCR1-AS1 and other oncogenes stimulating the Wnt signaling pathway. Multiple studies have suggested that FLVCR1-AS1 acts as an oncogene in multiple cancers through various ceRNA networks. Zhou et al got successful to reverse tumorigenesis of cervical cancer cells by suppressing FLVCR1-AS1 which resulted in increased miR-23a-5p expression level and decreased its target gene, SLC7A11, expression (Zhou, Zhao, et al. 2022). Besides, Pan et al proved that miR-381-3p is sponged by FLVCR1-AS1 and CTNNB1. Downregulation of FLVCR1-AS1 was followed by reduced proliferation and migration of breast cancer cells (Pan et al. 2020). Furthermore, Han et al examined the influence of FLVCR1-AS1 on the pathogenesis of CRC by knockdown and overexpression of it in CRC cells, and uncovered that this lncRNA promotes CRC cell proliferation and metastasis, while attenuates apoptosis through modulating the miR-381/RAP2A axis (Han et al. 2021). On the other hand, an investigation which was performed by Lin et al reported that, against other cancers, FLVCR1-AS1 plays a tumor suppressor role in pancreatic cancer. Overexpression of FLVCR1-AS1 was seen in tumor samples compared with normal. In addition, reversed tumorigenesis of pancreatic cancer cells was observed following the overexpression of FLVCR1-AS1; while, downregulation of it had opposite effects. The different role of FLVCR1-AS1 in pancreatic cancer is may be related to specific pancreatic microenvironment (19).

MiR-381-3p has been identified as a tumor suppressor gene and is reported to be downregulated in various human tumors, including bladder cancer, cervical cancer, and oral squamous cell carcinoma (Pan et al. 2020). In addition, Ye et al revealed that miR-381-3p functions as a negative regulator of CRC (17). Other studies indicated that miR-381-3p suppresses FZD3 and LRP6 in human bone mesenchymal stromal cells and papillary thyroid carcinoma, respectively (Long et al. 2019; Kong et al. 2018).

The present study indicated that FLVCR1-AS1 was considerably upregulated in CRC tissues compared with adjacent normal. Also, we found the most expression of FLVCR1-AS1 in HT29 cells compared with SW480, CACO2 and HCT116 cell lines. Due to getting unsuccessful in transfecting HT29 cells, the HCT116 cell line was selected to further studies. Knockdown of FLVCR1-AS1 sharply occurred consequence of transfecting shFLVCR1-AS1 and it was followed by enhanced expression of miR-381-3p and attenuated expression of oncogenes involved in the Wnt signaling. The Wnt signaling pathway is reported as the most common deregulated pathway in CRC Signaling in the Wnt pathway starts with the binding of WNT ligands to receptors that make the inhibitor complex of the β-catenin move toward the membrane which let β-catenin translocate to the nucleus (Beni et al. 2022). Eventually, it is followed by the transcription of tumor-promoting genes instantiate c-MYC and cyclinD1 (Zhou, Xu, et al. 2022). Additionally, the reduced cell viability and proliferation and induced apoptosis and necrosis were seen as results of FLVCR1-AS1 knockdown. These findings confirm the idea that FLVCR1-AS1 may play an oncogenic role in CRC.

In conclusion, lncRNA FLVCR1-AS1 was found upregulated in CRC tissues and was depicted to play a tumor promoter role in the pathogenesis of CRC through the FLVCR1-AS1/ miR-381-3p/LRP6, FZD3, CTNNB1 axis. Discovering other downstream targets of lncRNA FLVCR1-AS1 and investigating the role of this lncRNA in vivo might be the plan of the next studies. lncRNA FLVCR1-AS1 may be considered a potential therapeutic target and a novel diagnostic marker of CRC in the future.

Acknowledgements: The authors wish to thank Dr. Hossein Khanahmad, the Faculty member of Department of Genetics and Molecular Biology, School of Medicine, Isfahan University of Medical Sciences, Isfahan, Iran, for his advisements and supports in “cloning process”.

Author contribution: Faeze Ahmadi Beni did the experiments and wrote the article, Mohammad abdolvand collected the samples, Mansoor Salehi designed the study, Mohammad Kazemi took the leadership of the study, analyzed and interpreted the data, and Fariba Dehghanian revised the article and verified the analytical methods.

Funding: This study was supported by the research fund of Isfahan University of Medical Sciences. Compliance with ethical standards.

Conflicts of interest: The authors declare that they have no conflicts of interest.

Ethical approval: All the procedures performed in the present study were in accordance with the ethical standards of the Ethics Committee of Isfahan University of Medical Sciences (IR.MUI.MED.REC.1398.728).

Informed consent: Signed informed consents were obtained from all the patients prior to the study.

Data availability: All data generated or analyzed during this study are included in this published article.

Kommuru S, Aziz SN, Sagireddy S, Kaur G, Rijal S, Loh CC, Ibrahim Y, Patel V (2022) Risk Factors for Colorectal Cancer in Inpatients With Ulcerative Colitis: A Nationwide Cross-Sectional Analysis Cureus 14:e27114. https://doi.org/10.7759/cureus.27114
Krasteva N, Georgieva M (2022) Promising Therapeutic Strategies for Colorectal Cancer Treatment Based on Nanomaterials Pharmaceutics 14. https://doi.org/10.3390/pharmaceutics14061213
Lewandowska A, Rudzki G, Lewandowski T, Stryjkowska-Góra A, Rudzki S: Title: Risk Factors for the Diagnosis of Colorectal Cancer (2022) Cancer Control 29:10732748211056692. https://doi.org/10.3390/10.1177/10732748211056692.
Nedaeinia R, Sharifi M, Avan A, Kazemi M, Rafiee L, Ghayour-Mobarhan M, Salehi R (2016) Locked nucleic acid anti-miR-21 inhibits cell growth and invasive behaviors of a colorectal adenocarcinoma cell line: LNA-anti-miR as a novel approach Cancer Gene Ther 23:246–253. https://doi.org/10.1038/cgt.2016.25
Zhao C, Jiang Q, Chen L, Chen W (2021) LncRNA LINC01535 promotes colorectal cancer development and chemoresistance by sponging miR-761 Exp Ther Med 22:685. https://doi.org/10.3892/etm.2021.10117
Yu F, Yu C, Li F, Zuo Y, Wang Y, Yao L, Wu C, Wang C, Ye L (2021) Wnt/β-catenin signaling in cancers and targeted therapies Signal Transduction and Targeted Therapy 6:307. https://doi.org/10.1038/s41392-021-00701-5
Wang Z, Zhao T, Zhang S, Wang J, Chen Y, Zhao H, Yang Y, Shi S, Chen Q, Liu K (2021)The Wnt signaling pathway in tumorigenesis, pharmacological targets, and drug development for cancer therapy Biomarker Research 9:68. https://doi.org/10.1186/s40364-021-00323-7
Sehgal P, Lanauze C, Wang X, Hayer KE, Torres-Diz M, Leu NA, Sela Y, Stanger BZ, Lengner CJ, Thomas-Tikhonenko A (2021) MYC Hyperactivates Wnt Signaling in APC/CTNNB1-Mutated Colorectal Cancer Cells through miR-92a-Dependent Repression of DKK3 Mol Cancer Res 19:2003–2014. https://doi.org/10.1158/1541-7786.Mcr-21-0666
Agirre X, Meydan C, Jiang Y, Garate L, Doane AS, Li Z, Verma A, Paiva B, Martín-Subero JI, Elemento O et al (2019) Long non-coding RNAs discriminate the stages and gene regulatory states of human humoral immune response Nature Communications 10:821. https://doi.org/10.1038/s41467-019-08679-z
Zhang C, Wang L, Jin C, Zhou J, Peng C, Wang Y, Xu Z, Zhang D, Huang Y, Zhang Y et al (2021) Long non-coding RNA Lnc-LALC facilitates colorectal cancer liver metastasis via epigenetically silencing LZTS1 Cell Death & Disease 12:224. https://doi.org/10.1038/s41419-021-03461-w
Chang Z, Huang R, Fu W, Li J, Ji G, Huang J, Shi W, Yin H, Wang W, Meng T et al (2020) The Construction and Analysis of ceRNA Network and Patterns of Immune Infiltration in Colon Adenocarcinoma Metastasis Frontiers in Cell and Developmental Biology 8. https://doi.org/10.3389/fcell.2020.00688
Abdolvand M, Sadeghi M, Emami MH, Fahim A, Rahimi H, Amjadi E, Baghaei A, Abdolvand S, Maghool F, Feizbakhshan S (2022) Constructing a novel competing Endogenous RNAs network based on NR3C1 and X-linked inhibitor of apoptosis protein genes reveals potential prognostic biomarkers in colorectal cancer Journal of Research in Medical Sciences 27(1):71. https://doi.org/10.4103/jrms.jrms_889_21
Azizidoost S, Ghaedrahmati 0F, Anbiyaee O, Ahmad Ali R, Cheraghzadeh M, Farzaneh M (2022) Emerging roles for lncRNA-NEAT1 in colorectal cancer Cancer Cell International, 22(1):209. https://doi.org/10.1186/s12935-022-02627-6
Jiang S, Kong P, Liu X, Yuan C, Peng K, Liang Y: LncRNA FLVCR1-AS1 accelerates osteosarcoma cells to proliferate, migrate and invade via activating wnt/β-catenin pathway (2022) J buon 25(4):2078–2085
Bao W, Cao F, Ni S, Yang J, Li H, Su Z, Zhao B: lncRNA FLVCR1-AS1 regulates cell proliferation, migration and invasion by sponging miR-485-5p in human cholangiocarcinoma (2019) Oncol Lett 2019 18(3):2240–2247. https://doi.org/10.3892/ol.2019.10577
Pan Z, Ding J, Yang Z, Li H, Ding H, Chen Q (2020) LncRNA FLVCR1-AS1 promotes proliferation, migration and activates Wnt/β-catenin pathway through miR-381-3p/CTNNB1 axis in breast cancer. Cancer Cell International 20(1):214. https://doi.org/10.1186/s12935-020-01247-2
Yan H, Li H, Silva MA, Guan Y, Yang L, Zhu L, Zhang Z, Li G, Ren C (2019) LncRNA FLVCR1-AS1 mediates miR-513/YAP1 signaling to promote cell progression, migration, invasion and EMT process in ovarian cancer J Exp Clin Cancer Res 38(1):356. https://doi.org/10.1186/s13046-019-1356-z
Liu Y, Guo G, Zhong Z, Sun L, Liao L, Wang X, Cao Q, Chen H (2019) Long non-coding RNA FLVCR1-AS1 sponges miR-155 to promote the tumorigenesis of gastric cancer by targeting c-Myc. Am J Transl Res 11(2):793–805
Lin H, Shangguan Z, Zhu M, Bao L, Zhang Q, Pan S (2019) lncRNA FLVCR1-AS1 silencing inhibits lung cancer cell proliferation, migration, and invasion by inhibiting the activity of the Wnt/β-catenin signaling pathway. J Cell Biochem 120(6):10625–10632. https://doi.org/10.1002/jcb.28352
Han Y, Wang X, Mao E, Shen B, Huang L (2021) lncRNA FLVCR1–AS1 drives colorectal cancer progression via modulation of the miR–381/RAP2A axis Mol Med Rep 23(2). https://doi.org/10.3892/mmr.2020.11778
Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method Methods 25(4):402–408. https://doi.org/10.1006/meth.2001.1262
Liu Y, Chen X, Chen X, Liu J, Gu H, Fan R, Ge H (2020) Long non-coding RNA HOTAIR knockdown enhances radiosensitivity through regulating microRNA-93/ATG12 axis in colorectal cancer Cell Death & Disease 11(3):175. https://doi.org/10.1038/s41419-020-2268-8
Qian Y, Shi L, Luo Z: Long Non-coding RNAs in Cancer (2020) Implications for Diagnosis, Prognosis, and Therapy Frontiers in Medicine 7. https://doi.org/10.3389/fmed.2020.612393
Annese T, Tamma R, De Giorgis M, Ribatti D (2020) microRNAs Biogenesis, Functions and Role in Tumor Angiogenesis Frontiers in Oncology 10. https://doi.org/10.3389/fonc.2020.581007
Zhou X, Zhao X, Wu Z, Ma Y, Li H (2022) LncRNA FLVCR1-AS1 mediates miR-23a-5p/SLC7A11 axis to promote malignant behavior of cervical cancer cells Bioengineered 13(4):10454–10466. https://doi.org/10.1080/21655979.2022.2059958
Long H, Zhu Y, Lin Z, Wan J, Cheng L, Zeng M, Tang Y, Zhao R (2019) miR-381 modulates human bone mesenchymal stromal cells (BMSCs) osteogenesis via suppressing Wnt signaling pathway during atrophic nonunion development Cell Death & Disease 10(7):470. https://doi.org/10.1038/s41419-019-1693-z
Kong W, Yang L, Li PP, Kong QQ, Wang HY, Han GX, Wang QB (2018) MiR-381-3p inhibits proliferation, migration and invasion by targeting LRP6 in papillary thyroid carcinoma Eur Rev Med Pharmacol Sci 22(12):3804–3811. https://doi.org/10.26355/eurrev_201806_15264
Beni FA, Kazemi M, Dianat-Moghadam H, Behjati M (2022) MicroRNAs regulating Wnt signaling pathway in colorectal cancer: biological implications and clinical potentials Funct Integr Genomics 22(6):1073–1088. https://doi.org/10.1007/s10142-022-00908-x
Zhou Y, Xu J, Luo H, Meng X, Chen M, Zhu D (2022) Wnt signaling pathway in cancer immunotherapy Cancer Lett 525:84–96. https://doi.org/10.1016/j.canlet.2021.10.034

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

LncRNA FLVCR1-AS1 functions as competing endogenous RNA (ceRNA) to sponge miR-381-3p and aggravate colorectal cancer via upregulation of Wnt signaling pathway

Status:

Version 1

Abstract

Figures

1. Introduction

2. Materials and methods

2.1. Tissue specimens

2.2. Cell lines and Cell culture

2.3. RNA extraction and RT-qPCR

2.4. Cell transfection

2.5. MTT assay

2.6. Apoptosis assay

2.7. Statistical analysis

3. Results

3.1. The expression of FLVCR1-AS1 in CRC tissues and cell lines

3.2. knockdown of FLVCR1-AS1 inhibits cell proliferation and induces apoptosis

3.3. FLVCR1-AS1 upregulates Wnt signaling pathway via sponging miR-381-3p

4. Discussion

5. Conclusion

Declarations

References

Additional Declarations

Status:

Version 1