Virulence Factors, Antibiotic Resistance patterns, and Molecular Types of Clinical Isolates of Klebsiella Pneumoniae

doi:10.21203/rs.3.rs-331542/v1

Download PDF

Research

Virulence Factors, Antibiotic Resistance patterns, and Molecular Types of Clinical Isolates of Klebsiella Pneumoniae

https://doi.org/10.21203/rs.3.rs-331542/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 28 Oct, 2021

Read the published version in Expert Review of Anti-infective Therapy →

Version 1

posted

You are reading this latest preprint version

Background

Klebsiella pneumoniae is armed with a wide range of antibiotic resistance mechanisms which mostly challenges effective treatment. Due to this fact, the aims of the current study were to identify the clinical strains of K . pneumoniae as well as to determine their phenotypes and molecular characterization related to antimicrobial resistance and virulence genes.

Methods

In this investigation, specimens from a hospital and different laboratories located in Shahr-e-Qods, Tehran, Iran were collected during a period of nine-month (December 2018 to August 2019). The isolated strains of K. pneumoniae were then identified through standard microbial and biochemical assays. Additionally, disk diffusion, combined disk, modified Hodge test and PCR were performed for antibiotic resistance of the strains and virulence genes profiling, respectively. The molecular typing was accomplished by ERIC-PCR.

Results

Eighty-four isolates of K. pneumoniae were identified and subjected to the study. Fifty- two percent of the isolated strains of K. pneumoniae were detected as multidrug resistant (MDR) pathotypes with the highest resistance to ceftriaxone (65%) and the lowest resistance to colistin (23%). Twenty-seven (52%) out of 52 (100%) MDR pathotypes of isolated K. pneumoniae were identified as ESBL producers. According to Modified Hodge Test (MHT) results, out of 24 resistant strains of isolated K. pneumoniae to imipenem and meropenem, 15 pathotypes (62.5%) were detected as KPC producers. The gene of blaCTX (encoding carbapenemase) with 96% ranked first, while the blaKPC gene with the prevalence of 71% ranked second among ESBL producers. The aminoglycoside resistance gene of Aac6-Ib showed the highest frequency with the prevalence percentage of 90%. The virulence genes of mrkD (94%) and magA (11%) were the highest and lowest among isolates, respectively. According to ERIC-PCR results the isolated strains of K. pneumoniae were divided into four clusters in which the cluster 4 was predominant group.

Conclusions

The high prevalence of antibiotic resistance and virulence genes in conjunction with a significant relationship between the strains reveals a high pathogenic capacity of the isolated pathotypes of K. pneumoniae . These findings emphasize the choose of more effective antibiotic regimens for treatment of infections caused by K. pneumoniae.

Keywords: Klebsiella pneumoniae , antibiotic resistance, ESBL, virulence genes, molecular typing.

General Microbiology

Klebsiella pneumoniae

antibiotic resistance

ESBL

virulence genes

molecular typing

K. pneumoniae is a gram-negative, non-motile bacillus of the Enterobacteriaceae family with a polysaccharide capsule, which is substantial in pathogenesis and its ability to prevent phagocytosis [1]. This bacterium is an opportunistic pathogen and one of the most common causes of nosocomial infections ranging from pneumonia, meningitis, liver abscess, urinary tract infection (UTIs) and wound infection, to bacteremia and sepsis [2, 3]. K. pneumoniae pathogenesis is associated to the presence of certain virulence genes that encode virulence factors and allow it to attack the mammalian immune system and lead to a variety of diseases [4]. Through years, frequent use and contact with antibiotics in hospitals have created antibiotic-resistant K. pneumoniae strains, limiting available treatment options for medical intervention against Klebsiella infections, and developing many problems for medical staff and patients [5]. In the absence of correct and complete knowledge of antibiotic resistance mechanisms in bacteria, particularly K. pneumoniae, not only is the treatment extremely challenging, but it can inadvertently assist in the intensifying drug resistance.

Antibiotic resistance in gram-negative bacteria occurs due to enzymatic and non-enzymatic mechanisms [6,7]. Enzymatic pathways are imposed by the expression of antibiotic inactivating enzymes, while non-enzymatic pathways develop mainly because of gene mutations which result in resistance due to changes in efflux pumps, membrane permeability or target molecules [8]. Genes encoding resistance enzymes can be derived either from the bacterium itself or from Miniature Inverted Transposable Elements (MITEs) such as the plasmid encoding beta-lactamases or aminoglycoside-modifying enzymes [9,10]. The presence of genes encoding beta-lactamase and carbapenems enzymes are the most important mechanisms of antibiotic resistance in K. pneumoniae [11]. Extended-Spectrum Beta-Lactamases (ESBLs) hydrolyze many beta-lactam antibiotics and therefore pose major problems in the treatment of dangerous bacterial infections [12].

Resistance in K. pneumoniae isolates are mainly associated with ESBLs, as these enzymes lead to multidrug resistance (MDR) [13]. ESBL enzymes can inactivate broad-spectrum cephalosporins, monobactams, and penicillin such as class A beta-lactamases (TEM-1, TEM-2, and SHV-1), which form resistance to ampicillin, amoxicillin, and first-generation cephalosporins. Mutations in these genes trigger resistant to third generation cephalosporins [14, 15]. In addition to penicillin and cephalosporins, CTX-M enzymes are also a group of ESBLs which impose resistance to oxyimino -beta-lactams [16]. Another group of beta-lactamases commonly found in K. pneumoniae isolates is K. pneumoniae carbapenems (KPCs), which inflict resistance to carbapenem antibiotics [17]. A carbapenems identified in the accessory genome of K. pneumoniae is New Delhi Metallo-Beta-Lactamase 1 (NDM-1), a class B Metallo-beta-lactamase (MBL) encoded by the plasmid, and other examples of b-lactamases include carbapenems (bla_KPC and bla_OXA48) [18]. It could be worth mentioning that resistance to aminoglycosides is related to overexpression of drug metabolizing enzymes such as aminoglycoside N-6ʹ-acetyltransferase-Ib AAC (6ʹ) -Ib as well as 16S rRNA methyltransferases such as ArmA and RmtB [19]. Virulence-associated genes include coding regulators of mucoid phenotype A (rmpA), type 1 and type 3 adhesines (fimH-1, mrkD), aerobactin (iron siderophore) synthase (iucC), bacteriocin biosynthesis [enterobactin (entB) and yersiniabactin (irP-1)], and serum-dependent outer membrane lipoprotein (traT), which due to the number and function of these genes, they will play a significant role in the pathogenicity of K. pneumoniae strains isolated from nosocomial infections [20, 21].

The increasing prevalence of antibiotic resistance in pathogens of human and animal populations is now one of the most significant global health issues. Therefore, due to the development of resistance to antibiotics in K. pneumoniae and its various mechanisms, investigation of resistance pattern may lead to appropriate prescription of antibiotics, which results in more rapid improvement of related nosocomial infections [22, 23]. Additionally, this could in turn help inhibit new resistance patterns, by omitting the antibiotics with borderline sensitivity from therapeutic regimens in certain regions. Thus, the current study aimed to evaluate the phenotypic and genotypic mature of antibiotic resistance and virulence genes in K. pneumoniae strains isolated from clinical specimens in Shahr-e-Qods hospital. The relationship between the strains was also investigated by PCR (ERIC-PCR).

Bacterial strains

In the present study, during a 9-month period from December 2018 to August 2019, clinical samples suspected to K. pneumoniae infections were collected from the patients admitted to the 12th Bahman Hospital and other laboratories in Shahr-e-Qods, Tehran, Iran.

Bacterial culture

Following initial culture on Eosin-methylene blue agar (EMB), blood agar, and MacConkey agar media, the samples were incubated for 24 hours at 37 °C. The resultant bacterial colonies were examined by different diagnostic and biochemical tests, including Triple Sugar Iron (TSI), Simon citrate, urease and Methyl Red Voges Proskauer (MRVP), and then cultured on Sulfur-Indole-Motility (SIM) medium for further biochemical analysis. All identified K. pneumoniae strains were stored in skim milk agar stock for further analysis. [24].

Antibiotics susceptibility testing

Disc fusion (Kirby-Bauer) method was used for the evaluation of antibiotic resistance by culturing the isolates on the Mueller-Hinton agar medium. Using following antibiotic discs: including tetracycline (30 µg), imipenem (10 µg), gentamicin (10 µg), colistin (10 µg), amikacin (30 µg), ceftazidime (20 µg), cefotaxime (30 µg), ceftriaxone (30 µg), nitrofurantoin (32 µg), aztreonam (30µg), fosfomycin (32 µg), azithromycin (15 µg), and piperacillin/tazobactam (100.10 μg) .The newly cultured isolated colonies (16-24 hours) were dissolved in sterile saline to obtain the desired homogeneous suspension in comparison to McFarland 0.5 standard unit. Then, the suspension was cultured on Mueller-Hinton agar whole surfaces and the antibiotic discs were placed at regular intervals (7 discs per plate and 2 plates per microbe were used). After incubating the plates for 18-24 hours at 37 °C, the diameter of the growth inhibition zone was investigated. The diameters of the antibiogram growth inhibition zones were measured according to the CLSI guidelines and the strains were classified based on how they reacted to each drug into three groups: sensitive, semi-sensitive, and resistant. The minimum inhibitory concentration (MIC) for colistin was also measured by Vitek systems [25-26].

ESBL screening by Combined Disk Test (CDT)

K. pneumoniae isolates strains resistance to third generation cephalosporin, suspected as ESBLs producers were tested by the Combined Disc Test (CDT). Using 0.5 McFarland turbidity standards, a proper bacterial suspension was prepared from newly grown (16-24 hours) colonies of isolates and cultured on Mueller-Hinton agar using a sterile cotton swab. Afterward, discs containing ceftazidime (30 μg), cefotaxime (30 μg) and cefepime (30 μg), and ceftazidime + clavulanic acid (30 μg/ 10 μg), cefotaxime (30 μg) + clavulanic acid (30 μg/10 μg) and cefepime (30 μg) + clavulanic acid (30 μg/10 μg) were used. The antibiotic discs were placed on the Mueller- Hinton agar and the plates were incubated at 37 °C for 18-24 hours. After incubation, the diameter of the growth inhibition zone around the cephalosporin discs with and without clavulanic acid was measured and compared. An increase in the inhibition zone diameter of > 5mm was proved as ESBLs production [27].

Modified Hodge Test (MHT) for detection of carbapenemase (KPC)-producing isolates

The modified Hodge Test (MHT) assay is a simple phenotypic test to detect the presence of the carbapenemase enzyme in bacteria [28]. Thus, based on a 0.5 McFarland turbidity standard, a suspension of E. coli ATCC 25922 was prepared in 5 ml of Mueller-Hinton broth or saline. The E. coli ATCC 25922 suspension was then diluted 1:10 by adding 0.5 ml of it to 4.5 ml of Mueller-Hinton broth or saline. Next, a bacterial grass culture was performed from the diluted solution on Mueller-Hinton agar and dried for 3-5 minutes at room temperature. A disc of meropenem (10 μg) or ertapenem (10 μg) was then placed in the center of the plate. In a straight line, from the edge of the disc to the edge of the plate, the desired isolate was cultured. The same procedure was repeated for the other isolate in another direction. Three organisms were examined on each plate. Incubation was performed overnight at 35 °C for 24 hours. Then, the presence of cloverleaf was examined at the intersection of the studied organism and E. coli 25922 in the growth inhibition zone, indicating a positive result [29, 30].

DNA extraction

The bacterial genome was extracted using the boiling method. The bacteria were firstly cultured in 10 ml of BHI broth medium and incubated overnight. After examining the turbidity of tubes at 600 nm, proper OD was ≥4 for genome extraction. The culture media were transferred to 2 ml microtubes and centrifuged at 9000 rpm for 10 minutes. Then, the supernatant was rinsed out and 400 mL of distilled water was added, followed by boiling for 15 minutes at 100 °C in a Bain-Marie bath. The microtubes were centrifuged again for 10 minutes at 6000 rpm, and 100 μl of the supernatant, known as the extracted genome, was collected using a sampler and transferred to a new microtube. Finally, the DNA adsorption rate was investigated using a spectrophotometer at 260 nm, and extracted genomes was stored at -20 ° C [31].

Molecular detection of antibiotic resistance and virulence genes by Polymerase Chain Reaction (PCR)

In this study, the detection of genes involved in antibiotic resistance and virulence, including bla_CTX-M, bla_SHV, bla_TEM, bla_KPC, bla_NDM, aac (6’)-Ib,armA, IrP-1, rmpA, magA, mrkD were investigated using PCR. All the primers used in this study are listed in Table 1. The PCR protocols were performed according to the manufacturer's instructions (Amplicon 2X). The PCR products were loaded on 1% agarose gel and the green bands were observed by UV light and it was analyzed using a gel documentation system [23]. Lane M was contained DNA marker (100 bp DNA ladder) for a faster identification of PCR products or amplicons. Then, the electrophoresis was performed with a potential difference of 80 volts for one hour and the stained gels were inspected using a Bio-Rad Gel Doc EZ Imager (Bio-Rad, VIC, AUS).

Table 1. Sequences of primers used in the study.

Target genes	Primer Sequence (5′→ 3′)	Amplicon size (bp)	Tm °C	Reference
bla_CTX-M	For: TTTGCGAGTGCAGTACCAGTAA Rev: CTCCCCTGCCGGTTTTATC	519	56	59
bla_SHV	For: TTAACTCCCTGTTAGCCA Rev: GATTTGCTGATTTCGCCC	796	57	60
bla_TEM	For: ATGAGTATTCAACATTTCCG Rev: CTGACAGTTACCAATGCTTA	867	55	60
bla_KPC	For: ATGTCACTGTATCGCCGTCT Rev: TTTTCAGAGCCTTACTGCCC	893	58	61
bla_NDM	For: GGTTTGGCGATCTGGTTTTC Rev: CGGAATGGCTCATCACGATC	1113	55	62
aac (6’)-Ib	For: ATGACTGAGCATGACCTTG Rev: AACCATGTACACGGCTGG	484	56	63
ArmA	For: CCGAAATGACAGTTCCTATC Rev: GAAAATGAGTGCCTTGGAGG	846	58	64
Irp-1	For: TGAATCGCGGGTGTCTTATGC Rev: TCCCTCAATAAAGCCCACGCT	238	60	55
RmpA	For: ACTGGGCTACCTCTGCTTCA Rev: CTTGCATGAGCCATCTTTCA	531	58	65
MagA	For: GGTGCTCTTTACATCATTGC Rev: GCAATGGCCATTTGCGTTAG	1238	56	66
MrkD	For: CCACCAACTATTCCCTCGAA Rev: ATGGAACCCACATCGACATT	226	56	55

Molecular typing

The molecular relationship and genetic diversity of the isolates was determined by ERIC-PCR using the primers ERIC-F (5'-ATGTAAGCTCCTGGGGATTCAC-3') and ERIC-R (5'-AAGTAAGTGACTGGGGTGAGCG-3'). ERIC-PCR reactions were prepared in a volume of 25 μl, including 1 μl of each primer (final concentration 2 pmol / μl), 12.5 μl of Master Mix (Applied Biosystem), 9.5 μl of deionized water, and 4 μl of pattern DNA. At the beginning of the ERIC-PCR reaction to denature the template DNA strands, 95 °C was applied for 5 min and then the target DNA sequences were proliferated during 30 cycles including denaturation at 92 °C for 30 s; annealing at 52 °C for 1min; extension at 65 °C for 8 min; Also, a final extension step at 65 °C for 8 min and final storage at 4 °C. The ERIC-PCR reaction products were evaluated on 1.5% agarose gel [32,33]. Comparison of ERIC-PCR patterns was performed. The presence of a band with the number 1 and the absence of a band with the number 0 were encoded in a matrix. Analysis of ERIC-PCR typing results was done according to the number and weight of bands observed in the product electrophoresis of each sample. Finally the Amplification of the products which had been run, was drawn with the UPGMA algorithm on these websites: /http://insilico.ehu.es/dice_upgma, http://genomes.urv.cat/UPGMA/index.php [34,35].

Bacterial strains and antibiotic susceptibility profile

Based on the primary culture results of the samples, 84 specimens were identified as K. pneumonia. The results of antimicrobial susceptibility tests indicated the highest resistance against ceftriaxone (65%), cefotaxime (64%) and Fosfomycin (60%), respectively. The lowest levels of resistance were observed for colistin (23%), nitrofurantoin (25%), imipenem (28%) and azithromycin (32%), respectively. The Table 2 represents the complete results of all antibiotic disk tested in this study. More than 50% of the strains were multidrug resistance (MDR).

Table 2. Antibiotic susceptibility pattern of K. pneumoniae isolates based on CLSI (n = 84).

Sensitive no (%)	Semi-sensitive no	Resistant no (%)	Antibiotics
50(59)	5	29(34)	Amikacin
26(30)	7	51(60)	Fosfomycin
34(40)	4	46(54)	Aztreonam
54(64)	1	29(34)	Tetracycline
28(33)	1	55(65)	Ceftriaxone
31(36)	4	49(58)	Ceftazidime
29(34)	1	54(64)	Cefotaxime
57(67)	0	27(32)	Azithromycin
64(76)	0	20(23)	colistin
55(65)	5	24(28)	Imipenem
56(66)	7	21(25)	Nitrofurantoin
44(52)	2	38(45)	Gentamicin
42(50)	3	36(42)	Piperacillin / Tazobactam

Phenotypic detection of ESBL and carbapenemase producing K. pneumoniae

The results of the combined disk test indicated that out of 52 third generation cephalosporin resistant isolates, 27 (52 %) were ESBL positive. On the other hand, the results of MHT test revealed that, out of 24 samples resistant to imipenem and meropenem, 15 (62.5%) K. pneumoniae isolates were carbapenems-positive with the ability to produce carbapenems enzymes.

Virulence factorsand antibiotic resistance -associated genes

Out of 84 samples, 81 isolates (96%), 79 isolates (94%) and 77 isolates (91%) had bla_CTX-M, bla_SHV and bla_TEM, genes respectively. Which most of these genes were observed in all resistance isolates. Additionally, our results showed that among the genes involved in KPC resistance, bla_KPC was positive in 60 isolates (71%), of which 34 cases were among 36 resistant samples. The bla_NDM gene was also detected in 50 strains (60%), so that 33 of the 36 resistant samples had bla_NDM gene. Our data indicated that bla_KPC and bla_NDM genes had almost the same incidence among resistant K. pneumoniae, and there was no significant difference in their frequency (Fig. 1-2).

Examination of the genes involved in aminoglycoside resistance resulted in the detection of the Aac6-Ib gene in 76 isolates (90%), so that out of 36 resistant isolates, 34 samples were positive. Furthermore, the armA gene was identified in 60 samples (71%), where 30 cases of which were among 36 resistant strains. We found that the Aac6-Ib and armA genes had a high frequency among resistant specimens, while Aac6-Ib was meaningfully ample than the armA gene (Table 3, Fig. 1).

Findings related to virulence genes showed that 50 isolates (60%) were positive for Irp-1 gene, which was 34 out of 36 resistant samples. 70 samples (83%) were positive for rmpA gene, in this way, out of 36 resistant samples, 32 positive isolates were found. Moreover, in terms of the magA gene, 10 samples (11%) were positive with 6 cases related to the resistant strains. The mrkD gene was also positive in 79 samples (94%), so that out of 36 resistant isolates, 31 samples were positive. Our findings demonstrated that mrkD, rmpA, Irp-1 and magA genes had the highest frequency among resistant strains, respectively, where mrkD was significantly more abundant compared to the other tested genes (Table 3, Fig. 1-2).

Table 3. The frequency of virulence and antibiotic resistance genes in the tested samples.

Genes	All isolates (n=84) (%)	Resistant isolates(n=36) (%)
ESBL resistance	—
**bla_CTX-M**	(81)96%	35<96%
**bla_SHV**	(79)94%	35<96%
**bla_TEM**	(77)91%	35<96%
KPC resistance	—
**bla_KPC**	(60)71%	(34)94%
**bla_NDM**	(50)60%	(33)91%
Aminoglycoside resistance	—
*aac(6’)-Ib*	(76)90%	(34)94%
*armA*	(60)71%	(30)83%
Virulence genes	—
*mrkD*	(79)94%	(31)86%
*rmpA*	(70)83%	(32)88%
*IrP-1*	(50)60%	(34)94%
*magA*	(10)11%	(6)16%

Genotyping of K. pneumoniae isolates by ERIC-PCR analyses

ERIC-PCR differentiated the isolates into four clusters, G1- G4, with 70% similarity (Figure 3). In the strains that were studied, the maximum number, 40, belonged to the G4 cluster, and the minimum, 8, belonged to the G3 cluster. Ten of the studied strains were in G2, and 26 strains in the G1 cluster (Figure 3, 4).

The present survey revealed that the picture of the antibiotic resistance, virulence and genetic relationship between clinical strains of K. pneumoniae recovered from the patients admitted to the 12^th Bahman Hospital and other laboratories in Shahr-e-Qods. K. pneumoniae causes several types of infections in humans, including respiratory, bloodstream and urinary tract infections (UTIs), which are commonly seen in hospitalized or immunocompromised patients [36,37]. These infections are often treated with beta-lactams and other effective antibiotics against Enterobacteriaceae. Nevertheless, the antibiotic-resistant and highly pathogenic species of K. pneumoniae are rapidly spreading around the world [38]. Bacterial resistance depends vastly on populational and geographical factors. Thus, the body of different people can provide different environments for the bacteria to grow, multiply and be affected by the drugs [39]. Therefore, the study of bacterial resistance in a specific population can provide an appropriate overview of effective drugs for the healthcare staff to provide an effective antibiotic regimen to ensure improved recovery of patients.

Our findings demonstrated that out of 84 isolates identified as K. pneumoniae, more than 50% of the samples had multi-drug resistance, with the highest resistance against ceftriaxone, cefotaxime and Fosfomycin, respectively. Notably, in the tested isolates we observed a high susceptibility to colistin, nitrofurantoin, azithromycin, imipenem, and tetracycline. In line with the present study, Rocha et al., [40] reported that K. pneumoniae ESBL-positive isolates sampled from ICU patients showed the highest resistance to ceftriaxone. Kim Det al., [41] found that the resistance rates of Klebsiella pneumoniae to cefotaxime, cefepime, and carbapenem were 38-41%, 33-41%, and <0.1-2%, respectively, from 2013 to 2015. According to them, all isolates are sensitive to imipenem. The highest susceptibility was reported to gentamicin and piperacillin/tazobactam, respectively. In a different report compared to our results, the highest sensitivity was observed against ceftriaxone, ciprofloxacin and gentamicin, respectively. However, in the present study, the highest resistance was to ceftriaxone [42].

Moreover, our results of the combined disk test indicated that out of 52 resistant samples, 27 (52%) cases were positive for ESBL, almost corroborating evidence with the findings of a study by Rupinder et al., [43] who stated that ESBL production was observed in 48% of E. coli, 44% of K. pneumoniae and 50% of P. aeruginosa isolates in a tertiary hospital in Patiala, Punjab. While according to studies conducted in Iraq, 81.39% of K. pneumoniae isolates were ESBL producers [44]. This discrepancy between the reported frequencies can be due to the geographical diversity, the type of strains and the isolation under study or other different reasons.

The results of the genes involved in ESBL resistance showed that the prevalence of bla_CTX-M, bla_SHV and bla_TEM genes out of 84 samples were 81 (96%), 79 (94%) and 77(91%), respectively. Therefore, the highest frequency was related to bla_CTX-M gene. In the study of Pishtiwan et al., [45] the frequency of bla_TEM, bla_SHV and bla_CTX-M genes was 64.7%, 35.2% and 41.1%, respectively. Also, according to Ugbo et al., [46] the prevalence of bla_SHV, bla_TEM and bla_CTX-M was identified to be 55%, 35% and 45% respectively. These values were lower than the percentages of the present study and these results disagreed with the reports of studies by Bajpai et al., [47] in which the gene that predominated was bla_TEM (48.7%), followed by bla_TEM (7.6%) and bla_SHV (5.1%). It is worth mentioning that the genotypic approach can be the method of choice for distinguishing ESBL-producing strains from Enterobacteriaceae because phenotypic tests for ESBL detection only confirm ESBL production.

Analysis of the detection of KPC resistance genes showed that bla_KPC (71%) was ampler than bla_NDM (60%) without any significant differences in resistant species. Liu et al., [48] stated that among the tested isolates of K. pneumoniae,bla_NDMand bla_KPC genes had the highest frequency, respectively. This discrepancy may be attributed to genetic variations among strains associated with human populations and antibiotic regimens. In accordance with our data, Xiufeng et al., [49] reported that bla_KPC and bla_NDM were highly detected in carbapenems-resistant K. pneumoniae samples isolated from a Chinese hospital.

In the case of genes involved in aminoglycoside resistance, the Aac6-Ib and armA genes had a frequency of 90% and 71%, respectively, while among the resistant samples, Aac6-Ib was the most frequently detected gene. Aligned with our results, Cirit et al., [50] also reported Aac6-Ib to have the highest frequency among the genes involved in aminoglycoside resistance in nosocomial K. pneumoniae isolates. A study of highly aminoglycoside-resistant K. pneumoniae and Klebsiella oxytoca from an inpatient in Okinawa, Japan, with no known history of travelling overseas was accomplished. Genome sequencing analysis showed that these isolates harbored armA, which encodes a 16S rRNA methylase, ArmA, that confers pan-aminoglycoside resistance [51]. In a study conducted by Li et al., [52] in China, out of 223 isolates of K. pneumoniae, 13 isolates (5.8%) contained armA and 8 isolates (3.6%) contained rmtB. 110 isolates of K. pneumoniae were phenotypically resistant and after PCR, 11.8% of the isolates contained armA gene and 7.3% of the strains contained rmtB gene. These values are lower than our findings about the armA gene.

According to the results of the modified Hodge test, out of 24 samples resistant to imipenem and meropenem, 15 (62.5%) samples were positive for carbapenems. Examination of virulence genes showed that among 84 samples, mrkD, rmpA, Irp-1 and magA genes showed the frequency of 94%, 83%, 60% and 11%, respectively; among 36 resistant samples, mrkD, rmpA, Irp-1 and magA genes have the highest frequency, respectively, while mrkD was significantly more abundant compared to the other genes. Based on these data, mrkD is evidently highly associated with multidrug resistance. In line with our findings, Liu et al., [53] identified mrkD as the most common virulence gene with the prevalence of 100%. In 2004, an initial study of the magA gene was performed by Fang et al., [54] who identified the gene as a virulence factor in the pathogenesis of K. pneumoniae. In this study, the magA gene was observed in 52 invasive strains (liver abscesses) and 15 non-invasive strains. El Fertas-Aissani et al., [55] obtained the opposite result from the present report. In this regard none of the studied strains carried the magA gene. They also examined the rmpA gene, which contained 3.7% of the 54 strains of K. pneumoniae isolated from different clinical specimens, which is a lower percentage than the present study. In another study, Liu et al., [48] reported that rmpA and magA were the most abundant genes among the 117 isolates of K. pneumoniae, respectively, and Fu et al., [56] observed the same frequency of genes in their study.

Since the presence of some virulence factors can be involved in the pathogenicity of bacteria, knowledge of the existence of these factors and their prevalence can be a good way to identify and treat the studied strain. The phylogenetic tree was drawn based on the UPGMA algorithm and the genetic relationship between the isolates was identified, which the isolates were differentiated into four clusters, G1- G4, with 70% similarity. Moreover, in the strains that were studied, the maximum number, 40, belonged to the G4 cluster, and the minimum, 8, belonged to the G3 cluster.

According to the research of Ferreira et al., [57] the dendrogram obtained from ERIC-PCR results showed a genetic relationship between 25 K. pneumoniae studied. In their study, the clusters were determined using the method (UPGMA) and dice’s similarity coefficient. Based on this, it was found that although the bacteria were isolated from different patients, K. pneumoniae in the bloodstream had a high genetic relationship with each other. In studies by Firmo et al., [34] ERIC-PCR analysis of 16 isolates of K. pneumoniae showed that only three isolates (18.8%) (K4-R3, K6-R3 and K7-R3) present a single band pattern, which is 100% genetically similar, i.e. there was a clonal relationship. The other 13 isolates of K. pneumoniae presented heterogeneous profiles with a maximum of 40% similarity. El-Badawy et al., [58] showed that most isolates have different origins by genotyping K. pneumoniae isolates using ERIC-PCR method. 32 isolates belonged to 18 different single roots, indicating that the prevalence of K. pneumoniae in different parts of the hospital was due to poor infection control.

The results of the present study revealed that the high prevalence of resistance strains of K. pneumoniae. The highest resistance was observed to ceftriaxone, cefotaxime and Fosfomycin and the lowest resistance was reported against colistin, nitrofurantoin, emipenem and azithromycin, respectively. Furthermore, the bla_CTX, bla_KPC, Aac6-Ib and mrkD seemed to be the most highly associated genes with multidrug resistance. The high prevalence of antibiotic resistance and virulence genes in conjuction with a significant relationship between the strains reveals a high pathogenic capacity of the isolated pathotypes of K. pneumoniae.

Our findings demonstrated a direct relationship between the frequency of the genes involved in the development of virulence and resistance and also can provide a highly effective model for physicians of relevant medical centers to prescribe more suitable antibiotic regimens aimed at improved clinical efficiency and faster recovery of patients. These findings emphasize the choose of more effective antibiotic regimens for treatment of infections caused by K. pneumonia.

Acknowledgement

Thanks to guidance and advice from “Clinical Research Development Unit of Baqiyatallah Hospital”. Research reported in this publication was supported by Elite Researcher Grant Committee under award number 982964 from the National Institutes for Medical Research Development (NIMAD), Tehran, Iran.

Ethics approval and consent to participate

This study was approved based on ethic code: IR.NI.1398.172

Consent for publication

The authors have confirmed that informed consent was obtained from all patients.

Availability of data and materials

All data generated or analyzed during this study are included in this published article.

Competing interests

The authors declare that they have no competing interests in this section.

Funding

Research reported in this publication was supported by Elite Researcher Grant Committee under award number [982964] from the National Institutes for Medical Research Development (NIMAD), Tehran, Iran.

Authors' contributions

MA performed laboratory analysis and drafted all sections of the text. PB revised the first round of manuscript. RR designed the study and revised the manuscript. All authors had full access to all of the data (including statistical reports and tables) in the study and can take responsibility for the integrity of the data and the accuracy of the data analysis. All authors read and approved the final manuscript.

Acknowledgements

Thanks to guidance and advice from "Clinical Research Development Unit of Baqiyatallah Hospital", Tehran, Iran.

Lee CR, Lee JH, Park KS, Jeon JH, Kim YB, Cha CJ, Jeong BC, Lee SH. Antimicrobial resistance of hypervirulent K. pneumoniae: epidemiology, hypervirulence-associated determinants, and resistance mechanisms. Frontiers in cellular and infection microbiology. 2017 Nov 21;7:483.
Navon-Venezia S, Kondratyeva K, Carattoli A. K. pneumoniae: a major worldwide source and shuttle for antibiotic resistance. FEMS microbiology reviews. 2017 May 1;41(3):252-75.
Martin RM, Bachman MA. Colonization, infection, and the accessory genome of K. pneumoniae. Frontiers in cellular and infection microbiology. 2018 Jan 22;8:4.
Aljanaby AA, Alhasani AH. Virulence factors and antibiotic susceptibility patterns of multidrug resistance K. pneumoniae isolated from different clinical infections. African Journal of Microbiology Research. 2016 Jun 14;10(22):829-43.
Feretzakis G, Loupelis E, Sakagianni A, Skarmoutsou N, Michelidou S, Velentza A, Martsoukou M, Valakis K, Petropoulou S, Koutalas E. A 2-Year Single-Centre Audit on Antibiotic Resistance of Pseudomonas aeruginosa, Acinetobacter baumannii and K. pneumoniae Strains from an Intensive Care Unit and Other Wards in a General Public Hospital in Greece. Antibiotics. 2019 Jun;8(2):62.
Vuotto C, Longo F, Pascolini C, Donelli G, Balice MP, Libori MF, Tiracchia V, Salvia A, Varaldo PE. Biofilm formation and antibiotic resistance in K. pneumoniae urinary strains. Journal of applied microbiology. 2017 Oct;123(4):1003-18.
Ranjbar R, Izadi M, Hafshejani TT, Khamesipour F. Molecular detection and antimicrobial resistance of Klebsiella pneumoniae from house flies (Musca domestica) in kitchens, farms, hospitals and slaughterhouses. J Infect Public Health. 2016 Jul-Aug;9(4):499-505.
Cheng YH, Lin TL, Pan YJ, Wang YP, Lin YT, Wang JT. Colistin resistance mechanisms in K. pneumoniae strains from Taiwan. Antimicrobial agents and chemotherapy. 2015 May 1;59(5):2909-13.
Kieffer N, Nordmann P, Millemann Y, Poirel L. Functional characterization of a Miniature Inverted Transposable Element at the origin of mcr-5 gene acquisition in Escherichia coli. Antimicrobial agents and chemotherapy. 2019 Jul 1;63(7): e00559-19.
Shamina OV, Kryzhanovskaya OA, Lazareva AV, Alyabieva NM, Polikarpova SV, Karaseva OV, Mayanskiy NA. Emergence of a ST307 clone carrying a novel insertion element MITEKpn1 in the mgrB gene among carbapenem-resistant K. pneumoniae from Moscow, Russia. International Journal of Antimicrobial Agents. 2020 Feb 1;55(2):105850.
Zhang J, Zhou K, Zheng B, Zhao L, Shen P, Ji J, Wei Z, Li L, Zhou J, Xiao Y. High prevalence of ESBL-producing K. pneumoniae causing community-onset infections in China. Frontiers in microbiology. 2016 Nov 15;7:1830.
Popejoy MW, Paterson DL, Cloutier D, Huntington JA, Miller B, Bliss CA, Steenbergen JN, Hershberger E, Umeh O, Kaye KS. Efficacy of ceftolozane/tazobactam against urinary tract and intra-abdominal infections caused by ESBL-producing Escherichia coli and K. pneumoniae: a pooled analysis of Phase 3 clinical trials. Journal of Antimicrobial Chemotherapy. 2016 Oct 5;72(1):268-72.
Ghafourian S, Bin Sekawi Z, Sadeghifard N, Mohebi R, Kumari Neela V, Maleki A, Hematian A, Rhabar M, Raftari M, Ranjbar R. The Prevalence of ESBLs Producing Klebsiella pneumoniae Isolates in Some Major Hospitals, Iran. Open Microbiol J. 2011;5:91-5.
Dehshiri M, Khoramrooz SS, Zoladl M, Khosravani SA, Parhizgari N, Motazedian MH, Jahedi S, Sharifi A. The frequency of Klebsiella pneumonia encoding genes for CTX-M, TEM-1 and SHV-1 extended-spectrum beta lactamases enzymes isolated from urinary tract infection. Annals of clinical microbiology and antimicrobials. 2018 Dec 1;17(1):4.
Yazdansetad S, Alkhudhairy MK, Najafpour R, Farajtabrizi E, Al-Mosawi RM, Saki M, Jafarzadeh E, Izadpour F, Ameri A. Preliminary survey of extended-spectrum β-lactamases (ESBLs) in nosocomial uropathogen K. pneumoniae in north-central Iran. Heliyon. 2019 Sep 1;5(9): e02349.
Ranjbar R, Memariani H, Sorouri R, Memariani M. Distribution of virulence genes and genotyping of CTX-M-15-producing Klebsiella pneumoniae isolated from patients with community-acquired urinary tract infection (CA-UTI). Microb Pathog. 2016 Nov; 100:244-249.
Sattar H, Toleman M, Nahid F, Zahra R. Co-existence of bla NDM-1 and bla KPC-2 in clinical isolates of K. pneumoniae from Pakistan. Journal of chemotherapy. 2016 Jul 3;28(4):346-9.
Abdalhamid B, Elhadi N, Albunayan S, Alsamman K, Aljindan R. First description of methyltransferases in extensively drug-resistant K. pneumoniae isolates from Saudi Arabia. Journal of Medical Microbiology. 2017 Jul 1;66(7):859-63.
Zhang C, Xu X, Pu S, Huang S, Sun J, Yang S, Zhang L. Characterization of carbapenemases, extended spectrum β-lactamases, quinolone resistance and aminoglycoside resistance determinants in carbapenem-non-susceptible Escherichia coli from a teaching hospital in Chongqing, Southwest China. Infection, Genetics and Evolution. 2014 Oct 1;27:271-6.
Ranjbar R, Kelishadrokhi AF, Chehelgerdi M. Molecular characterization, serotypes and phenotypic and genotypic evaluation of antibiotic resistance of the Klebsiella pneumoniae strains isolated from different types of hospital-acquired infections and drug resistance. 2019;12:603.
Wiskur BJ, Hunt JJ, Callegan MC. Hypermucoviscosity as a virulence factor in experimental Klebsiella pneumoniae endophthalmitis. Investigative ophthalmology & visual science. 2008 Nov 1;49(11):4931-8.
Overmars, L., van Hijum, S. A., Siezen, R. J., & Francke, C. Identification and global characterization of repeated sequences in prokaryotic genomes.THE PLASTICITY OF PROKARYOTIC REGULATORY ELEMENTS, 57.
Ranjbar R, Tabatabaee A, Behzadi P, Kheiri R. Enterobacterial repetitive intergenic consensus polymerase chain reaction (ERIC-PCR) genotyping of escherichia coli strains isolated from different animal stool specimens. Iranian journal of pathology. 2017;12(1):25.
Ramazanzadeh R, Rouhi S, Hosainzadegan H, Shakib P, Nouri B. Co-occurrence of Extended-Spectrum Beta-Lactamases in isolated Enterobacter spp. From patient specimens. Archives of Clinical Infectious Diseases. 2016 Jul 1;11(3).
Akhi MT, Ghotaslou R, Beheshtirouy S, Asgharzadeh M, Pirzadeh T, Asghari B, Alizadeh N, Ostadgavahi AT, Somesaraei VS, Memar MY. Antibiotic susceptibility pattern of aerobic and anaerobic bacteria isolated from surgical site infection of hospitalized patients. Jundishapur journal of microbiology. 2015 Jul;8(7).
Bakhshi M, Zandi H, Bafghi MF, Astani A, Ranjbar VR, Vakili M. A survey for phylogenetic relationship; presence of virulence genes and antibiotic resistance patterns of avian pathogenic and uropathogenic Escherichia coli isolated from poultry and humans in Yazd, Iran. Gene Reports. 2020 May 20:100725.
Teklu DS, Negeri AA, Legese MH, Bedada TL, Woldemariam HK, Tullu KD. Extended-spectrum beta-lactamase production and multi-drug resistance among Enterobacteriaceae isolated in Addis Ababa, Ethiopia. Antimicrobial Resistance & Infection Control. 2019 Dec 1;8(1):39.
Yamada, Kageto, Machiko Kashiwa, Katsumi Arai, Noriyuki Nagano, and Ryoichi Saito. "Comparison of the Modified-Hodge test, Carba NP test, and carbapenem inactivation method as screening methods for carbapenemase-producing Enterobacteriaceae." Journal of microbiological methods 128 (2016): 48-51.
Al-Bayssari C, Dabboussi F, Hamze M, Rolain JM. Detection of expanded-spectrum β-lactamases in Gram-negative bacteria in the 21st century. Expert review of anti-infective therapy. 2015 Sep 2;13(9):1139-58.
Pasteran F, Gonzalez LJ, Albornoz E, Bahr G, Vila AJ, Corso A. Triton Hodge test: improved protocol for modified Hodge test for enhanced detection of NDM and other carbapenemase producers. Journal of clinical microbiology. 2016 Mar 1;54(3):640-9.
Ranjbar R, Ahmadi M, Memariani M. Multiple-locus variable-number tandem repeat analysis (MLVA) for genotyping of Salmonella enterica subspecies enterica serotype Infantis isolated from human sources. Microbial Pathogenesis, 2016;100:299-304.
Ranjbar R, Rahbar M, Naghoni A, Farshad S, Davari A, Shahcheraghi F. A cholera outbreak associated with drinking contaminated well water. (2011): 339-340
Versalovic J, Koeuth T, Lupski R. Distribution of repetitive DNA sequences in eubacteria and application to fingerprinting of bacterial enomes. Nucleic Acids Res.1991;19(24):6823-6831.
Firmo EF, Beltrão EM, da Silva FR, Alves LC, Brayner FA, Veras DL, Lopes AC. Association of blaNDM-1 with blaKPC-2 and aminoglycoside-modifying enzyme genes among Klebsiella pneumoniae, Proteus mirabilis and Serratia marcescens clinical isolates in Brazil. Journal of Global Antimicrobial Resistance. 2020 Jun 1;21:255-61.
Ranjbar R, Pezeshknejad P, Khamesipour F, Amini K, Kheiri R. Genomic fingerprints of Escherichia coli strains isolated from surface water in Alborz province, Iran. BMC Res Notes. 2017 Jul 20;10(1):295.
Doosti, Abbas, Mohammad Pourabbas, Asghar Arshi, Mohammad Chehelgerdi, and Hamidreza Kabiri. "TEM and SHV genes in K. pneumoniae isolated from cockroaches and their antimicrobial resistance pattern." Osong public health and research perspectives 6, no. 1 (2015): 3-8.
Bassetti M, Giacobbe DR, Giamarellou H, Viscoli C, Daikos GL, Dimopoulos G, De Rosa FG, Giamarellos-Bourboulis EJ, Rossolini GM, Righi E, Karaiskos I. Management of KPC-producing K. pneumoniae infections. Clinical Microbiology and Infection. 2018 Feb 1;24(2):133-44.
Navon-Venezia S, Kondratyeva K, Carattoli A. K. pneumoniae: a major worldwide source and shuttle for antibiotic resistance. FEMS microbiology reviews. 2017 May 1;41(3):252-75.
Nikkhoi, Shahryar Khoshtinat, Fatemeh Rahbarizadeh, Davoud Ahmadvand, and Seyed Moein Moghimi. "Multivalent targeting and killing of HER2 overexpressing breast carcinoma cells with methotrexate-encapsulated tetra-specific non-overlapping variable domain heavy chain anti-HER2 antibody-PEG-liposomes: in vitro proof-of-concept." European Journal of Pharmaceutical Sciences 122 (2018): 42-50.
Rocha, Francisco Ruliglésio, Lorena Cristina Corrêa Fehlberg, Jhonatha Rodrigo Cordeiro-Moura, Ana Carolina Ramos, Vicente de Paulo Teixeira Pinto, and Francisco Cesar Barroso Barbosa. "High Frequency of Extended-Spectrum Beta-Lactamase-Producing K. pneumoniae Nosocomial Strains Isolated from a Teaching Hospital in Brazil." Microbial Drug Resistance25, no. 6 (2019): 909-914.
Roy J, Nag DC, Nessa L, Rouf MA, Sarkar NK, Saha NR, Hossain M. Antibiogram and Extended Spectrum Beta-lactamase (ESBL) production among K. pneumoniae isolated from sputum. Chest & Heart Journal. 2016 Jan. Vol. 40, No. 1.\
Mas’ud A, Salwa SD. Antibiogram of K. pneumoniae among Pulmonary Tuberculosis Suspects Attending Infectious Diseases Hospital, Kano. Microbiology Research Journal International. 2018 Oct 29:1-9.
Rupinder B., Geeta W., Shikha J. Prevalence of extended spectrum β-lactamases in multidrug resistant strains of gram negative Bacilli. Acad. Indus. Res. 2013;1(9):558–560.
Aljanaby AA, Alhasnawi HM. Research Article Phenotypic and Molecular Characterization of Multidrug Resistant K. pneumoniae Isolated from Different Clinical Sources in Al-Najaf Province-Iraq. Pak. J. Biol. Sci. 2017;20(5):217-32.
Pishtiwan AH, Kadija KHM. Prevalence of blaTEM, blaSHV, and blaCTX-M Genes among ESBL-Producing Klebsiella pneumoniae and Escherichia coli Isolated from Thalassemia Patients in Erbil, Iraq. Mediterr J Hematol Infect Dis. 2019; 11(1): e2019041.
Ugbo E.N., Anyamene C.O., Moses I.B., Iroha I.R, Babalola O.O, Ukpai E.G, Emioye A.A, Udagu I.O. Prevalence of blaTEM, blaSHV, and blaCTX-M genes among extended spectrum beta-lactamase-producing Escherichia coli and Klebsiella pneumoniae of clinical origin. Gene Reports. 2020 Dec;21: 100909
Bajpai T, Pandey M, Varma M, Bhatambare GS. Prevalence of TEM, SHV, and CTX-M Beta-Lactamase genes in the urinary isolates of a tertiary care hospital. Avicenna journal of medicine. 2017 Jan;7(1):12.
Liu X, Zhang J, Li Y, Shen Q, Jiang W, Zhao K, He Y, Dai P, Nie Z, Xu X, Zhou Y. Diversity and frequency of resistance and virulence genes in blaKPC and blaNDM co-producing K. pneumoniae strains from China. Infection and Drug Resistance.2019;12:2819.
Xiufeng Z, Fangping L, Xiaohua L, Lisha M, Yixing L, Awan F, Weibiao L, Zhenling Z. Prevalence and global distribution of blaKPC-2 and blaNDM-1 genes in K. pneumoniae .bioRxiv. 2020 Jan 1.
Cirit, Osman Sezer, Marta Fernández-Martínez, Buket Yayla, and Luis Martínez-Martínez. "Aminoglycoside resistance determinants in multiresistant Escherichia coli and K. pneumoniae clinical isolates from Turkish and Syrian patients." Acta microbiologica et immunologica Hungarica 66, no. 3 (2019): 327-335.
Uechi K, Tada T, Shimada K, Nakasone I, Sonozaki T, Kirikae T, Fujita J. Emergence of ArmA, a 16S rRNA methylase in highly aminoglycoside-resistant clinical isolates of K. pneumoniae and Klebsiella oxytoca in Okinawa, Japan. Journal of Infection and Chemotherapy. 2018 Jan 1;24(1):68-70.
Li B, Yi Y, Wang Q, Woo PC, Tan L, Jing H, Gao GF, Liu CH. Analysis of drug resistance determinants in K. pneumoniae isolates from a tertiary-care hospital in Beijing, China. PloS one. 2012 Jul 31;7(7): e42280.
Liu Y, Du FL, Xiang TX, Wan LG, Wei DD, Cao XW, Zhang W. High Prevalence of Plasmid-Mediated Quinolone Resistance Determinants Among Serotype K1 Hypervirulent Klebsiella pneumoniae Isolates in China. Microbial Drug Resistance. 2019 Jun 1;25(5):681-9.
Fang CT, Chuang YP, Shun CT, Chang SC, Wang JT. A novel virulence gene in K. pneumoniae strains causing primary liver abscess and septic metastatic complications. The Journal of experimental medicine. 2004 Mar 1;199(5):697-705.
El Fertas-Aissani R, Messai Y, Alouache S, Bakour R. Virulence profiles and antibiotic susceptibility patterns of K. pneumoniae strains isolated from different clinical specimens. Pathologie Biologie. 2013 Oct 1;61(5):209-16.
Fu L, Huang M, Zhang X, Yang X, Liu Y, Zhang L, Zhang Z, Wang G, Zhou Y. Frequency of virulence factors in high biofilm formation blaKPC-2 producing K. pneumoniae strains from hospitals. Microbial pathogenesis. 2018 Mar 1;116:168-72.
Ferreira RL, da Silva B, Rezende GS, Nakamura-Silva R, Pitondo-Silva A, Campanini EB, Brito MC, da Silva EM, Freire CC, Cunha AF, Pranchevicius MC. High prevalence of multidrug-resistant Klebsiella pneumoniae harboring several virulence and β-lactamase encoding genes in a Brazilian intensive care unit. Frontiers in microbiology. 2019 Jan 22;9:3198.
El-Badawy MF, Tawakol WM, El-Far SW, Maghrabi IA, Al-Ghamdi SA, Mansy MS, Ashour MS, Shohayeb MM. Molecular identification of aminoglycoside-modifying enzymes and plasmid-mediated quinolone resistance genes among Klebsiella pneumoniae clinical isolates recovered from Egyptian patients. International journal of microbiology. 2017 May 30;2017.
Hajjar Soudeiha M., Dahdouh E., Daoud Z., Sarkis D.K. Phenotypic and genotypic detection of β-lactamases in Acinetobacter spp. isolates recovered from Lebanese patients over a 1-year period. Journal of Global Antimicrobial Resistance, 03 Oct 2017, 12:107-112.
Shahbandeh M, Taati Moghadam M, Mirnejad R. The Efficacy of AgNO3 Nanoparticles Alone and Conjugated with Imipenem for Combating Extensively Drug-Resistant Pseudomonas aeruginosa. International journal of Nanomedicine. 2020; 15: 6905–6916.
Tseng SP, Wang JT, Liang CY, Lee PS, Chen YC, Lu PL. First report of blaIMP-8 in Raoultella planticola. Antimicrobial agents and chemotherapy. 2014 Jan 1;58(1):593-5.
Poirel L, Walsh TR, Cuvillier V, Nordmann P. Multiplex PCR for detection of acquired carbapenemase genes. Diagnostic microbiology and infectious disease. 2011 May 1;70(1):119-23.
Barguigua A, El Otmani F, Talmi M, Bourjilat F, Haouzane F. ZeroualiK. Characterization of ESBL-producing Escherichia coli and K. pneumoniae isolates from community in Morocco. J Med Microbiol.2011;60:1344-52.
Hu X, Xu B, Yang Y, Liu D, Yang M, Wang J, Shen H, Zhou X, Ma X. A high throughput multiplex PCR assay for simultaneous detection of seven aminoglycoside-resistance genes in Enterobacteriaceae. BMC microbiology. 2013 Dec 1;13(1):58.
Siu LK, Fung CP, Chang FY, Lee N, Yeh KM, Koh TH, Ip M. Molecular typing and virulence analysis of serotype K1 K. pneumoniae strains isolated from liver abscess patients and stool samples from noninfectious subjects in Hong Kong, Singapore, and Taiwan. Journal of clinical microbiology. 2011 Nov 1;49(11):3761-5.
Yu WL, Ko WC, Cheng KC, Lee HC, Ke DS, Lee CC, Fung CP, Chuang YC. Association between rmpA and magA genes and clinical syndromes caused by K. pneumoniae in Taiwan. Clinical infectious diseases. 2006 May 15;42(10):1351-8.

Download PDF

Journal Publication

published 28 Oct, 2021

Read the published version in Expert Review of Anti-infective Therapy →

Version 1

posted

You are reading this latest preprint version

Virulence Factors, Antibiotic Resistance patterns, and Molecular Types of Clinical Isolates of Klebsiella Pneumoniae

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Materials And Methods

Results

Discussion

Conclusion

Declarations

References

Status:

Journal Publication

Version 1