Animals
The experiments were approved by Stony Brook University Institutional Animal Care and Use Committee (#277150). Adult male and female WT C57Bl/6 and FABP5 KO mice were kept on a 12:12-h light:dark cycle with ad libitum access to food and water. The mice were euthanized with isoflurane and BMDMs were isolated as described below.
Cell culture and SILAC labeling
BMDMs were obtained from the femur and tibia of 8 WT and 8 FABP5 KO mice as described previously (16, 17). The femur and tibia were cleaned with gauze and the ends of each bone removed. The bones were flushed with 1X DPBS (Gibco) to collect bone marrow in a sterile Falcon tube. The bone marrow samples were then processed with red blood cell lysis buffer Hybri-Max (Sigma, Cat. # R7757-100ML). Reagents from SILAC protein quantitation kit (ThermoFisher Scientific, Cat. # A33970) were used for cell culture media. Additionally, 13C615N4 L-Arginine-HCl was also used to supplement the BMDM SILAC media (ThermoFisher Scientific Cat. # 899990). The cells were incubated in open DMEM-F12 for 4 hours at 37°C and supernatant was collected from petri dishes to eliminate resident cells. The cells were incubated at 37°C, 5% CO2 with SILAC-BMDM medium containing 15% L-Cell Conditioned Media (LCM), 10% dialyzed FBS and 1% penicillin/streptomycin (Gibco) in DMEM-F12. SILAC media contained DMEM:F12, dialyzed fetal bovine serum (FBS), and either “light” (12C-K and -R) or “heavy” (13C6-K, 13C6-15N4-R) lysine and arginine. WT BMDMs were incubated in “light” while FABP5 KO BMDMs were incubated in “heavy” media at 37˚C, 5% CO2 for 7 days.
Polarization of macrophages
BMDMs were polarized into the M1-like condition by incubating the cells with 100 ng/mL LPS and 20 ng/mL IFNγ for 24 h. M2-like macrophages were polarized using 20 ng/mL IL-4 for 24 h. Unstimulated macrophages were given media replacements without any additional stimulatory agents. Following amino acid labeling, each polarized condition had a corresponding non-polarized condition that was run in parallel.
Cell Harvesting
Macrophages were washed with 1X DPBS. Cells were then harvested by scraping in lysis buffer containing 50 mM triethylammonium bicarbonate in 5% SDS supplemented with PhosSTOP phosphatase inhibitor tablet. Heavy and light SILAC labeled samples were combined and processed for protein and phosphopeptide analyses.
Total protein analysis preparation
For total protein analysis, 100 µL of cell lysates were reduced in 10 mM DTT at 55°C for 30 min, followed by alkylation in 25 mM iodoacetamide at room temperature in the dark for 30 min. Then, 10 µL of 12% phosphoric acid was added to the samples, followed by 7000 µL of S-Trap bind/wash buffer (90% methanol/50 mM TEAB) to produce a micro precipitate. The samples were then loaded on an S-Trap mini cartridge (cat. # K02-mini-10 Protifi), washed three times with S-Trap bind/wash buffer, followed by centrifugation at 4000 x g for 1 min. The samples were digested with trypsin (20 µg) in 50 mM TEAB in a humidified incubator overnight at 37°C. Peptides were eluted by sequential addition of 80 µL of 50 mM TEAB, 0.2% formic acid, and 50% acetonitrile, 0.2% formic acid, each followed by centrifugation at 4000 x g for 1 min. The samples were then dried by SpeedVac and resuspended in 200 µL of 0.1% trifluoroacetic acid (TFA) for desalting on HLB reverse phase cartridges (Waters) and eluted to generate 20% and 50% acetonitrile fractions.
Phospho-peptide analysis preparation
For phospho-peptide analysis, SILAC heavy- and light-labeled proteins were combined and precipitated as above in 1.1% phosphoric acid, 90% methanol/100 mM TEAB. The protein precipitates were centrifuged at 2000 x g for 10 minutes, transferred to a fresh microfuge tube, and washed five times with 90% methanol/50 mM TEAB. One milligram sample was digested with trypsin (100 µg) in 50 mM TEAB in a humidified incubator overnight at 37˚C. The peptides were acidified with 1% TFA, desalted on HLB reverse-phase cartridges with 50% ACN. The peptides were dried, and phospho-peptides were isolated by TiO2 affinity chromatography (10 µm beads; glsciences.com). The dried peptides were resuspended in 500 µL 0.1% TFA, 50% acetonitrile (ACN), and 1M lactic acid. Peptide samples were added using 30 mg TiO2 beads and mixed at 1000 rpm (Eppendorf Thermo mixer) at room temp for 90 min. The TiO2 beads were washed three times with 0.1% TFA, 50% acetonitrile (ACN). Phosphopeptides were eluted with 50 mM KH2PO4 pH 10.5 (pH adjusted with NH4OH), immediately neutralized with 5% formic acid, 50% acetonitrile, and lyophilized. Peptide fractions were desalted using HLB cartridges and eluted to generate 20% ACN and 50% ACN fractions. Dried phosphopeptides were resuspended in 0.1% FA and subjected to LC-MS/MS.
Mass spectrometry
Parent peptide mass, collision-induced fragment mass information, and peptide abundance values were obtained by liquid chromatography-electrospray ionization tandem mass spectrometry (LC-MS/MS) using an orbitrap instrument (Thermo Q-Exactive HF), followed by protein database searching. HPLC C18 columns were prepared using a P-2000 CO2 laser puller (Sutter Instruments) and silica tubing (100 µm ID × ∼20 cm), and they were self-packed with 3 µm Reprosil C18 resin. Peptides (~ 10 µg in a 1 µL injection volume) were separated using both 120-minute and 180-minute gradients. Gradient 1 (120 minutes) used a flow rate of 300 nL/min, with a gradient elution step of 0–40% acetonitrile (ACN) and 0.1% formic acid (0.23%/min) over 90utes, followed by a 40–60% ACN gradient over 15 minutes and a 10-minute wash with 90% ACN. Gradient 2 (180 minutes) was similar but used a 0–10% ACN gradient over 15 min, 10–45% over 140 min, 45–60% over 12 min, and 60–90% over 5 min.
Data processing and statistical analysis
Peptide identification and quantitation were performed using an orbital trap (Q-Exactive HF; Thermo) instrument, followed by protein database searching using Proteome Discoverer 2.4. Four technical replicates per sample were analyzed: both 20% ACN and 50% ACN fractions for eight LC-MS/MS runs per sample in total. Electrospray ionization was achieved using a spray voltage of ~ 2.2 kV. Information-dependent MS acquisitions were made using a survey scan covering m/z 375–1400 at 60,000 resolutions, followed by 'top 20' consecutive second product ion scans at 15,000 resolution. AGC targets for MS and MS/MS were 5e5 and 5e4, with a maximum IT of 100 ms and 50 ms, an MS/MS loop size of 20, and dynamic exclusion for 15 s. Mass resolution cutoffs for MS and MS/MS were 10 ppm and 0.05 Da, respectively. Data files were acquired with Xcalibur. Peptide alignments and quantitation were performed using Proteome Discoverer v2.4 software (Thermo). Protein false discovery rates experiments were binned at 0.01 and 0.05 FDR. Peptide and PSM FDR cutoffs were typically set to 0.01. Two missed tryptic cleavages were allowed, and modifications considered included static cysteine derivatization, and variable deamidation (NQ), water loss (ST), oxidation (M), phosphorylation (STY), and SILAC labels. Pairwise peptide ratios between heavy and light SILAC-labeled samples allowed t-test calculations based on the background population of peptides. The human UniProt dataset (73,101 entries) was used for data alignment. Fold change ratios of FABP5 KO (heavy) and WT (light) for each condition was obtained by matched peptide-based label-free quantitation, and p-values were calculated by Benjamini-Hochberg correction for FDR. Coefficients of variation between biological and technical replicates were used to measure subject variability and quality control, respectively. The data were obtained from eight biological and two technical replicates.
Proteomics and phosphoproteomics bioinformatics analysis
For non-SILAC proteomic analysis, grouped abundances of WT and KO were used separately to depict changes in expression at the protein level for each condition. Any blank values, excluding Arg1, were excluded from the list. SILAC provides further quantitative capabilities for proteomic and phosphoproteomic changes. This allows for changes to be quantified between the FABP5 KO and WT BMDMs. Thus, abundance ratios were quantified as FABP5 KO/WT (heavy/light). Proteins and phosphorylated proteins were considered statistically significant if log2 fold change (log2FC) > 1 and < -1 with a threshold of FDR adjusted p-value < 0.05. These differentially expressed proteins and phosphoproteins were depicted in a volcano plot, using R EnhancedVolcano package in Rstudio (18). The entire set of related proteins and phosphoproteins were used to perform gene set enrichment analysis (GSEA). The pathway enrichment analyses were performed using the clusterProfiler R package with gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) databases to associate the proteins and phosphoproteins with their functions and pathways (19, 20). GO analysis was performed through the gseGO function and KEGG analysis was performed with the gseKEGG function. The proteins and phosphoproteins were ranked based on log2 fold-change logarithmic values and adjusted p-value threshold of 0.05. Kinase enrichment analysis was performed with PhosphoSitePlus database and Maayan Lab Kinase Enrichment Analysis (KEA) (21, 22). The phosphorylation sites in correspondence to the FABP5 KO/WT phosphoproteins were used for PhosphoSitePlus analysis. These FABP5 KO/WT phosphopeptides were analyzed for kinase enrichment with a log2 fold change threshold of 1 and p-value threshold of 0.05. The KEA kinase network analysis was performed using an input list of FABP5 KO/WT proteins that had phosphorylated sites with log2 fold change threshold of |0.8|.
M1 and M2 qPCR Validation
RNA was extracted from WT and FABP5 BMDM samples, then cDNA synthesis was performed using SuperScript III First Strand Synthesis (ThermoFisher). qPCR was performed using PowerUp SYBR green (ThermoFisher) on a StepOnePlus instrumentation (Applied Biosystems). The following primers were used: β-actin, forward 5’-GACGGCCAGGTCATCACTAT-3’and reverse 5’-CGGATGTCAACGTCACACTT-3’; IL-1β, forward 5’- GCTTCAGGCAGGCAGTATC − 3’ and reverse 5’- AGGATGGGCTCTTCTTCAAAG − 3’; COX-2, forward 5’-AGGACTGGGCCATGGAGT-3’and reverse 5’-ACCTCTCCACCAATGACCTG-3’; TNFα, forward 5’-GAACTGGCAGAAGAGGCACT-3’ and reverse 5’-AGGGTCTGGGCCATAGAACT-3’; Arg-1, forward 5’-CTCCAAGCCAAAGTCCTTAGAG-3’ and reverse 5’-AGGAGCTGTCATTAGGGACATC-3’; YM-1, forward 5′-TCTGGTGAAGGAAATGCGTAAA-3 and reverse 5′-GCAGCCTTGGAATGTCTTTCTC-3′; Fizz-1, forward 5′-CAGCTGATGGTCCCAGTGAA-3′ and reverse 5′-TTCCTTGACCTTATTCTCCACGAT-3′. Quantification was performed utilizing the 2−ΔΔCt approach, where β-actin served as the housekeeping gene and samples were normalized based on unstimulated WT levels.
ROS measurement
BMDMs were seeded at 5*105 cells/ plate and were labeled with 5 uM of CellROX Deep Red (Invitrogen, cat. # C10422) at 37˚C for 30 min. Cells were also labeled with Zombie staining (Biolegend, cat. # 423105) to quantify viable cells. Cells were harvested and analyzed via flow cytometry by using the mean fluorescence intensity (MFI) in a logarithmic scale. Statistical analysis was performed with GraphPad using Bonferroni-Dunn unpaired t-test method.